2 3 dioxygenase and regulatory t cells

NGUYỄN hữu LONG TỔNG hợp và THỬ tác DỤNG ức CHẾ INDOLEAMIN 2,3 DIOXYGENASE 1 của một số dẫn CHẤT PROPANAMID THƠM MANG KHUNG 6 AMINO 1h INDAZOL KHÓA LUẬN tốt NGHIỆP dược sĩ

NGUYỄN hữu LONG TỔNG hợp và THỬ tác DỤNG ức CHẾ INDOLEAMIN 2,3 DIOXYGENASE 1 của một số dẫn CHẤT PROPANAMID THƠM MANG KHUNG 6 AMINO 1h INDAZOL KHÓA LUẬN tốt NGHIỆP dược sĩ

... vị trí “pocket” B với các nhóm thế có thể tạo tương tác Van de Waals với Phe226 và Arg231 - Các nhóm thế khác trong phân tử tạo liên kết hydro với Cys129, Ser167, Gly262, Ala264 và 7-propionat ... nitro trong môi trường etanol axetat (EA) với tác nhân SnCl2.2H2O và xúc tác HCl Phương trình phản ứng được trình bày rõ ràng. Sơ đồ 3.10 Quy trình tổng hợp của các chất Va-e a Tổng hợp chất 3-(6-amino-1H-indazol-1-yl)-N-phenylpropanamid ... nằm ở “pocket” A tương tác trực tiếp với nhân hem cần thiết cho hoạt tính - Nguyên tử brom ở vị trí số 6 làm tăng hoạt tính do tạo tương tác kỵ nước với Tyr126, Phe164, Leu234 Cầu nối 4-amin giữa...

Ngày tải lên: 11/12/2021, 18:34

79 5 0
activation of myeloid dendritic cells effector cells and regulatory t cells in lichen planus

activation of myeloid dendritic cells effector cells and regulatory t cells in lichen planus

... contribute to the adaptive responses of CD4+ or CD8+ T cells, which are mainly related to the secretion of IL-17 (Th17/Tc17 cells), IL-22 (Th22/Tc22 cells) and IFN-γ (Th1/Tc1 cells) To date, the ... exhibit increased frequencies of Th22 and Tc22 cells To evaluate the frequencies of Th22 and Tc22 cells in peripheral blood, we analysed production of the cytokines IL-17, IFN-γ and IL-22 in T cells ... frequencies of Th22 and Tc22 cells compared to the HC group; this trend remained for Th22 cells follow-ing stimulation with SEB (Fig. 4b) TLR activation induces the production of polyfunctional T cells...

Ngày tải lên: 08/11/2022, 15:02

11 2 0
induced nitric oxide synthase inos and indoleamine 2 3 dioxygenase ido detection in circulating monocyte subsets from brazilian patients with dengue 4 virus

induced nitric oxide synthase inos and indoleamine 2 3 dioxygenase ido detection in circulating monocyte subsets from brazilian patients with dengue 4 virus

... Earlier studies demonstrate that both monocyte subsets– CD16−and CD16+are infected with DENV (Azeredo et al., 2010; Wong et al., 2012) Despite the fact that the virus load was not detected within ... Fioretti, M.C., Puccetti, P., 2006 The combined effects of tryptophan starvation and tryptophan catabolites down-regulate T cell receptor zeta-chain and induce a regulatory phenotype in naive T cells ... Acknowledgements We gratefully thank Dr Ana Rita Motta Castro at UFMS (Campo Grande MS) and her team, for their help and assistance with pa-tient recruitment and sample collection We are indebted to the...

Ngày tải lên: 04/12/2022, 14:52

11 1 0
regulatory t cells promote hepatitis b virus infection and hepatocellular carcinoma progression

regulatory t cells promote hepatitis b virus infection and hepatocellular carcinoma progression

... patients In patients with ACLF, one study indicated that, at the onset of disease, the Treg to Th17 ratio and Th17 frequency were sig-nificant predictors of patient survival, with a low Treg/ Th17 ... Early stage HCC High PBT and TIT ( ) No 55 Balance of CD8þT-cells and TIT No No CD4þFoxp3þ HCC High ratio of TIT/CD8þT-cells ( ) ( ) 123 CD4þCD25þFoxp3þ HCC High TIT No ( ) 124 Tregs: regulatory ... mutations that pro-mote neoplastic transformation.73 Tregs in hepatocellular carcinomas Recruitment of Tregs to the tumor site The detailed mechanisms underlying recruitment of Tregs to the tumor...

