... VIETNAM NATIONAL UNIVERSITY, HANOI VIETNAM NATIONAL UNIVERSITY, HANOI UNIVERSITY OF LANGUAGES AND INTERNATIONAL STUDIES UNIVERSITY OF LANGUAGES AND INTERNATIONAL STUDIES FACULTY OF POST - GRADUATE ... chemical A locate B smallest C surprise D depend A mystery B understand C overcome D submarine A Atlantic B paragraph C Antarctic D.contribute A vegetation B eliminate C disappearance D intonation ... frightening number of illiterate students are graduating from college XII A unable to read and write B able to join intramural sport C inflexible D unable to pass an examination in reading and writing
Ngày tải lên: 16/02/2020, 14:34
... with oral communication in a foreign language and this can often lead to stress, discouragement and lack of interest in learning Having been teaching English for several years at a secondary school, ... communication among humans We can easily say that people speak more than they write, so speaking is also probably the main goal for anyone studying a foreign language Despite so, it can be often ... effort at all when practicing their speaking skills Also, they felt embarrassed and contained from speaking in front of their mates, showing annoyance, bother and no collaboration, especially,
Ngày tải lên: 16/02/2020, 14:45
An exploratory study on teachers’ use of the textbook tieng anh thi diem 10 in the classroom at a high school in quang ninh
... tourists can see and there * Suggested destination • Cat Ba National Park • Nui Chua National Park • Phu Quoc National Park Three groups have prepared the presentation at home come to blackboard and ... in pairs Choose one destination and make a similar conservation as in XXX S: (Practice in pairs) Activity 3: Choose one ecotourism destination in Viet Nam and prepare a presentation about what ... today we can learn more about interesting places culture and traditions in Vietnam but also in our Hometown Quang Ninh Thus can recognize that our hometown Quang Ninh has many beautiful values and
Ngày tải lên: 16/02/2020, 14:45
Differentiation and catering for differing intelligences of students in the classroom an experimental research at a primary school in ha noi
... differentiation is a pedagogical, rather than an organizational approach Differentiation shapes an approach to teaching in which teachers proactively modify curricula, teaching methods, resources, learning ... of animals/ TYPES OF MI Visual – Spatial, Bodily-Kinesthetic insects Measuring height and weight Mathematical – Logical, Naturalist of some animals/ insects Presentation: some kinds of Musical-Rhythmic, ... Language Teaching Methodology Code: 8140231.01 HANOI, 2018 VIETNAM NATIONAL UNIVERSITY, HANOI UNIVERSITY OF LANGUAGES AND INTERNATIONAL STUDIES FACULTY OF POST-GRADUATE STUDIES LƯU THỊ MAI THANH
Ngày tải lên: 16/02/2020, 14:46
Improving english vocabulary learning for students of medical english at a medical college in hanoi through games an action research project
... is an essential part in learning a foreign language One of the most important issues in second language teaching and learning is vocabulary learning And, perhaps, one of the most difficult aspects ... challenging tasks facing any language teachers is to capture students’ interest, and therefore, keep them in high learning spirit Meanwhile, vocabulary learning is a hard task which can sometimes ... planning At first, teachers should have a specific plan of using games in teaching medical English vocabulary, which refers to what kind of games to be used, the time when teachers use that game and
Ngày tải lên: 16/02/2020, 14:48
An investigation into the use of group work to teach speaking to large english classes at a police university in vietnam
... some above findings, it can be found out that using group work can bring many benefits in the process of teaching and learning speaking skills This research can be a suggestion for teachers and ... participating students As can be seen from the table, there was a considerable increase in numbers of participants Students’ participation in speaking lessons became more positive and enthusiastic ... (1997) Focus on speaking Sydney: National Center for English Language Teaching and Approach Canale, M (1983) From communicative competence to communicative language pedagogy In Richards, J.C & Schmidt,
