12 19 portlet edit mode page running in a browser

Báo cáo hóa học: " Use of Time-Frequency Analysis and Neural Networks for Mode Identification in a Wireless Software-Defined Radio Approach" pptx

Báo cáo hóa học: " Use of Time-Frequency Analysis and Neural Networks for Mode Identification in a Wireless Software-Defined Radio Approach" pptx

... Van Dyck, and A Soltanian, “Interference of bluetooth and IEEE 802.11: simulation modeling and performance evaluation,” in Proc 4th International ACM Workshop on Modeling, Analysis and Simulation ... transmit a large number of modes in different bands The SDR approach is a great evolution based on the programmable digital radio (PDR) paradigm, which consists in a radio fully programmable in baseband ... by the state of the art cannot be used TF analysis allows one to extract important features, used as input to the classifier to establish which kind of mode is actually available in the radio environment...

Ngày tải lên: 23/06/2014, 01:20

13 456 0
bai lop 5 luyen tuan 12-19

bai lop 5 luyen tuan 12-19

... Đông b bán hoang mạc (Ca dắc - Xtan) Trung c Đồng (đảo Ba ly, in đô ni xi a) Đông nam d Rừng Tai ga (LB Nga) Bắc đ Dãy núi Ai - ma - lay -a (Pêtan) Nam - Học sinh d a vào hình minh hoạ: a, b, c, ... tam giác ADK (SGK) - Hs thao tác theo hớng dẫn gv - Hs kẻ hình thang ABCD vào giấy ô ly, vẽ theo hớng dẫn A B M D H C ShtABCD = S ADK S ADK= DKxAH DKxAH mà 2 B ( DC + CK ) xAH ( DC + AB ) xAH ... hình thang ABCD - GVHDHS tính trung điểm M cạnh BC, cắt rời hình tam giác ABM, sau ghép lại nh hớng dẫn SGK để đợc hình tam giác ADK Hs nx S hình thang ABCD diện tích hình tam giác ADK v a tạo...

Ngày tải lên: 26/10/2013, 08:11

234 402 1
The about us page in a social world

The about us page in a social world

... “About” and “Mission” are the same Twitter at least does a good job explaining what they are but not who they are Instagram’s about us includes a quick paragraph about the two founders and that ... Also, please feel free to share your favorite “About Us” page in the comments below * Image: Social media network Hand painted in people faces showing OK sign The post The About Us Page in a ... Journal, Business Week, USA Today and New York Times bestselling books “Call to Action”, “Waiting For Your Cat to Bark?” and “Always Be Testing” Bryan has been the keynote speaker for Search Engine...

Ngày tải lên: 07/01/2014, 16:52

5 420 0
Tài liệu Web page design in 7 days doc

Tài liệu Web page design in 7 days doc

... Paragraph alignments in your web page You can determine how a paragraph will be aligned in a web page You can align text in left, right or center of a web page To specify alignment for a paragraph ... using paragraphs A paragraph starts on a new line with one blank line after previous line Paragraph tag is First paragraph Second paragraph You will nest other tags inside ... written in separate lines To break lines in output web page you must insert tags in breaking points Also pay attention that tag is one of few single tags in html language It has not an...

Ngày tải lên: 17/01/2014, 06:20

72 361 0
Báo cáo khoa học: Theoretical study of lipid biosynthesis in wild-type Escherichia coli and in a protoplast-type L-form using elementary flux mode analysis potx

Báo cáo khoa học: Theoretical study of lipid biosynthesis in wild-type Escherichia coli and in a protoplast-type L-form using elementary flux mode analysis potx

... FabD, FabH_2, FabB_3, and AccACD In this cycle, acetyl-CoA is carboxylated (driven by ATP hydrolysis) and decarboxylated again (Fig 2) The remaining EFMs are capable of producing all of the main ... We applied metabolic pathway analysis to this model In an earlier study by Stelling et al [40], lipid metabolism was included in a general, overall model of central metabolism in a simplified way ... detectable in the cell wall-free mutant These findings stand in contrast to a subsequent analysis of singlegene knockout data indicating that E coli can only survive if at least L1-P-EtAmine and a...

