9 entering a new organization

Telesales - Kĩ năng bán hàng qua điện thoại

Telesales - Kĩ năng bán hàng qua điện thoại

... Displaying an Organizational Contact in the eBusiness Center Header Viewing All Contacts at an Organization Entering a New Contact for an Existing Organization Entering a New ... information on creating custom reports on flexfields data Oracle eTechnical Reference Manuals Each eTechnical Reference Manual (eTRM) contains database diagrams and a detailed description of database ... Applications tables are interrelated, any change you make using Oracle Applications can update many tables at once But when you modify Oracle Applications data using anything other than Oracle Applications,...

Ngày tải lên: 13/01/2014, 14:14

256 10,4K 76
Activity 5.2: Creating Use Cases

Activity 5.2: Creating Use Cases

... 32 Activity 5.2: Creating Use Cases Exercise 1: Creating Use Cases ! Create uses cases for the consultants and administrative assistants Review the “Timesheet System” and “Timesheet Data Entry” ... case study Develop use cases for each section Develop as many as you can in the time allotted Divide your time equally between each section Use prose to describe each use case Identify the actor ... prose to describe each use case Identify the actor and system for each use case Next, you will discuss your answers with the class System Actor Use case ...

Ngày tải lên: 16/10/2013, 13:15

2 239 0
Activity 5.3: Creating Usage Scenarios

Activity 5.3: Creating Usage Scenarios

... 34 Activity 5.3: Creating Usage Scenarios Exercise 1: Creating Usage Scenarios You will create a total of six usage scenarios from the use cases that you identified in Activity 5.2 ! Create usage ... usage scenarios for the consultants and administrative assistants Work in groups assigned by the instructor Identify three use cases each for the consultants and the administrative assistants Review ... the class System: Actor: Use case: Scenario: Precondition: Task sequence Post condition: Exceptions Activity 5.3: Creating Usage Scenarios System: Actor: Use case: Scenario: Precondition: Task...

Ngày tải lên: 18/10/2013, 18:15

6 409 0
Creating the project office 19

Creating the project office 19

... change agent • Applies effective strategies for managing change and achieving successful contact across the organization • Expects resistance and plans for surprises • Tames organizational chaos ... organizing actions and tasks Each project is assigned a project manager Adequate resources are assigned to each project Managers and project staff have online project information Barriers are ... program manager Alfonso Bucero and his team implemented a project office and managed the cultural change using project management skills in a professional delivery organization Hewlett-Packard...

Ngày tải lên: 08/11/2013, 00:15

10 287 0
Tài liệu Activity 4.4: Creating a Future-State Usage Scenario pdf

Tài liệu Activity 4.4: Creating a Future-State Usage Scenario pdf

... 24 Activity 4.4: Creating a Future-State Usage Scenario Exercise 1: Creating a Future-State Use Case (30 minutes) ! Create a future-state use case Participate in small groups as assigned ... this space to create the future-state use cases Activity 4.4: Creating a Future-State Usage Scenario Exercise 2: Creating a Future-State Usage Scenario (30 minutes) ! Create a future-state usage ... and Bardell, Inc case study Review the current-state use cases and usage scenarios Create future-state use cases for the client billing process by using the current-state use case as a template...

Ngày tải lên: 10/12/2013, 16:16

4 418 0
Tài liệu Activity 10.1: Creating and Distributing Preliminary Components pptx

Tài liệu Activity 10.1: Creating and Distributing Preliminary Components pptx

... aware of possible component redundancy Distribute all the preliminary components based on data services according to where you have identified data services on the topology in Exercise Be aware ... 86 Activity 10.1: Creating and Distributing Preliminary Components Exercise 1: Creating Preliminary Service Type Based Components (10 minutes) ! Create preliminary components Participate in small ... types, create preliminary components for each business object by packaging the different services of each type into separate components For example, the Invoice business object would have an Invoice...