Ngày tải lên: 09/03/2020, 19:08
An action research project on using pictures to encourage 4th graders to participate in speaking activities at a primary school in bac ninh province
... What are your own changes after taking part in the English speaking activities using pictures? You can choose more than one options A I am more motivated to listen and speak in English B I have ... ruins Akiko‟s sandcastle groups - Play the recording a few time for Ps to listen and repeat Do choral and individual repetition, pointing to the - Copy in their characters speaking notebook - Ask ... Ask ps to role play the dialogue in - Malaysia: Work in pairs pairs Nước Ma-lai- Play the recording again for Ps to xi -a Whole class listen and say along - America: - Give the meaning of some new
Ngày tải lên: 20/08/2020, 14:22
An investigation into 10th grade students’ out of class learning at a high school in lao cai province
... Reimagining the self: What translanguaging practices and project-based work can for multilingual international students’ creative agency Presentation at the 2017 American Association for Applied ... Language Education in Asia, 2(2), 246-256 Hadfield, J (1990) Intermediate Communication Games England: Longman Holden, S (1981) Drama in Language Teaching Longman Hyland, F (2004) Learning autonomously: ... Language and Linguistics Tavakoli, N., Shakeri, N, Ghanbarzadeh, T (2016) Language Learning Beyond the Classroom International Journal Research in Linguistics, Language Teaching and Testing,
Ngày tải lên: 20/08/2020, 14:22
Using pre reading activities to enhance students’ reading interests an action research project at a high school in ba vi district, ha noi
... observation and teaching diaries and then the data were analyzed quantitatively and qualitatively The results of the data analysis indicate that students have relatively low interest in reading lessons ... great support and to many of my colleagues for their notable assistance ii ABSTRACT An important goal of language teaching is to awaken learners‟ interest in language and also to give them a lasting ... Provides final feedback the sea The material that makes up the glass window has the ability to wash away the dirt in the rain An aeroplane “ Its wings and shape imitating those of birds” A submarine:
Ngày tải lên: 26/08/2020, 23:07
EFL TEACHERS’ AND STUDENTS’ PERCEPTIONS AND PRACTICES REGARDING LEARNER AUTONOMY: AN EXPLORATORY STUDY AT A VIETNAMESE UNIVERSITY IN THE MEKONG DELTA
... Coding questionnaire and interview data 59 3.5 Data analysis 59 3.5.1 Qualitative data analysis 59 3.5.1.1 Transcribing data 59 3.5.1.2 Translating data ... programs at university I can set up my learning long-term goals independently and clearly I can set up my learning short-term goals independently and clearly I can design my learning plan in details ... how many minutes of subjects I intend to learn on that day But my learning is interrupted by many factors For example, after having dinner, it’s time for LA and I tell myself that I want to watch
Ngày tải lên: 22/09/2020, 17:05
Báo cáo y học: "Identification of an endogenous retroviral envelope gene with fusogenic activity and placenta-specific expression in the rabbit: a new "syncytin" in a third order of mammals" ppt
... 5'TTCCTGAGGGCTCACTGATTAAC and 5'-GAAGGGGAGAGTCAGTTGTTGGAG (external to the ORF) or 5'AGACTGCGGAGATAAAACTGC and 5'-gataaaggtcatcagcctattga (internal to the ORF) PCR products were then cloned in pGEM-T ... cellular and a syncytial trophophoblast layer separating maternal and fetal blood spaces (maternal lacuna, ml, and fetal vessels, fv) All of these characterize the definitive labyrinthine placenta ... representatives, the rabbit (Oryctolagus cuniculus), has an already sequenced genome, and can be reared and investigated easily at different stages of gestation, and has a placental physiology that has...