Ngày tải lên: 22/03/2014, 21:20

12 554 0
Chapter 7 Create, Add, Delete, and Edit Data in a Disconnected Environment

Chapter 7 Create, Add, Delete, and Edit Data in a Disconnected Environment

... own DataSet (schema) 1 Create Dataset Add DataTable(s) Add DataColumn(s) to DataTable Define datatable schema Fill Data into DataTable(s) in DataSet 2 Add DataRow to DataTable Processing data in ... provides access to one row of data in a DataTable DataSet A DataTable's DataRow objects contain all the data in the DataTable Create DataTable DataColumn DataRow Table.NewRow method Can access DataRow ... DataView An custom view of a DataTable Sorting, filtering, searching, editing, and navigating the data from a DataSet Using same data memory from Datatable Each DataTable have DefaultView DataTable...

Ngày tải lên: 13/05/2014, 12:19

50 386 0
Báo cáo sinh học: "Gene therapy with tumor-specific promoter mediated suicide gene plus IL-12 gene enhanced tumor inhibition and prolonged host survival in a murine model of Lewis lung carcinoma" pptx

Báo cáo sinh học: "Gene therapy with tumor-specific promoter mediated suicide gene plus IL-12 gene enhanced tumor inhibition and prolonged host survival in a murine model of Lewis lung carcinoma" pptx

... the treated animals to measure the biochemistry markers including alanine transaminase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN) and creatine (Cr) using commercial kits ... transferasemediated dUTP nick-end labeling; ALT: alanine transaminase; AST: aspartate aminotransferase; BUN: blood urea nitrogen; Cr: Creatinine Acknowledgements This work was supported by grants ... were measured at the indicated time points after intratumoral injection with AdCMV(-), AdhTERTHRP, AdCMVmIL -12 alone or in combination Each data point represented the mean tumor volume in that group...

Ngày tải lên: 18/06/2014, 19:20

10 700 0
báo cáo hóa học: " Comparing the SF-12 and SF-36 health status questionnaires in patients with and without obesity" pot

báo cáo hóa học: " Comparing the SF-12 and SF-36 health status questionnaires in patients with and without obesity" pot

... of each subscale are calculated based on the response to individual items comprising that subscale; the subscales are then standardized using a z-score transformation and aggregated to estimate ... telephone interview was administered by trained interviewers and ascertained information such as patient demographics, height, weight, comorbid illness, and quality of life We calculated body mass index ... SF-36 in patients of all BMI groups and appears to perform at least as well as the SF-36 in cross-sectional settings; hence, using the SF -12 in place of the SF-36 may be appropriate, especially...

Ngày tải lên: 18/06/2014, 22:20

7 367 1
Báo cáo hóa học: " Evaluation of the diagnostic indices and clinical utility of qualitative cardiodetect® test kit in diagnosis of ami within 12 hours of onset of chest pain in the emergency department" pptx

Báo cáo hóa học: " Evaluation of the diagnostic indices and clinical utility of qualitative cardiodetect® test kit in diagnosis of ami within 12 hours of onset of chest pain in the emergency department" pptx

... acid-binding proteins as plasma markers of tissue injury Clinica Chimica Acta 2005, 352:15-35 30 Nagahara D, Nakata T, Hashimoto A, Takahashi T, Kyuma M, Hase M, Tsuchihashi K, Shimamoto K: Early ... LMaarten, Glatz FCJan, Hermensa WT: Measurement of myocardial infarct size from plasma fatty acid-binding protein or myoglobin, using individually estimated clearance rates Cardiovascular Research 199 9, ... myocardial infarction Emerg Med Clin North Am 2001, 19( 2):321-337 37 Tanaka T, Sohmiya K, Kitaura Y, Takeshita H, Morita H, Ohkaru Y, Asayama K, Kimura H: Clinical evaluation of point-of-care-testing...

