... modular, scalable architecture of the multi- agent paradigm provides computational scalability and flexibility for agents entering and leaving agent communities The multi- agent paradigm can also make ... Integration of the evaluation metric of text classification and the multi- agent paradigm may provide us a powerful tool to validate the approach of automatic text classification using a multi- agent ... using a multi- agent framework, where data and computation are distributed across a network of computers 1.1 Manual Classification In library and information science, class/classification and category/categorization...
Ngày tải lên: 13/11/2014, 09:10
... a w m a te ria l A A D D A A D D D D B E E F G A B D F B A D D A C B C C C C Ra w m a te ri a l C C Re a dy P a rt A R e a dy P a rt B A B R e a d y P a rt M ac hin es / R es ourc e s a re g ... changes and simultaneously be guided by those agents with global views Recent research on the foraging behaviour of a natural MAS, namely an ant colony, has found that autonomous agents like ants ... reaches a steady state and the performance data are recorded from that point Next the simulation continues for a certain period of time and an average steady-state performance of the approach...
Ngày tải lên: 13/09/2015, 20:40
Tài liệu Teamwork in Multi-Agent Systems: A Formal Approach pptx
... behind TeamLog from Kim Does, Harmen Wassenaar, Alina Strachocka and Andrzej Szałas In addition, Kim, Michał and Alina also offered a great support by bringing numerous technical tasks to a successful ... (1977), axiom A2 has been named K and principle A3 has been named T Already in Lewis and Langford (1959), A4 was referred to as and A5 as Later, axiom A6 has been named D Thus, different systems are ... www.it-ebooks.info 12 Teamwork in Multi- Agent Systems developers when tailoring a multi- agent system for a specific application, especially when both software agents and humans operate in a multi- agent environment...
Ngày tải lên: 18/02/2014, 15:20
A general framework for multi agent task selection
... distributed manner This framework is robust to changes and adaptable to a dynamically changing map and a dynamically changing number of agents A Utility Function has been developed as a performance measure ... should an agent pick so as to optimise the overall performance of the multi- agent system?” A task can be defined as a subgoal of the overall mission of the multi- agent 1.2 Applications of Multi- Agent ... coordinated manner with minimal reliance on communications 1.1 Challenges of Multi- Agent Systems While the use of multi- agents has many advantages over their single agent counterpart, managing and...
Ngày tải lên: 09/09/2015, 10:15
A collaborative, multi agent based methodology for abnormal events management
... Total number of variables in a multivariate data Variables σ Standard deviation of the training data x A A software agent used in the multi- agent environment Cj The class representation of data ... Imaging and fermentation projects I would like to thank all my lab mates, Jonnalagadda Sudhakar, Arief Adhitya, Mukta Bansal, Nguyen Trong Nhan, Mohammad Iftekhar Hossain, Li Jie, Manish Mishra, ... temporal data The scatter diagram or scatter plot has been a popular tool for visualizing the correlation among multivariate data using two dimensional graphs by displaying all pairs of variables against...
Ngày tải lên: 11/09/2015, 21:20
A distributed, cooperative multi agent system for real time traffic signal control
... (such as agents I5 and I6), these teams are variable and agents can switch teams as in seen in situations A and B 38 After a certain amount of time, each agent evaluates its need for cooperation ... Cooperative agents can be organised in a non-hierarchical level, where every agent has the same say in decision-making, or in a hierarchical way, where groups of agents are grouped and one agent takes ... who acts for or in the place of another Agents are rarely used alone and therefore the notion of social ability is an important one [28] A multi- agent system (MAS) is basically a collection of agents...
Ngày tải lên: 16/09/2015, 12:35
Multi agent systems on wireless sensor networks a distributed reinforcement learning approach
... approach to multi- agent learning is to regard the MAS as a large single agent whose state and action spaces are the concatenation of the local state and action spaces of the different agents The system ... could fail at critical times Finally, MAS are usually simpler to program by distributing the system’s functions among several agents All of the above advantages of MAS make them a practical and ... observability is to enable the agents to exchange information via communication 2.3.2 Multi- agent learning with communication Allowing agents to communicate with one another in a multi- agent domain...