Ngày tải lên: 04/12/2022, 16:03

14 4 0
Báo cáo khoa học: Tec family kinases: Itk signaling and the development of NKT ab and cd T cells potx

Báo cáo khoa học: Tec family kinases: Itk signaling and the development of NKT ab and cd T cells potx

... IL-13 and IFN-c, they lack the capacity to translate and secrete these cytokines upon antigenic stimulation both in vitro and in vivo [20,22,25] By contrast, bypassing the TCR with the addition ... birth in mice [39] Vc4+cd T cells are generated later than Vc3+cd T cells in the fetal thymus and migrate to epithelial layers of reproductive tract, lung and tongue [39,40] By contrast, cd T cells ... that carry the Vc3⁄ Vd1 cd TCR and home to the skin, skin-resident intraepithelial T lymphocytes, suggesting that Itk is important for their development [38,62] Further analy-sis indicates that...

Ngày tải lên: 28/03/2014, 22:21

10 458 0
Báo cáo khoa học: Copines-1, -2, -3, -6 and -7 show different calcium-dependent intracellular membrane translocation and targeting pdf

Báo cáo khoa học: Copines-1, -2, -3, -6 and -7 show different calcium-dependent intracellular membrane translocation and targeting pdf

... 10 lm. Trang 5Fig 3 Ionomycin treatment of HEK-293 cells causes translocation of the copines to the plasma membrane HEK-293 cells were transfected with the different copines and treated with ionomycin ... line-293 (HEK-293) cells Our results show that, in these cells, after ionomycin treatment, all of the copines exhibit calcium concentration-dependent translocation to the plasma membrane, and ... blocking the Fig 5 Methacholine-induced translocation of different copines and C2C2-constructs to the plasma membrane in response to transient ele-vation of Ca 2+ in cultured HEK-293 cells HEK-293 cells...

Ngày tải lên: 29/03/2014, 21:20

16 275 0
Module 2-3 – Implementing and Verifying EIGRP pptx

Module 2-3 – Implementing and Verifying EIGRP pptx

... want to remove the default network The configuration must be removed with the no ip default-network network command. Trang 12Example R1 EIGRP ConfigurationTrang 13ip address 192.168.1.102 255.255.255.224<output ... configure the ip default-network command, a static route (the ip route command) is generated in the router configuration However, the Cisco IOS software does not display a message to indicate this The ... masks to select the interfaces and networks that will participate in EIGRP routing – Configure the gateway of last resort or default route. Trang 4Configuring EIGRProuter eigrp autonomous-system-number...

Ngày tải lên: 06/07/2014, 23:21

26 224 0
Báo cáo y học: "CD25brightCD4+ regulatory T cells are enriched in inflamed joints of patients with chronic rheumatic disease" potx

Báo cáo y học: "CD25brightCD4+ regulatory T cells are enriched in inflamed joints of patients with chronic rheumatic disease" potx

... enrichment of regulatory T cells was seen Thus, the simple extrapolation of the animal data into future therapeutic strategies that aim at reconstituting this population does not seem to hold true ... CD25brightCD4+ regulatory T cells with a capacity to control T cell proliferation in the joints of patients with rheumatoid arthritis Here, we investigate a possible accumulation of these regulatory T ... influence the inflammatory processes in the joint These features were apparent in the vast majority of the patients despite the different treatments they received, indicating that the anti-rheumatic...

Ngày tải lên: 09/08/2014, 01:23

12 425 0
Báo cáo y học: "Direct Toll-like receptor 2 mediated co-stimulation of T cells in the mouse system as a basis for chronic inflammatory joint disease" ppsx

Báo cáo y học: "Direct Toll-like receptor 2 mediated co-stimulation of T cells in the mouse system as a basis for chronic inflammatory joint disease" ppsx

... AAT A-3' mTLR1 lower 5'-ATG CAG AAA TGG GCT AAC TT-3' mTLR2 upper 5'-TCT GCT GTG CCC TTC TCC TGT TGA-3' mTLR2 lower 5'-GGC CGC GTC GTT GTT CTC GT-3' mTLR4 upper 5'-AGC CGG AAG GTT ATT GTG GTA ... GTG GTA GT-3' mTLR4 lower 5'-TGC CGT TTC TTG TTC TTC CTC T-3' mTLR6 upper 5'-ATA CCA CCG TTC TCC ATT T-3' mTLR6 lower 5'-GAC GTG CTC TAT CAT CAG TG-3' Trang 5ative responses were not observed ... and/or autoreactive T cells [1,2] Recently, T cells have attracted most attention, and their activities, together with an autonomous role for the synovial lining cells, are now thought to be responsible...