Ngày tải lên: 20/06/2014, 23:20

9 464 0
assess the efficiency of dental plaque control in decay teeth, gingivitis prevention for the 12 years- old pupils at some schools in the suburb of hanoi

assess the efficiency of dental plaque control in decay teeth, gingivitis prevention for the 12 years- old pupils at some schools in the suburb of hanoi

... beverages (n=1022) Index Amount Scale (%) Number of time of eating, drinking sweet food and beverage and beverages each day: - Many times 703 68.8 Oral and dental hygience after eating, drinking ... Decay teeth, Gingivitis and some related factors in 12- year-old pupils in Quoc Oai and Gia Lam district, Hanoi city in 2009”, Preventive Medicine Magazine, Section XXI, No (125 ), page 90-96 Ta ... immune reactions destroy the organization of gums The capacity making the decay teeth of the dental plate was based on its adhesion into the teeth, the capacity making acid from C12 and C6 and pH...

Ngày tải lên: 25/07/2014, 13:57

29 360 0
helvea swiss equities conference 2012 thomas aebischer cfo managing growth in a two speed economy january 12 2012 holcim ltd

helvea swiss equities conference 2012 thomas aebischer cfo managing growth in a two speed economy january 12 2012 holcim ltd

... Working age (15 – 64) / Total population China Brazil Russia Thailand Mexico Chile Argentina Indonesia Philippines 70% Switzerland Spain France Germany Canada Italy Japan USA India Ethiopia Nigeria ... Nigeria Niger 50% Low demand Increasing demand Mass consumption Softening demand outlook Low savings Growing savings rate High savings rate Declining savings rate Lacking investments Increasing investments ... Spain 4% France 4% Canada 4% Germany 4% UK 2% Italy 2% Spain 2% India 7% Australia 3% Germany 3% Mature markets France 3% Canada 3% Japan 6% Indonesia 3% Emerging markets • In 2010 the global...

Ngày tải lên: 30/07/2014, 21:34

25 180 0
Báo cáo khoa học: "Adenosquamous carcinoma of breast in a 19 years old woman: a case report" pot

Báo cáo khoa học: "Adenosquamous carcinoma of breast in a 19 years old woman: a case report" pot

... adenosquamous carcinoma A variant of metaplastic mammary carcinoma Am J Surg Pathol 198 7, 11:351-358 Page of 3 Barnes PJ, Boutilier R, Chiasson D, Rayson D: Metaplastic breast carcinoma: clinical-pathologic ... the radiating arms of the lesion A view (×20) of one of the radiating arms of the lesion showing parenchymal tissue separated by a diagonal band of infiltrative cellular stromal tissue containing ... breast cancer: • Prof PP Rosen, Department of Cancer and Metastasis, Hospital Durani Reynals, Hospitalet de LLogregat, Barcelona, Spain • Prof DL Page, Department of Pathology, Division of Anatomic...

Ngày tải lên: 09/08/2014, 03:21

3 272 0
Báo cáo y học: "Whole-genome resequencing of Escherichia coli K-12 MG1655 undergoing short-term laboratory evolution in lactate minimal media reveals flexible selection of adaptive mutation" pptx

Báo cáo y học: "Whole-genome resequencing of Escherichia coli K-12 MG1655 undergoing short-term laboratory evolution in lactate minimal media reveals flexible selection of adaptive mutation" pptx

... LactA, LactB, LactC, LactD, and LactE strains using Nimblegen CGS arrays (Additional data file 1); an Excel table listing mutations reported for all strains using Solexa sequencing (Additional ... usedor absence1studyof mutations Solexapoints known a strains LactD,andgenome CGS arrays LactC, LactD,ator LactB, refMutationsenrichedLactE strains at time timein LactA, usinglocaAdditionalfor ... of ppsA rather than altered enzyme pyrE attenuator (Δ82 translational stop) (MG1655 translational stop) UAG UAG Δ82 rph pyrE 610- GCAGAAGGCGAGCCGTTCACCCATGAAGAGCTACTCATCTTGTTGGCTCTGGCCCGAGGG 670...

