... NTLM or LAN Manager, and then attack the password hashes offline Threat is easily carried out with little skill required Both attacks enable an attacker to obtain a valid user account and password ... Module 8: Creating a Security Design for Authentication 13 When using LAN Manager and NTLM authentication protocols, consider: Removing LAN Manager password hashes LAN Manager password hashes are ... sent along with NTLM authentication messages for compatibility with older operating systems Because an attacker can easily crack LAN Manager password hashes, remove them from the account databases...
Ngày tải lên: 18/01/2014, 05:20
... this class of chemical substances a reasonable database exists that can be used for calibration Also, similar mechanisms for metabolic transformation may apply to this class of chemical substances ... the same parameters to tropical or arctic food webs Model calibration: To calibrate the model, a database was compiled of empirical BCF and BAF data for organic chemicals in fish and aquatic ... unable to predict metabolic transformation rates of chemical substances in aquatic biota However, if information on metabolic transformation rates are available from laboratory bioconcentration...
Ngày tải lên: 22/03/2014, 14:20
Báo cáo hóa học: " Development and application of a biomarker assay for determining the pharmacodynamic activity of an antagonist candidate biotherapeutic antibody to IL21R in whole blood" pptx
... that will be required upon hand-off for assay validation SJ, AW, SWA and KA performed the in vitro assays on monkeys treated with Ab-01 and control Ig and analyzed the data, and KA and SA performed ... 10.1 186 /1 479 -5 87 6 -8- 51 Cite this article as: Arai et al., Development and application of a biomarker assay for determining the pharmacodynamic activity of an antagonist candidate biotherapeutic antibody ... the American Association for Accreditation of Laboratory Animal Care guidelines The Wyeth Institutional Animal Arai et al Journal of Translational Medicine 2010, 8: 51 http://www.translational-medicine.com/content /8/ 1/51...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo khoa học: " A biosensor assay for the detection of Mycobacterium avium subsp. paratuberculosis in fecal samples" potx
... nanomolar detection limits Anal Bioanal Chem 2004, 3 78 , 15 87 - 1593 Baeumner AJ, Leonard B, McElwee J, Montagna RA A rapid biosensor for viable B anthracis spores Anal Bioanal Chem 2004, 380 , 15-23 Baeumner ... reading Negative Positive 52 1943 2 97 12 4 78 19 977 2 576 1 175 8 684 1 66115- 98 (Cattle) UN UN Human UN UN Hay/grass Human Negative Negative Negative Negative Negative Negative Negative 0 0 19 981 ... Human Human Human Bovine Dog Negative Negative Negative Negative Negative 40 Vijayarani Kumanan et al Specificity of the assay The specificity of the lateral-flow biosensor assay was evaluated...
Ngày tải lên: 07/08/2014, 23:22
báo cáo khoa học: "Combinatorial peptidomics: a generic approach for protein expression profiling" potx
... separate spectra from each of the samples were obtained by accumulation of data from 400 laser shots Peak areas were measured for each peak on each spectrum and average values were expressed as ... suitable for use with a variety of platforms, including traditional systems (columnbased co-IP), arrayed affinity reagents (antibody microarrays, e.g on MALDI plates) and a variety of micro- and ... nano-fluidic applications Except for a few obvious and easily accepted reasons for miniaturisation, such as increasing the throughput of an assay by packing more reaction chambers into the same...
Ngày tải lên: 11/08/2014, 00:22
Tracnghiem-U6-7-8-2011-A
... - HẾT Trang 2/2 - Mã đề thi 1 37 ...
Ngày tải lên: 14/05/2015, 19:00
Development and validation of a generic assay to detect compounds acting via an aggregation based mechanism
... βTween-20 (at Lactamase Lactamase 0.5nM β(µM) Lactamase) BZBTH2B BLAC-1 BLAC-2 BLAC-3 BLAC-4 BLAC-5 BLAC-6 BLAC -7 BLAC -8 BLAC-9 BLAC-10 BLAC-11 BLAC-12 BLAC-13 BLAC-14 0.43 0.61 1. 87 0.93 5.05 13 .85 ... reader-mostly fluorescence, luminescence and absorbance Reporting format “Representative” data; statistical analysis of manually curated dataset Automated analysis of all data using statistical ... assay plates Z-factor remained above the 0.5 cut-off across all plates (Fig 5) Average Zfactor for the 24 assay plates was 0 .71 with an SD value at 0.05 Figure 5: Z-factor trend across assay plates...