Ngày tải lên: 21/12/2013, 06:16

4 413 0
Tài liệu Activity 4.2: Creating a Logical Data Model ppt

Tài liệu Activity 4.2: Creating a Logical Data Model ppt

... actions that define the relationship between each pair of entities, and label the line with the relationship verb This is the initial ER diagram for the logical data model Answer in v04_160 9a_ act42-1.bmp ... cardinality and existence characteristics of each of the relationships defined in Exercise ! Identify cardinality For each relationship on your ER diagram, ask the question “How many of the parent ... the cardinality of each relationship and denote the entities as parent or child ! Identify existence ! For each relationship on your ER diagram, ask the question “Can the child exist if the parent...

Ngày tải lên: 21/12/2013, 06:16

4 410 0
Tài liệu Activity 11.2: Creating an Initial User Interface Design pptx

Tài liệu Activity 11.2: Creating an Initial User Interface Design pptx

... Incorporate terminology, concepts, and metaphors that are familiar to the consultant Activity 11.2: Creating an Initial User Interface Design Exercise 2: Design Feedback and User Assistance (10 ... 96 Activity 11.2: Creating an Initial User Interface Design Exercise 1: Designing a User Interface (15 minutes) Delivery Tip The instructions are deliberately somewhat vague so that students can ... Ferguson and Bardell, Inc case study, focusing on the section titled "Time Sheet System." Consider the activity of time reporting as performed by the consultant Design a user interface for that activity...

Ngày tải lên: 24/01/2014, 10:20

4 377 0
Tài liệu Báo cáo khoa học: Adaptive changes in the expression of nuclear and mitochondrial encoded subunits of cytochrome c oxidase and the catalytic activity during hypoxia pptx

Tài liệu Báo cáo khoa học: Adaptive changes in the expression of nuclear and mitochondrial encoded subunits of cytochrome c oxidase and the catalytic activity during hypoxia pptx

... of ATP (0.5–1 mM) for maximal activity Narasimhan and Attardi [41] showed that a high concentration of 5¢-adenylylimidodiphosphate was able to stimulate the Ó FEBS 2003 878 C Vijayasarathy et al ... mitochondrial RNA, subjected to autoradiography and quantified in a Bio-Rad GS 525 Molecular Imager Spectrophotometric analysis of CytOX activity and heme content CytOX was assayed in membrane fragments ... mitochondrial functions during hypoxia and a compensatory up-regulation of alternate energy generating systems Discussion Studies in yeast have demonstrated that oxygen acts as a molecular switch and alters...

Ngày tải lên: 20/02/2014, 23:20

9 561 0
Báo cáo khoa học: All-trans-retinoic acid inhibits collapsin response mediator protein-2 transcriptional activity during SH-SY5Y neuroblastoma cell differentiation pptx

Báo cáo khoa học: All-trans-retinoic acid inhibits collapsin response mediator protein-2 transcriptional activity during SH-SY5Y neuroblastoma cell differentiation pptx

... Ohshima T, Sasaki Y, Suzuki H, Yanai S, Yamashita N, Nakamura F, Takei K, Ihara Y, Mikoshiba K et al (2005) Semaphorin 3A signalling is mediated via sequential Cdk5 and GSK3beta phosphorylation ... regulates polarized Numb-mediated endocytosis for axon growth Nat Cell Biol 5, 819–826 10 Arimura N, Menager C, Kawano Y, Yoshimura T, Kawabata S, Hattori A, Fukata Y, Amano M, Goshima Y, Inagaki ... ment of Navarra, Spain and Asociacion de Amigos de la Universidad de Navarra, Spain We would like to thank F J Rauscher III (The Wistar Institute, Philadelphia, PA, USA) and Trevor Williams (University...

Ngày tải lên: 16/03/2014, 12:20

14 248 0
Báo cáo khoa học: A dideoxynucleotide-sensitive DNA polymerase activity characterized from endoreduplicating cells of mungbean (Vigna radiata L.) during ontogeny of cotyledons pptx

Báo cáo khoa học: A dideoxynucleotide-sensitive DNA polymerase activity characterized from endoreduplicating cells of mungbean (Vigna radiata L.) during ontogeny of cotyledons pptx