Ngày tải lên: 09/08/2014, 20:20

12 295 0
Mechatronics for Safety, Security and Dependability in a New Era - Arai and Arai Part 12 docx

Mechatronics for Safety, Security and Dependability in a New Era - Arai and Arai Part 12 docx

... near antennas affect their performance in many ways Placing a conductive surface near an antenna has advantages and disadvantages In some cases a metallic plate near an antenna can act as a reflector ... Yoshitsugu Kamiya Department of Mechanical Systems Engineering, Kanazawa University, Kanazawa, Ishikawa, 920- 1192 , Japan ABSTRACT In this paper, effects of a current controller on dynamic characteristics ... Ephremides A. , Michaels L .A An exact analysis and performance evaluation of framed ALOHA with capture IEEE Transactions on Communications Feb 198 9 Vol 37, issue 2, pages 125 -137 317 MODELING ELECTROMAGNETIC...

Ngày tải lên: 10/08/2014, 05:20

30 273 0
Báo cáo y học: "Demonstration of the histopathological and immunohistochemical effects of a novel hemostatic agent, ankaferd blood stopper, on vascular tissue in a rat aortic bleeding mode" pps

Báo cáo y học: "Demonstration of the histopathological and immunohistochemical effects of a novel hemostatic agent, ankaferd blood stopper, on vascular tissue in a rat aortic bleeding mode" pps

... Karakaya K, Hanci V, Abdusoglu M, Erol B, Turksoy O, Akduman B, Mungan NA: Protective value of a folkloric medicinal plant extract against mortality and hemorrhage in a life-threatining renal ... intensity was graded 1, and the most prominent staining reaction Page of covering nearly the whole area of the specimen was classified as Grade was intermediate between and Statistical analysis Statistical ... particularly in terms of graft patency Intimal hyperplasia can cause aneurysm and thrombus formation [1] In our study, on Days and post-ABS application, histopathological changes in the rat abdominal...

Ngày tải lên: 10/08/2014, 09:22

7 455 0
Báo cáo y học: "Lower limb biomechanics during running in individuals with achilles tendinopathy: a systematic review" potx

Báo cáo y học: "Lower limb biomechanics during running in individuals with achilles tendinopathy: a systematic review" potx

... non-significant effects) Abbreviations: Calcaneus-vertical TDA, calcaneus to vertical touch down angle; Calcaneus-tibia TDA, calcaneus to tibia touch down angle; Calcaneal at HS, calcaneal angle (relative ... at heel strike; Ankle angle at MS, ankle sagittal plane angle at midstance; ADF Max, maximum ankle joint dorsiflexion; ADF ROM, ankle joint dorsiflexion range of motion; AROM DF, sagittal plane ... at the ankle; Peak TIR, peak tibial internal rotation; TIR max, maximum tibial internal rotation; TROM ir/er, total transverse tibial range of motion; tTIR max, timing of maximum internal transverse...

Ngày tải lên: 10/08/2014, 21:24

17 353 0
Báo cáo y học: "Chondrosarcoma presenting as dyspnea in a 19-year-old man: a case report" pdf

Báo cáo y học: "Chondrosarcoma presenting as dyspnea in a 19-year-old man: a case report" pdf

... Dijkstra SD, van Rijswijk CS, Krol AD, Taminiau AHM, Bovée JV: The clinical approach towards chondrosarcoma Oncologist 2008, 13:320-329 Hayashida K, Nishimura T, Uehara T, Naito H, Takamiya M, ... Chandrasekharan et al.: Chondrosarcoma presenting as dyspnea in a 19- year-old man: a case report Journal of Medical Case Reports 2011 5:150 Submit your next manuscript to BioMed Central and take ... Kozuka T, Sakakibara H, Imakita M, Yutani C, Hamada T: [A case of pulmonary tumorembolism from chondrosarcoma of the lower extremity] (in Japanese) Kaku Igaku 198 5, 22:101-106 Leung DY, Seah PW,...

Ngày tải lên: 11/08/2014, 00:23

4 410 0
w