Ngày tải lên: 09/08/2014, 01:23

14 509 0
Báo cáo y học: " Antibody microarray analysis of cell surface antigens on CD4+ and CD8+ T cells from HIV+ individuals correlates with disease stages" ppt

Báo cáo y học: " Antibody microarray analysis of cell surface antigens on CD4+ and CD8+ T cells from HIV+ individuals correlates with disease stages" ppt

... blood T-cell cytotoxicity found in HIV infection [41] These findings, together with ours, support the hypothesis that the CD8+ T cells from LNTP may have stronger cytotoxic activity than those ... status, we suggest that the use of this technology will facilitate further investigation of the causes and control of HIV disease progression and eventually lead to a better understanding of the ... as the internal control to measure the distribution of cells The dot pattern obtained is the immunophenotype of that population of leuko-cytes The main strength of antibody microarray is its...

Ngày tải lên: 13/08/2014, 05:22

13 290 0
Báo cáo y học: "haracterization of regulatory T cells in urban newborns" pptx

Báo cáo y học: "haracterization of regulatory T cells in urban newborns" pptx

... without lymphocyte proliferation data Total (n = 82) With Data (N = 52) Without Data (N = 30) N (%) N (%) Race/ethnicity Atopic disease Intake of steroids during pregnancy 18 (22.0) 11 (21.2) 7 (23.3) ... Competing interests The authors declare that they have no competing interests Authors' contributions NPL conducted the data analysis and wrote the manu-script BRP performed the proliferation studies ... version 9 (SAS Institute, Cary, NC) and the R system for statistical computing [27] Results Subject characteristics The subjects in this study consisted of a subset of new-borns and mothers enrolled...

Ngày tải lên: 13/08/2014, 13:22

10 233 0
2 3 plants and animals (life science)

2 3 plants and animals (life science)

... pledges to correct errors called to its attention in subsequent editions Photo locators denoted as follows: Top (T), Center (C), Bottom (B), Left (L), Right (R), Background (Bkgd) 2 Andrew Plumptre/Photolibrary/OSF ... the daisy The butterfl y gets energy too A skink eats the butterfl y The skink gets energy The energy has moved from the Sun to the skink. butterfl y skink Trang 8Food Web in a GrasslandHabitats ... live together and help each other The ants keep predators away from the aphids The aphids make honeydew The honeydew is a sweet treat for the ants to eat. Plants and animals live together They...

Ngày tải lên: 24/04/2017, 09:12

14 204 0
Lecture Business: A changing world - Chapter 2: The legal and regulatory environment

Lecture Business: A changing world - Chapter 2: The legal and regulatory environment

... Stephen and Cathy Simon of 1234 Any Street,  Dartmouth, Nova Scotia, agree to mow the front and  back lawns and trim the trees and shrubberies at 6789  Any Street, Halifax, Nova Scotia. This service will be  carried out every Saturday at 2 p.m. from June 1, 2002  ... provincial legislature. Administrative law Regulations passed by  provincial and federal tribunals 2-2 Trang 4   ©  2003 McGraw­Hill Ryerson Limited The Court System 2-3 • Violations of federal laws • Constitutional law ... carried out every Saturday at 2 p.m. from June 1, 2002  through September 31, 2002.    Mr. John James of 6789 Any Street, Halifax, Nova  Scotia, agrees to pay Stephen and Cathy Simon $50  every Saturday after these services are completed. ...

Ngày tải lên: 04/02/2020, 11:42

15 53 0
Hyperfunction of CD4 CD25 regulatory T cells in de novo acute myeloid leukemia

Hyperfunction of CD4 CD25 regulatory T cells in de novo acute myeloid leukemia

... consisted of CD4+CD25− T cells that were not cocul-tured with Tregs but were stained with CFSE Apoptosis assays for T cells To assess the apoptosis of T cells, freshly purified CD4+CD25− T cells ... CD4+CD25− T cells were performed The re-sults showed that Tregs from controls or AML patients promoted the apoptosis of normal CD4+CD25− T cells compared with that of CD4+CD25−T cells cultured ... CD4+CD25−T cells to CD4+CD25+Foxp3+Tregs Previous studies confirmed that in breast cancer, tumor-induced Bregs promote tumor metastasis by converting dormant CD4+CD25− T cells into CD4+CD25+Foxp3+...