Ngày tải lên: 04/10/2015, 15:46
Genotoxicity of 255 chemicals in the Salmonella microsome test (Ames test) and 8-hydroxyguanine (8-OH-Gua) assay for the detection of carcinogens
... 8- oxodeoxyguanosine and 8- oxo-guanine, Proc Natl Acad Sci USA, 6, 288 -293 Maron, D.M and Ames, B.N (1 983 ) Revised methods for the Salmonella mutagenicity test Mutat Res., 113, 173 -215 Musarrat, ... genomic/nucleic DNA extraction for 8- hydroxydeoxyguanosine analysis of small amounts of rat liver tissue, Cancer Lett., 97, 233-239 Shigenaga, M.K., Aboujaoude, E.N., Cheon, Q and Ames, B.N (1994) Assays of ... nitroarenes and/or aromatic amines, YG3003 (hisD(G )8 476 /rfa/pAQ1/pKM101/mutMST::Kmr) strain (deficient in 8- hydroxyguanine DNA glycosylase) sensitive to oxidative chemicals, and YG71 08 (hisG46/rfa/d...
Ngày tải lên: 05/09/2013, 08:40
Giao a tuan 7-8 lop 4
... giá trò biểu thức a + b b + a để điền vào bảng a 20 350 12 08 b 30 250 276 4 a +b 20 + 30 = 50 350 + 250 = 600 12 08 + 276 4 = 3 972 b +a 30 + 20 = 50 250 +350 = 600 276 4 + 12 08 = 3 972 -GV: Hãy so sánh ... thức b + a a = 12 08 b = 276 4 ? -Vậy giá trò biểu thức a + b so với giá trò biểu thức b + a ? -Ta viết a +b = b + a -Em có nhận xét số hạng hai tổng a + b b + a ? -Khi đổi chỗ, số hạng tổng a + b ... -GV v a ghi bảng v a nêu: * (a + b) gọi tổng hai số hạng, biểu thức (a + b) +c có dạng tổng hai số hạng cộng với số thứ ba, số thứ ba c * Xét biểu thức a + (b + c) ta thấy a số thứ tổng (a + b),...
Ngày tải lên: 29/09/2013, 15:10
Tài liệu Module 7: Creating a Security Design for Accounts pdf
... Anyone who can manage an account can change the rights and permissions of the account or disable its use Anyone who can manage a password to an account can, at any time, access all of the information ... account passwords for non-System accounts are stored as LSA secrets, which an attacker can extract If the account is a domain account, an attacker who extracts the password from a computer can ... information that the account can access Who can obtain account information Account information often includes personal data, such as home addresses, birthdates, and telephone numbers Each account...
Ngày tải lên: 18/01/2014, 05:20
Tài liệu Practical mod_perl-CHAPTER 8:Choosing a Platform for the Best Performance docx
... (RAID) An array of physical disks, usually treated by the operating system as one single disk, and often forced to appear that way by the hardware The reason for using RAID is often simply to achieve ... a high data-transfer rate, but it may also be to get adequate disk capacity or high reliability Redundancy means that the system is capable of continued operation even if a disk fails There are ... Sometimes a simple OS upgrade to the latest stable version can save you an expensive hardware upgrade Also, remember that when you buy new hardware, chances are that the latest software will make the...
Ngày tải lên: 26/01/2014, 07:20
Tài liệu Báo cáo khoa học: TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses pdf
... Biotin-TCGACTAGAAGCTTCTAGAAGCTTCTAG AGCTGATCTTCGAAGATCTTCGAAGAT Biotin-TCGACTTCAAGCTTGTACAAGCTTGTAG AGCTGAAGTTCGAACATGTTCGAACATC Biotin-AACGACGGTCGCTCCGCCTGGCT nM Unlabeled HSE DNA-binding activity ... performance of a 384 -well plate immunoassay, named TransLISA, for measuring the DNA-binding activity of a transcription factor (Fig 1B) This assay is the first homogeneous, nonradioactive assay for ... confirm that the assay specifically measures HSF1 DNA-binding activity Analytical range and precision The analytical range of the assay was evaluated using known concentrations of recombinant human HSF1...
Ngày tải lên: 18/02/2014, 14:20
Báo cáo khoa học: 7,8-Diaminoperlargonic acid aminotransferase from Mycobacterium tuberculosis, a potential therapeutic target Characterization and inhibition studies pptx
... of KAPA concentration gave: KiKAPA ẳ 14 lm, KmAdoMet ẳ FEBS Journal 273 (2006) 477 8 4 78 9 ê 2006 The Authors Journal compilation ê 2006 FEBS 4 78 1 M tuberculosis DAPA aminotransferase A S Mann and ... measured at various AdoMet and KAPA concentrations n 20 lM KAPA; h 50 lM KAPA; d 70 lM KAPA; s 100 lM KAPA; r 140 lM KAPA (B) Replot of the ordinate intercepts against KAPA concentrations Data ... 0.1 mm PLP, 20 lm KAPA, mm AdoMet and DAPA AT (0.65 lg) The assay was run as described above for the coupled assay The DAPA formed was quantied by the standard disc bioassay procedure using E...