Ngày tải lên: 26/11/2015, 13:03
To develop a database management tool for multi agent simulation platform
... (DW/DWH), database query and report, (multidimensional) Online Analytical Processing (OLAP), data analysis, data mining and visualization (Gangadharan and Swami, 2004; Ranjan, 2009) Generally, BI ... data management solution of huge datasets in agent based simulation systems: data management tools are currently needed in agentbased simulation systems and database management is an important ... 178 A. 6.3 Test a connection to OLAP database 179 A. 6.4 Select data from OLAP database 180 A. 7 Working with Spatial Databases 181 A. 7.1 Create a spatial database ...
Ngày tải lên: 22/05/2016, 11:33
Báo cáo y học: " Introduction of Medical Emergency Teams in Australia and New Zealand: a multi-centre study"
... of data as baseline and the second year as comparator Finally, an additional and similar analysis was performed for hospitals that had participated in the MERIT study A P value of less than 0.05 ... hospitals participating in the Medical Emergency Response and Intervention Trial ANZICS-APD, Australian and New Zealand Intensive Care Society Adult Patient Database tals, and tertiary hospitals ... numbers and as a percentage of overall cases or events Data on adverse events (ICU admission due to ward CA and readmission to ICU) are presented as means ± standard deviation for absolute values and...
Ngày tải lên: 25/10/2012, 10:35
Optimization of design and operating parameters on the year round performance of a multi-stage evacuated solar desalination system using transient mathematical analysis
... Non-conventional solar stills with charcoal particles as absorber medium Desalination 2003, 153(1-3), 55–64 [3] Al-Abbasi M .A. , Al-Karaghouli A. A., Minasian A. N Photochemically assisted solar desalination ... variation of global solar radiation and ambient temperature at Chennai for January to June _ Solar radiation -Ambient temperature Figure Mean monthly hourly variation of global solar radiation ... temperature from the flat plate collectors, latent heat and refined latent heat of vaporization of water from each stage and specific heat capacity of water from each stage are averaged over the day...
Ngày tải lên: 05/09/2013, 16:11
Developement of Multi-Agent system (MAS) model for Bac Lieu case study
... of MAS is formalizing the necessary coordination among agents The theory of agents is therefore a theory of Decision-making: what decision-making mechanisms are available to the agent? What are ... a computerized process, something that comes between a computer program and a robot An agent can be described as autonomous because it has the capacity to adapt when its environment changes A ... non-acid surface (high), medium deep acid surface soil (medium), low shallow acid surface soil (low) Sluices at the intersection between main canal and primary canal are open or closed Data are available...
Ngày tải lên: 16/10/2013, 01:15
Tài liệu A.7. The Setup Assistant ppt
... is a big moment You're about to create your account— your Administrator account, in fact, as described in Chapter 12 All you have to is make up a name, usually a short variation of your name and ... iPhoto, and so on (If you have a Mac account—see Section 18.6—put that account info here Registration Information This is your chance to become a grain of sand on the great beach of the Apple database ... When you click Transfer, the data-copying process begins Figure A- 2 The Migration Assistant is actually pretty amazing It brings over to your new Mac (or new Mac OS X installation) all of the files,...
Ngày tải lên: 14/12/2013, 13:15
Tài liệu Lab A: Creating and Configuring a Management Agent pdf
... Management Agent box, click Tutorial HR (LDIF) Management Agent, and then click Create The Configure the Management Agent dialog box appears Configure HR MA to place metaverse namespace data ... mmsadmin@nwtraders.msft with a password of password Create an instance of the HR tutorial management agent called HR MA a In the control pane of MMS Compass, click Bookmarks, click Management Agents, and ... 2 Lab A: Creating and Configuring a Management Agent Exercise Creating an HR Management Agent In this exercise, you will use MMS Compass to create and configure the HR tutorial management agent...
Ngày tải lên: 18/01/2014, 05:20
Tài liệu How to build a Multi-Level Money Machine docx
... be a pyramid infinite variations of legal and illegal marketing programs For that reason, multiOnly a few sophisticated states have level and anti-pyramid laws are drafted and statutes that specifically ... who mainly retails may not always break away, yet, breakaway qualifications must be achievable with a fair amount of effort by a serious business-builder A x Matrix means that everyone can have ... evaluate a company an energy drink, meal replacement bars, a Are they unique and exclusive? Ideally, multi- vitamin, antioxidants and fiber caplets you want products that are only available from And...
