2 open excision of sgh through a laryngofissure

báo cáo sinh học:" Narrowing the gap between eye care needs and service provision: a model to dynamically regulate the flow of personnel through a multiple entry and exit training programme" pdf

báo cáo sinh học:" Narrowing the gap between eye care needs and service provision: a model to dynamically regulate the flow of personnel through a multiple entry and exit training programme" pdf

... A3 A3 A3 A3 A2 A2 A2 A2 A1 Eye Car e Tr aining Modules H2 A1 A1 A1 Eye car e nur se Catar act sur geon Optometr ist Ophthalmologist Figure Example 1of the use of a proposed modular training system ... synthesis of a large number of small units of activity and how each relates to Leave Training St a g e Training Ex i s t i n g W/F Upgraded St a g e Training St a g e Training St a g e Training ... will be: available free of charge to the entire biomedical community At a later date, the financial data associated with the personnel flows will be addressed by adding the costs associated with...

Ngày tải lên: 18/06/2014, 17:20

6 442 0
Báo cáo hóa học: " Enabling direct connectivity between heterogeneous objects in the internet of things through a network-service-oriented architecture" docx

Báo cáo hóa học: " Enabling direct connectivity between heterogeneous objects in the internet of things through a network-service-oriented architecture" docx

... interact with packets through a ‘packet facade’ (Figure 2b, interaction 2) Through this packet facade, standardized packet attributes (metadata) can be added, updated or requested This metadata can ... Two main approaches are discussed: (1) incremental ‘evolutionary’ architectures and (2) clean slate ‘revolutionary’ architectures A Evolutionary internet of things approaches Advocates of an evolutionary ... packet type a Network services can associate metadata with, or retrieve metadata from, stored packets using the packet facade b Only the packet facade requires knowledge about the packet format...

Ngày tải lên: 21/06/2014, 01:20

14 661 3
Báo cáo khoa học: Tuberous sclerosis-2 (TSC2) regulates the stability of death-associated protein kinase-1 (DAPK) through a lysosome-dependent degradation pathway doc

Báo cáo khoa học: Tuberous sclerosis-2 (TSC2) regulates the stability of death-associated protein kinase-1 (DAPK) through a lysosome-dependent degradation pathway doc

... beta, DNA damage, ER-stress and excessive growth factor signaling DAPK also plays a role in survival pathways reflected in its autophagy-signalling activity A substantial amount of research has ... a stop codon was introduced at amino acid 1517 using the primers: Fwd 5¢-CGACGAGTC AAACTAGCCAATCCTGCTG-3¢; Rev 5¢-CAGCAGGAT TGGCTAGTTTGACTCGTCG-3¢ Autophagy Apoptosis Fig DAPK and TSC2 form a ... cytoskeletal binding domain and a death domain [1] Recent advances have established an important role for DAPK in a diverse range of signal transduction pathways including growth factor signalling, apoptosis,...

Ngày tải lên: 28/03/2014, 23:20

17 368 0
CHARACTERIZATION OF INHIBITORS OF ALDEHYDE DEHYDROGENASE 2 IDENTIFIED THROUGH A HIGH-THROUGHPUT DOCKING APPROACH

CHARACTERIZATION OF INHIBITORS OF ALDEHYDE DEHYDROGENASE 2 IDENTIFIED THROUGH A HIGH-THROUGHPUT DOCKING APPROACH

... database (114, Adapted from Strickland et al., 2011) Gene Name ALDH 4A1 ALDH 7A1 Chromosome location 1p36.13 5q31 ALDH 1A1 ALDH 1A2 ALDH 1A3 ALDH1B1 ALDH2 ALDH1L1 ALDH1L2 ALDH 9A1 ALDH 5A1 ALDH 8A1 ALDH 6A1 ... substrate Glutamate y-semialdehyde a- Aminoadipic semialdehyde Retinal Retinal Retinal Retinal & acetaldehyde Acetaldehyde 10-Formyltetrahydrofolate 10-Formyltetrahydrofolate y-Aminobutyraldehyde ... inhibition of dehydrogenase activity.ALDH2 inactivation has a role in impaired GTN reduction and nitrate tolerance NA Structure analogues are being developed as AntiNA dipsotropic agents All of the analogues...