Ngày tải lên: 07/03/2014, 11:20
Báo cáo khoa học: Structural and functional roles for b-strand 7 in the a-crystallin domain of p26, a polydisperse small heat shock protein from Artemia franciscana pdf
... 5¢-GGACACGTACAAGGAGAATTTCGACGACG-3¢ 5¢-CGTCGTCGAAATTCTCCTTGTACGTGTCC-3¢ 5¢-CACGTACAAAGAGAACGTCGACGACG-3¢ 5¢-CGTCGTCGACGTTCTCTTTGTACGTG-3¢ 5¢-GAGAATTTCGAGCACGATACAGACTCCC-3¢ 5¢-GGGAGTCTGTATCGTGCTCGAAATTCTC-3¢ ... Sciences and Engineering Research Council of Canada Discovery Grant, a Nova Scotia Health Research Foundation ⁄ Canadian Institutes of Health Research Regional Partnership Plan Grant, and a Heart and ... Weleber RG (19 98) Autosomal dominant congenital cataract associated with a missense mutation in the human alpha crystallin gene CRYAA Hum Mol Genet 7, 471 – 474 63 Vicart P, Caron A, Guicheney P,...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: A simple in vivo assay for measuring the efficiency of gene length-dependent processes in yeast mRNA biogenesis doc
... sua7D1[pRS314 ⁄ SUA7] MATa ura3–52 trp1D63 sua7D1[pRS314 ⁄ sua7-L50D] MATa ura3–52 trp1D63 sua7D1[pRS314 ⁄ sua7-K205E] MATa leu2D1 ura3 his4–912d lys2–128d MATa leu2D1 ura3–52 mot1–1 MATa ura3 his4–912d ... RN & Kane CM (2002) Promoting elongation with transcript cleavage stimulatory factors Biochim Biophys Acta 1 577 , 2 87 3 07 28 Kobayashi A, Miyake T, Ohyama Y, Kawaichi M & Kokubo T (2001) Mutations ... met15D0 ura3D0 ⁄ ura3D0 dst1::KAN ⁄ DST1 MATa ade2 trp1leu2 his4–912d lys2–128d ura3::GAL1-lacZ::URA3 spt16–1 97 MATa ura3 his4–912d lys2–128d MATa ura3 his4–912d lys2–128d spt6–140 MATa ura3 his4–912d...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: Epoxidation of benzo[a]pyrene-7,8-dihydrodiol by human CYP1A1 in reconstituted membranes Effects of charge and nonbilayer phase propensity of the membrane pot
... UK), and the [14C]Ole2PtdCho was from Amersham Pharmacia Biotech (Freiburg, Germany) For the preparation of (+) -7, 8- diol and (–) -7, 8- diol, racemic 7, 8- diol was synthesized [20] and chromatographically ... enzymatic assays, usually or 10 pmol (vesicular) CYP 1A1 Enzyme assays The epoxidation assays were performed as described for the racemic 7, 8- diol [7] with the following modifications: incubations ... Considering all the data, the observed increase in the formation of DE2 is caused, at least partially, by a lipid-induced conformational change This change mediates more favourable active site spatial...
Ngày tải lên: 08/03/2014, 10:20
HiPath 3000/5000 Version 4.0Service Manual..Important information1 2 3 4 5 6 7 8 9 10 11 12 A B doc
... Table 3 - 78 Table 3 -79 Table 3 -80 Table 3 -81 Table 3 -82 Table 3 -83 Table 3 -84 Table 3 -85 Table 3 -86 Table 3- 87 Table 3 -88 Table 3 -89 Table 3-90 Table 3-91 Table 3-92 Table 3-93 Table 3-94 Table 3-95 ... 3-60 Table 3-61 Table 3-62 Table 3-63 Table 3-64 Table 3-65 Table 3-66 Table 3- 67 Table 3- 68 Table 3-69 Table 3 -70 Table 3 -71 Table 3 -72 Table 3 -73 Table 3 -74 Table 3 -75 Table 3 -76 Table 3 -77 Table ... Safety Information for Australia ● Privacy and Data Security, page 1-14 ● Related Documents, page 1-15 ● Information on the Intranet, page 1-16 Important Notices (for U.S and Canada only), page...
Ngày tải lên: 22/03/2014, 15:21