Ngày tải lên: 30/05/2020, 21:52

10 18 0
The human complement inhibitor Sushi Domain-Containing Protein 4 (SUSD4) expression in tumor cells and infiltrating T cells is associated with better prognosis of breast cancer patients

The human complement inhibitor Sushi Domain-Containing Protein 4 (SUSD4) expression in tumor cells and infiltrating T cells is associated with better prognosis of breast cancer patients

... GTGACTCACCATT-3’ A standard of cytokeratin-19 GTCCGAGGTTACTGAC-3’ and 5’-ACTGAACCTGA CCGTACACACTTTCTGCCAGTGTGTCTTC-3’ The standard was used to obtain the transcript levels The data were analyzed by Kaplan-Meier ... specifications (AbGene) A qPCR was set up as described in [9], using the fol-lowing primers for SUSD4: 5’-AAAACCTTATCTGGT CGTC-3’ and 5’-ACTGAACCTGACCGTACATCTCC GTGACTCACCATT-3’ A standard of cytokeratin-19 ... 0) and SUSD4 positive tumors (scores 1–2) In the stroma of the tumors, SUSD4 positive tumor-infiltrating cells were detected The cells were counted for the whole tissue section and grouped into...

Ngày tải lên: 22/09/2020, 23:51

13 15 0
Special role of Foxp3 for the specifically altered microRNAs in Regulatory T cells of HCC patients

Special role of Foxp3 for the specifically altered microRNAs in Regulatory T cells of HCC patients

... indicates that thousands of human genes are microRNA targets Cell 2005, 120(1):15 –20. 22 Paquette J, Tokuyasu T: EGAN: exploratory gene association networks Bioinformatics 2009, 26(2):285 –286. 23 ... Phosphorylation of FOXP3 controls regulatory T cell function and is inhibited by TNF-alpha in rheumatoid arthritis Nat Med 2013, 19(3):322 –328. 36 Korn T, Mitsdoerffer M, Croxford AL, Awasthi A, ... reported to facilitate the dif-ferentiation of Th17 by inhibiting Tregs induction [36-38] Up-regulation of these miRNAs might break the balance between Th17 and Tregs and finally accelerate the...

Ngày tải lên: 14/10/2020, 17:33

10 17 0
kõ ho¹ch båi d­ìng häc sinh giái kõ ho¹ch båi d­ìng häc sinh giái m«n gi¸o dôc c«ng d©n 9 i danh s¸ch häc sinh giái stt hä vµ tªn ghi chó 1 2 3 ii §æc ®ióm t×nh h×nh 1 thuën lîi §©y ®òu lµ c¸c em häc

kõ ho¹ch båi d­ìng häc sinh giái kõ ho¹ch båi d­ìng häc sinh giái m«n gi¸o dôc c«ng d©n 9 i danh s¸ch häc sinh giái stt hä vµ tªn ghi chó 1 2 3 ii §æc ®ióm t×nh h×nh 1 thuën lîi §©y ®òu lµ c¸c em häc

... STT Họ và tên Yếu kém về các mặt Hoàn cảnh gia đình Mục tiêu phấn đấu: ( theo dõi yếu kém hàng tháng) STT Họ và tên Tháng9 T10 T11 T12 T1 T2 T3 T4 T5 Trang 82 Lớp 9B- Số lợng học sinh: em Trong ... tên Yếu kém về các mặt Hoàn cảnh gia đình - Mục tiêu phấn đấu: ( theo dõi yếu kém hàng tháng) STT Họ và tên Tháng9 T10 T11 T12 T1 T2 T3 T4 T5 2 Lớp 8B - Số lợng học sinh: em Trong đó : Nữ Nam: ... Mục tiêu phấn đấu: ( theo dõi yếu kém hàng tháng) STT Họ và tên Tháng9 T10 T11 T12 T1 T2 T3 T4 T5 Trang 112 Lớp 7B- Số lợng học sinh: em Trong đó : Nữ Nam: - -Điều kiện học tập: +Sách giáo khoa:...