Ngày tải lên: 24/01/2014, 07:20
Tài liệu supervised tactical mobility behavior modeling and control of multi agent robotic vehicles doc
Ngày tải lên: 13/02/2014, 08:20
Tài liệu Mental Health in a Multi-ethnic Society A Multi-disciplinary Handbook docx
... and the paper indicates that these so-called anomalies are found among black Americans, Africans, Asians and ‘American Indians’ It is not necessarily the racial prejudices of individual research ... interest in multicultural and anti-racist education and spent a year in India researching the education of children Later, while working at the Confederation of Indian Organisations, Amanda carried ... issues of race and culture, etc.), it is not just a theoretical, academic definition of ‘mental health’ that is required, but an evaluation of what mental health actually means as a practical proposition...
Ngày tải lên: 15/02/2014, 02:20
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf
... AGTAAGGAAAATAAGCTTGGGCATGATCCC GCTCACTGCCTAAGCTTTGTAGCTAATAAAG CTTTATTAGCTACAAAGCTTAGGCAGTGAGC CTTTGTTATTTATTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAATAAATAACAAAG CTTTGTTAAAGCTTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAAGCTTTAACAAAG ... SJS170 ALS030 SJS209 SJS275 SJS276 CGGAAGATCTAACTAAGCGTGCTGCTTC TACGAGATCTGTTGTTTGGAAGCAGGTT CGGAAGATCTGGGATCATGCCCATTTAG TACGAGATCTTAGCTACATTAAATAGGC GGGATCATGCCCAAGCTTATTTTCCTTACT AGTAAGGAAAATAAGCTTGGGCATGATCCC ... AACTCACCATAGGAATGCATAAGCTTTAACAAAG CCTCTTACACTTGCTTTTGAC GCAAAGGTGCCTTTGAGGTTG GACCCCTTCATTGACCTCAACTA CTTGATTTTGGAGGGATCTC TTAGCTACATTAAATAGGCAG GtaatacgactcactataGGGATCATGCCCATTTAG Forward (nt 1281–1298...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khóa học: A multi-protein complex containing cold shock domain (Y-box) and polypyrimidine tract binding proteins forms on the vascular endothelial growth factor mRNA Potential role in mRNA stabilization pptx
... (2001) Release of pro- and antiangiogenic factors by human cardiac fibroblasts Biochim Biophys Acta 1538, 273–282 10 Balasubramanian, S., Ramakrishnan, S., Charboneau, R., Wang, J., Barke, R .A & Roy, ... K., Aihara, Y., Yokoyama, T., Arai, M., Kanda, R & Kurabayashi, M (2000) Induction of VEGF gene transcription by IL-1beta is mediated through stressactivated MAP kinases and SP1 sites in cardiac ... G.), a Cancer Council of South Australia project grant (L S C.), an RAH/IMVS project grant (L S C) and a National Health and Medical Research Committee program grant (M A V, G J G.) References Yancopoulos,...
Ngày tải lên: 19/02/2014, 12:20
On the Segregation of Genetically Modified, Conventional, and Organic Products in European Agriculture: A Multi-market Equilibrium Analysis doc
... Biotechnology and Organic Agriculture: National Organic Standards, Labeling and Second-Generation of GM Products Paper presented at the AAEA annual meeting, Montreal, Canada, July Golan, E., Kuchler, ... Chain: The Market and Welfare Effects of Different Labeling and Regulatory Regimes American Journal of Agricultural Economics 86(1): 42-60 32 Giannakas, K., and Yiannaka, A (2003) Agricultural Biotechnology ... health, environmental, and animal-welfare considerations, other consumers may, ceteris paribus, prefer conventional food based on other quality attributes (such as appearance, integrity, and taste)...
Ngày tải lên: 05/03/2014, 20:20
Báo cáo khoa học: "Enriching the Output of a Parser Using Memory-Based Learning" potx
... informative to compare our results with those reported in (Blaheta and Charniak, 2000) for this same task Blaheta and Charniak measured tagging accuracy and precision/recall for functional tag identification ... for evaluation on bare labels suggests that our approach is capable not only of adding functional tags, but can also correct the parser’s phrase labels and partof-speech tags: for Collins’ parser ... parser itself, but is available in a treebank Using the method with two state of the art statistical parsers and the Penn Treebank allowed us to recover functional tags (grammatical and semantic),...
Ngày tải lên: 08/03/2014, 04:22