... 32p-GTTTTCCCAGTCACGAC 3’ 17-mer M13 Univ primer (-20 downstream oligo) Gap-3/OH 3’ GCGGTCCCAAAAGGGTCAGTGCTGCAACATTTTGCTGCCGGTCACGGTTCGAACGTACGGACGTCCA…5’ 5’ 32p-GTTTTCCCAGTCACGAC GTAAAACGACGGCCAGT 3’ ... DNA polymerase activity A S Roy et al M13 mp 18 (+) ss DNA template MCS EcoR1 Sac1 Xma1 BamH1 Xba1 Kpn1 Sma1 Acc1 HincII Sal1 Pst1 Sph1 HindIII ATGACCATGATTACGAATTCCGAGCTCGGTACCCGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTT ... 3’ (-20 downstream oligo) 3’ GCGGTCCCAAAAGGGTCAGTGCTGCAACATTTTGCTGCCGGTCACGGTTCGAACGTACGGACGTCCA…5’ 5’ 32p-GTTTTCCCAGTCACGAC GTAAAACGACGGCCAGT 3’ P (-20 downstream oligo) D Gap-3/P 5’/P C 5’/OH...

Ngày tải lên: 30/03/2014, 08:20

19 351 0
Báo cáo Y học: The DNA-polymerase inhibiting activity of poly(b-L-malic acid) in nuclear extract during the cell cycle of Physarum polycephalum pot

Báo cáo Y học: The DNA-polymerase inhibiting activity of poly(b-L-malic acid) in nuclear extract during the cell cycle of Physarum polycephalum pot

... polymerase a by poly(b-Lmalate) in the nuclear extract (d) The activity was measured as a function of added amounts of DNA polymerase a in the standard DNA polymerase assay that contained the extract ... radioactivity covalently attached to DNA polymerases was an indicator of the polymerase activity and was measured after SDS/PAGE by autoradiography Separate results are shown in Fig 2C for DNA ... plasmodia as described previously [11] DNase-I-activated salmon testis DNA for the standard DNA polymerase assay and for photoaffinity labeling was prepared as described previously [12] Rabbit antiserum...

Ngày tải lên: 31/03/2014, 21:21

6 349 0
báo cáo hóa học: " Identification of symptom domains in ulcerative colitis that occur frequently during flares and are responsive to changes in disease activity" ppt

báo cáo hóa học: " Identification of symptom domains in ulcerative colitis that occur frequently during flares and are responsive to changes in disease activity" ppt

... Demographics and disease characteristics of patients in the study Characteristics Gender Male Female Median [range] age (years) NIH Race Caucasian Asian or Pacific Islander Black American Indian/Alaskan ... criteria for defining a frequent and responsive symptom domain specifically stated that all three endpoints for a particular symptom domain had to have a median VAS rating that was significantly ... Visual analogue scale ratings of symptoms that are absent during remission A box plot of the VAS ratings of symptoms that are absent during remission All of the symptoms evaluated had VAS ratings...

Ngày tải lên: 18/06/2014, 19:20

12 383 1
báo cáo hóa học: " Kinematics and muscle activity of individuals with incomplete spinal cord injury during treadmill stepping with and without manual assistance" docx

báo cáo hóa học: " Kinematics and muscle activity of individuals with incomplete spinal cord injury during treadmill stepping with and without manual assistance" docx

... walk at faster speeds with manual assistance than without The average highest walking speed without manual assistance was 0.76 m/s The average walking highest speed with manual assistance was ... rootmean-square (RMS) for each step cycle within a trial for each muscle, and then averaged these values for an overall RMS value for each trial We also calculated separate RMS values for the stance ... R-value and smaller time shift at the knee joint in the comparison of walking with manual assistance to control data than in the comparison of walking without manual assistance to control data...

Ngày tải lên: 19/06/2014, 10:20

14 434 0
báo cáo hóa học:" Effect of shoe heel height on vastus medialis and vastus lateralis electromyographic activity during sit to stand" pdf

báo cáo hóa học:" Effect of shoe heel height on vastus medialis and vastus lateralis electromyographic activity during sit to stand" pdf

... ARV data for VM and VL, and the data for the VM: VL ratio were all tested for statistical significance For each of these variables, a × repeated measures analysis of variance (ANOVA) was carried ... 78:25-32 Janwantanakul P, Gaogasigam C: Vastus lateralis and vastus medialis obliquus muscle activity during the application of inhibition and facilitation taping techniques Clinical Rehabilitation ... calculate the ratio of VM: VL EMG activity for each condition Statistical analysis Data were analysed using the Statistical Package for Social Sciences (SPSS) version 11.5 The separate EMG ARV...