Ngày tải lên: 16/04/2021, 10:53

12 10 0
Tổng hợp và thử tác dụng ức chế indoleamin  2,3 dioxygenase 1 của một số dẫn chất acetamid thơm mang khung 6 amino 1h indazol

Tổng hợp và thử tác dụng ức chế indoleamin 2,3 dioxygenase 1 của một số dẫn chất acetamid thơm mang khung 6 amino 1h indazol

... chế IDO1 22 2.3 Phương pháp nghiên cứu 22 2.3.1 Tổng hợp hóa học 22 2.3.2 Thử hoạt tính ức chế IDO1 23 CHƯƠNG 3 THỰC NGHIỆM, KẾT QUẢ VÀ BÀN LUẬN 26 3.1 Hóa học 26 Trang 53.1.1 Tổng hợp ... 26 3.1.2 Kiểm tra độ tinh khiết 40 3.1.3 Xác định cấu trúc 41 3.2 Thử hoạt tính ức chế IDO1 45 3.3 Bàn luận 46 3.3.1 Phản ứng hóa học 46 3.3.2 Khẳng định cấu trúc 50 3.3.3 Thử hoạt ... và thiết bị nghiên cứu 20 2.1.1 Nguyên liệu, hóa chất sử dụng trong nghiên cứu 20 2.1.2 Thiết bị nghiên cứu 21 2.2 Nội dung nghiên cứu 21 2.2.1 Tổng hợp hóa học 21 2.2.2 Thử hoạt tính...

Ngày tải lên: 16/11/2021, 15:30

91 13 0
NGUYỄN hữu LONG TỔNG hợp và THỬ tác DỤNG ức CHẾ INDOLEAMIN 2,3 DIOXYGENASE 1 của một số dẫn CHẤT PROPANAMID THƠM MANG KHUNG 6 AMINO 1h INDAZOL KHÓA LUẬN tốt NGHIỆP dược sĩ

NGUYỄN hữu LONG TỔNG hợp và THỬ tác DỤNG ức CHẾ INDOLEAMIN 2,3 DIOXYGENASE 1 của một số dẫn CHẤT PROPANAMID THƠM MANG KHUNG 6 AMINO 1h INDAZOL KHÓA LUẬN tốt NGHIỆP dược sĩ

... indazol nằm ở “pocket” A tương tác trực tiếp với nhân hem cần thiết cho hoạt tính - Nguyên tử brom ở vị trí số 6 làm tăng hoạt tính do tạo tương tác kỵ nước với Tyr126, Phe164, Leu234 Cầu nối 4-amin ... π-π và tương tác tĩnh điện với các nhóm thế tại Phe226 và Arg231, nằm ở “pocket” B, đã củng cố giả thuyết của Sugimoto. Hình 1.5 (a) Cấu trúc tinh thể phức hợp IDO1 và PI; (b) Cấu trúc tinh thể ... với Phe226 và Arg231 - Các nhóm thế khác trong phân tử tạo liên kết hydro với Cys129, Ser167, Gly262, Ala264 và 7-propionat của nhân hem.MỘT SỐ CHẤT ỨC CHẾ IDO1 ĐÃ ĐƯỢC NGHIÊN CỨU1.3.1 Hoạt tính...

Ngày tải lên: 10/12/2021, 21:49

79 20 0
Báo cáo y học: "Indoleamine 2,3-dioxygenase-expressing dendritic cells are involved in the generation of CD4+CD25+ regulatory T cells in Peyer''''s patches in an orally tolerized, collagen-induced arthritis mouse model" ppt

Báo cáo y học: "Indoleamine 2,3-dioxygenase-expressing dendritic cells are involved in the generation of CD4+CD25+ regulatory T cells in Peyer''''s patches in an orally tolerized, collagen-induced arthritis mouse model" ppt

... (5'-CACTGTACCAGTGCAGTAG -3' ) and antisense (5'-ACCATTCACACACT CGTTAT -3' ) primers, and using Foxp3 sense (5'-CAGCTGCCTACAGTGCCCCTAG -3' ) and antisense (5'CATTTGCCACGAGTGGGTAG -3' ) primers PCR products ... George TC, Norment A, Viney JL: Mucosal CD8α+ DC, with a plasmacytoid phenotype, induce differentiation and Page 10 of 10 (page number not for citation purposes) 22 23 24 25 26 27 28 29 30 31 32 33 ... regulatory effects on T cells that are mediated by tryptophan depletion and by the production of metabolic byproducts collectively known as kynurenines [16 ,21 ,22 ] Demonstrating the concomitant induction...

Ngày tải lên: 09/08/2014, 10:22

10 473 0
w