Ngày tải lên: 24/08/2014, 09:58

58 166 0
Some aspects of American culture and society in the twentieth and twenty-first centuries through a number of selected short literary works

Some aspects of American culture and society in the twentieth and twenty-first centuries through a number of selected short literary works

... indicate rather extreme casualty for the purpose of the author to draw a picture of a real awkward salesman, more or less reveal the informality of the American as the guests For an American, ... mother had done was apparently a revenge against her and her husband for they had not been able to save their four and a half month baby from infant death For the past few years, Mabel had always ... leading in their big mansions… Smoking jackets and cravats, spats and canes, elegant garden parties and martinis… This was a world of so elegantly distant from ours, it was like a voyage to another...

Ngày tải lên: 07/11/2012, 15:01

49 787 1
Tài liệu A.2. Four Kinds of Installation doc

Tài liệu A.2. Four Kinds of Installation doc

... Install" option.) A clean installation provides a healthier, more glitch-proof copy of 10.5 See "The Clean Install" on Section A. 6 MacOSX10.5 In times of dire troubleshooting, when nothing in Appendix ... when nothing in Appendix B has helped, you can actually give yourself a fresh copy of 10.5, even though it's already on the hard drive See "The Clean Install" on Section A. 6 ...

Ngày tải lên: 14/12/2013, 12:15

2 318 0
Tài liệu Activity 7.2: Determining the Impact of Technology on a Windows DNA Design docx

Tài liệu Activity 7.2: Determining the Impact of Technology on a Windows DNA Design docx

... your answers in the table below User Interface User Services Business Services Data Access Data Store Communication Operating Systems System Services Development Tools Data Access Data Storage ... the level of impact — high, medium, or low — that each technology type would have on the given layer of a Windows DNA design Write your answers in the grid provided After completing the above steps, ... Activity 7.2: Determining the Impact of Technology on a Windows DNA Design Exercise 1: Determining Technology Implications ! Determine technology implications Participate in small groups as assigned...

Ngày tải lên: 21/12/2013, 06:16

4 632 0
Tài liệu Báo cáo khoa học: C-Terminal extension of a plant cysteine protease modulates proteolytic activity through a partial inhibitory mechanism doc

Tài liệu Báo cáo khoa học: C-Terminal extension of a plant cysteine protease modulates proteolytic activity through a partial inhibitory mechanism doc

... N-Pro 208 aa 34 aa CT - ex Stop 114 aa Xho1 365 aa 24 aa 208 aa N-Pro N Pro II 24 aa Protease domain BamH H1 Start I 114 aa Pre A S Dutta et al Protease domain CT - ex 34 aa III 208 aa N-Pro NP ... protease from the latex of Ervatamia coronaria Biosci Biotechnol Biochem 62, 1947–1955 15 GuhaThakurta P, Biswas S, Chakrabarti C, Sundd M, Jagannadham MV & Dattagupta JK (2004) Structural basis of ... proteases [Erv -A, -B and –C (isolated from the latex of Ervatamia coronaria in our laboratory) and papain from Carica papaya (Merck, Kenilworth, NJ, USA)], two serine proteases [trypsin and chymotrypsin...

Ngày tải lên: 14/02/2014, 14:20

13 761 0
Tài liệu Playing through: A Guide to the Unwritten Rules of Golf potx

Tài liệu Playing through: A Guide to the Unwritten Rules of Golf potx

... trash bin manners matter 17 Foul Language Almost all of us are guilty of the occasional expletive Asking all golfers to cease swearing, while an admirable concept, simply isn’t practical What ... appreciate the beauty of the places that, as golfers, we get to enjoy I was having a particularly bad day on a course in Pagosa Springs, Colorado After yet another lousy shot, my cart mate came over, ... putting and hand them to us This made the round easy and very pleasant I have an electric handcart One day I hadn’t charged the battery fully and it ran out of juice As I was pushing it back to...

Ngày tải lên: 22/02/2014, 08:20

223 405 0
Báo cáo khoa học: ` Inhibition of human ether a go-go potassium channels by 2+ Ca ⁄calmodulin binding to the cytosolic N- and C-termini potx

Báo cáo khoa học: ` Inhibition of human ether a go-go potassium channels by 2+ Ca ⁄calmodulin binding to the cytosolic N- and C-termini potx

... threshold (Fig 2) and by assuming that a CaM binding domain has to have a length of at least around 15 residues For quantitative estimates of the binding of CaM and CaM mutants to peptides and fusion ... CNG channels and of KCNQ channels On the one hand they are activated by membrane depolarization 1082 and not inactivate as KCNQ channels On the other hand EAG channels harbor a C-terminal putative ... voltage of half-maximal gate activation and km the corresponding slope factor G is the maximal conductance of all channels and Erev the reversal potential Functional expression of hEAG1 channels...