Ngày tải lên: 12/08/2014, 23:22
báo cáo khoa học: " Light has a specific role in modulating Arabidopsis gene expression at low temperature" potx
... At5 g63790 and ATAF2, At5 g08790), three AP2/ERF-domain proteins (At2 g23340, At5 g05410 and At4 g23750), five zinc finger proteins (At2 g47890, At5 g04340, At1 g06040, At1 g51700 and At5 g54470), a homeobox (At4 g08150), ... Ascorbate Reductase Genes At4 g35090 catalase (Up) At3 g09940 monodehydroascorbate reductase At3 g52880 monodehydroascorbate reductase At1 g20630 catalase (Down) At1 g75270 dehydroascorbate reductase At5 g03630 ... error of a mean (s.e., n = or 4) was calculated for each normalized ratio value presented in the Tables All original data containing normalized ratios of means, standard errors of the mean and t-test...
Ngày tải lên: 12/08/2014, 05:20
Students’ perceptions and practices of learner autonomy in learning english reading comprehension – an exploratory study at a private university in bac ninh province
... 3.1 Quantitative data .42 3.1.1 Data management and coding 42 3.1.2 Quantitative data analysis 44 3.2 Qualitative data .52 3.2.1 Data management and coding ... in- depth understanding of research problems by combining quantitative and qualitative data, and explaining the quantitative results in more detail with qualitative data The data collection instruments ... data to perform a quantitative analysis (called quantitizing) and conversion from quantitative data to perform a qualitative 31 analysis (called qualitizing) There is only one inference to make...
Ngày tải lên: 19/07/2017, 19:26
Management in India: Grow from an Accidental to a Successful Manager in the IT & Knowledge IndustryA real-world, practical book for a professional in his journey to becoming a successful manager in IndiaRahul Goyalprofessional expertise distilled doc
... maintains a blog at http://pankajghanshani.com, and you can follow him on Twitter at @PankajGhanshani and find him on Linkedin at http://www.linkedin.com /in/ pankajghanshani www.PacktPub.com Support ... can lead to an information gap that is readily filled by the grapevine This has created a new kind of challenge for managers—that of finding a reliable source of information and keeping an adequate ... Maslow and Mcclelland's theories of motivation We look at what is motivating in today's workplace and also what is de-motivating Finally, we peek into signs of low motivation that managers can...
Ngày tải lên: 23/03/2014, 13:20
báo cáo khoa học: "A statistical model for genotype determination at a major locus in a progeny test design" ppt
... conditional on their genotypes -y,, is multinormal with - a mean I - variance-covariance matrix ’ a where Similarly, the vector and variance-covariance matrix of the mean R; , ; Y, of the ti’&dquo; and ... estimations of the parameters is defined in another way and calculate at each step the probability p, We, u) can be used in have to now, have : The we and probabilities ,n, We shall have a are ... evaluation and genetic trends In : Proc Anim Breed Genet Symp in honor of Dr J.L Lush, 10-41, American Society of Animal Science and American Dairy Science Associations, Champaign, Illinois ALOUEL...
Ngày tải lên: 09/08/2014, 22:22
Báo cáo y học: "Trauma admissions to the Intensive Care Unit at a reference Hospital in Northwestern Tanzania" ppsx
... analysis, manuscript writing & editing MM and JBM participated in data analysis and manuscript writing WM supervised the study and contributed in data analysis, manuscript writing & editing All ... contributed in study design, literature search, data analysis, manuscript writing & editing JMG and RMD participated in study design, data analysis, manuscript writing & editing MDM participated in data ... including Tanzania, injuries in general are increasing due to increase in urbanization, motorization, civil violence, wars and criminal activities [3] In these countries, major trauma remains a major...
Ngày tải lên: 13/08/2014, 23:20
a study on projection and its realization in president barack obama’s speech at a campaign event in las vegas
... between a dependent clause and its dominant clause In parataxis, clauses are independent of one another According to Halliday (1994:221), “the paratactic relation is logically symmetrical and transitive” ... two clauses are equal, Halliday & Matthiessen (2004: 374) calls relation “parataxis” in which one clause is initiating and the other continuing Contrary to “parataxis” is “hypotaxis”, the relation ... According to Halliday & Hasan (1985) cited in Martin & Rose (2007), mode refers to what part of language is playing and what the participants expect the language to for them in a certain situation The...
Ngày tải lên: 02/03/2015, 14:22