Ngày tải lên: 20/06/2014, 01:20

7 450 0
báo cáo hóa học:" Does a SLAP lesion affect shoulder muscle recruitment as measured by EMG activity during a rugby tackle?" potx

báo cáo hóa học:" Does a SLAP lesion affect shoulder muscle recruitment as measured by EMG activity during a rugby tackle?" potx

... humeral head Any delay in the activity of Serratus Anterior could impair scapular control e.g lateral (upward) rotation and protraction This would allow the humeral head to translate anteriorly and ... electrodes were placed cm apart, approximately cm distal to the inferior angle of the scapula, at an oblique angle of approximately 25 Horsley et al Journal of Orthopaedic Surgery and Research 2010, ... rate [14] The tackle appears to be the phase of play associated with the greatest risk of injury overall [3,15,16], yet there appears to be scant published research regarding the anatomical and...

Ngày tải lên: 20/06/2014, 04:20

10 238 0
báo cáo hóa học:" Physical activity and change in quality of life during menopause- an 8-year follow-up study" docx

báo cáo hóa học:" Physical activity and change in quality of life during menopause- an 8-year follow-up study" docx

... Physical activity and change in quality of life during menopause –an 8-year followup study Jaana M Moilanen1, Anna-Mari Aalto2, Jani Raitanen1,3, Elina Hemminki2, Arja R Aro4, Riitta Luoto3,5 ... authors: JMM: jaana.m.moilanen@uta.fi AMA: anna-mari.aalto@thl.fi JR: jani.raitanen@uta.fi EH: elina.hemminki@thl.fi ARA: araro@health.sdu.dk RL: riitta.luoto@uta.fi Correspondence to: Riitta Luoto ... JMM, AMA, ARA and EH planned the study questions and analysis JR and JMM were responsible for statistical analysis JMM prepared the first version of the manuscript All authors (RL, AMA, EH, ARA,...

Ngày tải lên: 20/06/2014, 16:20

20 307 0
Báo cáo lâm nghiệp: "Limitation of photosynthetic activity by CO 2 availability in the chloroplasts of oak leaves from different species and during drought" pdf

Báo cáo lâm nghiệp: "Limitation of photosynthetic activity by CO 2 availability in the chloroplasts of oak leaves from different species and during drought" pdf

... 1970s and early 1980s (Gaastra, 1959; Farquhar and Sharkey, 1982) Only in the last decade have limitations in CO influx other than by stomata or leaf boundary layer received increasing attention ... ducers in the laboratory allowing on line calculation of gas exchange, and digital control of chamber functions (technical details available on request) Actinic irradiance was provided by a slide projector ... here, and also lower than values measured in poplar leaves (0.66) results confirmed that in decreases of net assimilation rates associated to decreasing c , despite the apparent maintenance and...

Ngày tải lên: 08/08/2014, 18:21

12 347 0
Báo cáo y học: " Foot posture influences the electromyographic activity of selected lower limb muscles during gait" doc

Báo cáo y học: " Foot posture influences the electromyographic activity of selected lower limb muscles during gait" doc

... coverage angle; talus second metatarsal angle A - calcaneal inclination angle, B - calcaneal-first metatarsal angle, C - talo-navicular coverage angle, D - talus-second metatarsal angle Angle A ... angular measurements obtained from antero-posterior and lateral x-rays (talus-second metatarsal angle, talonavicular coverage angle, calcaneal inclination angle and calcaneal-first metatarsal angle) ... 0.11** AI arch index, NNHt normalised navicular height truncated, CIA calcaneal inclination angle, C1MA calcaneal first metatarsal angle, TNCA talo-navicular coverage angle, T2MA talus-second...

Ngày tải lên: 10/08/2014, 21:24

9 323 0
w