Ngày tải lên: 07/03/2014, 12:20

13 502 0
Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx

Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx

... 5¢-TTTTG GATTGAAGCCAATATGATA-3¢; NF1 mut, 5¢-TTTT GGATTGAATAAAATATGATA-3¢; Site-2 wt, 5¢-GCGT CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT TGTCC-3¢; Site-2 mut, 5¢-GCGTCTCACCCTAGTAA TGGTAATGCTCCAAGGGTTTTTGTCC-3¢; ... Neckelmann, N., Li, K., Wade, R.P., Shuster, R & Wallace, D.C (1987) cDNA sequence of a human skeletal muscle ADP/ATP translocator: Lack of a leader peptode, divergence from a fibroblast translocator ... lL of antiserum 8199 prepared against a central domain of the NF1 C protein (kindly provided by N Tanese) or lL of antirat liver b-F1 ATPase (unrelated protein) Amplification of immunoprecipitated...

Ngày tải lên: 07/03/2014, 15:20

8 427 0
History Of Egypt, Chaldæa, Syria, Babylonia, and Assyria, Volume 2 (of 12) pptx

History Of Egypt, Chaldæa, Syria, Babylonia, and Assyria, Volume 2 (of 12) pptx

... civil and criminal law, received the complaints of his vassals and serfs at the gate of his palace, and against his decisions there was no appeal He kept up a flotilla, and raised on his estate a ... repeated surveys made and co-ordinated by the Royal Administration, thus enabling Pharaoh to know the exact area of his estates The unit of measurement was the arura; that is to say, a square of ... more came round, beggary succeeded to fulness of living, and a part of the population was literally starving for several days This almost constant alternation of abundance and dearth had a reactionary...

Ngày tải lên: 08/03/2014, 22:20

141 487 0
Báo cáo khoa học: Characterization of SCP-2 from Euphorbia lagascae reveals that a single Leu/Met exchange enhances sterol transfer activity pdf

Báo cáo khoa học: Characterization of SCP-2 from Euphorbia lagascae reveals that a single Leu/Met exchange enhances sterol transfer activity pdf

... (5¢-ATG AAAGTTCAAGAGAAGATCAATCTC-3¢); ELM99 (5¢ATGAGGGGTGCTATGAAGATCAAGG-3¢); ATL100 (5¢-ATTAGGGGTGCGCTGAAGATCAAGG-3¢); ATL14L15F18 (5¢-AAATCCGATGCAATCCTGGACCTGCTG AAGGAATTTCTTTCCACCGACGCC-3¢) For ... palmitic acid to the sample The values are mean ± SD from at least four different analyses Plant Type Ergosterol Palmitic Acid E lagascae E lagascae E lagascae E lagascae A thaliana A thaliana ... was amplified from E lagascae cDNA by the use of primers SCPElNE (5¢-ACTGGAATTCAACT CAAGTCCCAAAATATTTTGGAT-3¢) and SCPElCN (5¢-TCATGGCGGCCGCTCACAGCTTCGACGGCTTGG GGAA-3¢) The PCR fragment obtained...

Ngày tải lên: 16/03/2014, 12:20

15 392 0
Báo cáo khoa học: Efficient synthesis of a disulfide-containing protein through a batch cell-free system from wheat germ pdf

Báo cáo khoa học: Efficient synthesis of a disulfide-containing protein through a batch cell-free system from wheat germ pdf

... [9] at the linker region was constructed by amplifying the whole plasmid pEU-scFvLH by inverse PCR with the primers s2: 5¢-CAAAAAATTGAATGGCATG AACCGCCGAGCTCCAAC-3¢ and a2 : 5¢-AGCTTCAA AAATATCATTTAAACCCGACGGGCTGCTTTT-3¢ ... 5¢-CTACC AGATCTGCCATGCAGATCGTTGTTACCCAGG-3¢ and a1 : 5¢-GGCTAAGAGCTCACGGTCAGGCTCG-3¢ by using a LATaq PCR kit (50 lL) The sequences underlined are the BglII restriction site and initiation codon, and ... Kawasaki et al (Eur J Biochem 270) Antigen-binding analyses We then examined the antigen binding activity The soluble material from each reaction was loaded on an antigen column and was separated...

Ngày tải lên: 16/03/2014, 23:20

7 332 0
synthesis and growth of hematite nanodiscs through a facile hydrothermal approach

synthesis and growth of hematite nanodiscs through a facile hydrothermal approach

... 10b The measured curves for calculating BET surface area of particles were plotted and analyzed It can be seen that the surface area of aFe2O3 nanodiscs (triangle spotted lines) was estimated to ... Nanotec Electronica S.L., Spain); The Brunauer–Emmett–Teller (BET) surface area of the as-prepared particles was measured at 77 K (liquid nitrogen) on a Quantachrome Autosorb-6B Surface Area ... orders of magnitude smaller than the signal from the sample and thus can be ignored; (vi) The catalytic oxidation of CO gas was performed in a home-built fixed bed microreactor A reactant gas containing...

Ngày tải lên: 20/03/2014, 13:08

17 624 0
Electrochemical Oxidation of Cysteine at a Film Gold Modified Carbon Fiber Microelectrode Its Application in   a Flow—Through Voltammetric Sensor

Electrochemical Oxidation of Cysteine at a Film Gold Modified Carbon Fiber Microelectrode Its Application in a Flow—Through Voltammetric Sensor

... the Au/CFE two well-defined oxidation peaks (peak at 0.835 V, 24.4 A and peak at 1.15 V, 40.7 A) were exhibited at pH 4.86 and a scan rate of 10 mV/s The Au nanoparticles serve as large surface ... height was calculated using a chromatogram data integrator (Scientific Information Service Corp., Davis, CA, USA) The samples of L-cysteine and hydrogen tetrachloroaurate(III) trihydrate (HAuCl4·3H2O) ... chromatograms in Figure 12 (A C) are comparable to a chromatogram of cysteine at bare Au, Au/CFE and blank solution The peak height of cysteine at Au electrode (retention time 7.49 min) is smaller...

Ngày tải lên: 21/03/2014, 12:18

16 371 0
Báo cáo khoa học: Folding of epidermal growth factor-like repeats from human tenascin studied through a sequence frame-shift approach pdf

Báo cáo khoa học: Folding of epidermal growth factor-like repeats from human tenascin studied through a sequence frame-shift approach pdf

... apparatus using a PrePak Cartridge 25 · 100 mm (Agilent) casted on a PrepLC Universal Base apparatus (Waters) and a Zorbax 300SB-C18 9.4 · 250 mm (Agilent) Samples were eluted using a linear gradient ... A fit of experimental data with a three-parameter negative exponential curve (R > 0.99, data not shown) gave an apparent rate constant value of 0.54 min)1 for EGF-14, and values in the range 0.22–0.26 ... Derivatization of the amino acid mixture with phenylisothiocyanate was achieved according to the standard protocol of PicoTag system (Waters) Analysis of free amino acids was performed by RP-HPLC on a PicoTag...

Ngày tải lên: 23/03/2014, 13:20

12 416 0
Báo cáo khoa học: Human airway trypsin-like protease induces amphiregulin release through a mechanism involving protease-activated receptor-2-mediated ERK activation and TNF a-converting enzyme activity in airway epithelial cells doc

Báo cáo khoa học: Human airway trypsin-like protease induces amphiregulin release through a mechanism involving protease-activated receptor-2-mediated ERK activation and TNF a-converting enzyme activity in airway epithelial cells doc

... References Yasuoka S, Onishi T, Kawano S, Tsuchihashi S, Ogawara M, Masuda K, Yamaoka K, Takahashi M & Sano T (1997) Purification, characterization, and localization of a novel trypsin-like protease found ... stimulated with PAR-2 AP (300 lM) for h (A) Total RNA was extracted, and quantitative real-time RT ⁄ PCR (TaqManTM) analysis was used to determine the amounts of AR and b-actin mRNA (B, C) ELISA was ... bronchial asthmatic patients [10] These observations suggest that HAT might mediate airway inflammation by PAR-2 activation In addition to airway inflammation, hypersecretion of airway mucus is a characteristic...

Ngày tải lên: 30/03/2014, 11:20

13 243 0
báo cáo hóa học: " Fear of hypoglycaemia: defining a minimum clinically important difference in patients with type 2 diabetes" docx

báo cáo hóa học: " Fear of hypoglycaemia: defining a minimum clinically important difference in patients with type 2 diabetes" docx

... Mean age (SD) of the study population was 62.7 (10.6) years 42.6% were female 28.9% of patients had a history of macrovascular complications, while 16.4% had a history of microvascular complications ... 77:371-383 Atkinson MJ, Sinha A, Hass SL, Colman SS, Kumar RN, Brod M, et al.: Validation of a general measure of treatment satisfaction, the Treatment Satisfaction Questionaire for Medication (TSQM), ... of hypoglycaemia can lead to behavioral changes [6], cognitive impairment [15], and unawareness of hypoglycaemia [16] Because of these negative consequences, patients may develop psychological...

Ngày tải lên: 18/06/2014, 19:20

8 364 0
w