... critical in urban and peri-urban areas where caregiv- ers have more access to financial means and greater availability of alternative treatments. Lesson 4: The availability of anti-diarheal products ... in rural areas of Siem Reap and Pursat. The partnerships also facilitated an extensive training program of partners and providers on diarrheal disease, pre- vention, and treatment, and the ... 12 www.casesjournal.org To increase acceptability of the product, messages also emphasized the fact that the Orasel tasted better than the available ORS and that the zinc had a sweet taste. Village...
Ngày tải lên: 12/02/2014, 19:20
Ngày tải lên: 28/07/2014, 19:20
Components of Software Development Risk: How to Address Them? A Project Manager Survey ppt
... proponents of software risk management, information about the impact of software risk management has been sparse and anecdotal. There are only a few empirical studies about the commonality and type of software ... bosses denote those of a project manager. regression analysis. PCA analyzes the covariation of a set of variables and condenses the variation into a smaller number of underlying (latent) components. ... resource usage and deadline effect. The other items loading to this factor are: evaluation of performance require- ments, managing project complexity, and estimation of hardware and software capabilities....
Ngày tải lên: 07/03/2014, 00:20
Project management institute a guide to the project management body of knowledge PMBOK project management institute (2013)
Ngày tải lên: 17/08/2013, 11:00
Tài liệu Evaluation of possible Six Sigma implementation including a DMAIC project pptx
... organizational and managerial processes, neighborhood change, international relations and the maturation of industries." According to Wallén (1993) the advantages of a Case Study are that ... -22- -ABBREVIATIONS- LIST OF ABBREVIATIONS ABB Asea Brown Bovery ANOVA Analysis of Variance ANOM Analysis of Means C p Process Capability Ratio C pk Process Capability Ratio, considering ... interviews were carried through with a TPMG 5 Manager, a TPMG Coordinator at the Cage Factory, a Quality Assurance Manager and a Professor in Quality Engineering at Chalmers University of Technology....
Ngày tải lên: 24/01/2014, 00:20
Tài liệu The New Face oF GoverNmeNT: How Public Managers Are Forging a New Approach to Governance pdf
... People and the Changing Face of Government 135 Human Capital and Transformational Change 137 Human-Capital Management in Government 138 Challenges Facing Human Resources Managers 139 Challenges ... McNabb entered a second career in academia. He advanced to the rank of professor on the faculty at Pacific Lutheran University. He has a BA from California State College at Fullerton, an MA from ... about a transformation of the organization. ey are only a means for identifying problem areas and for planning subsequent transformation actions. e literature of organizational change clearly...
Ngày tải lên: 15/02/2014, 20:20
Tài liệu A junk-free childhood 2012 - The 2012 report of the StanMark project on standards for marketing food and beverages to children in Europe pptx
... with a particular brand are called brand equity characters. These brand equity characters – usually cartoon or animated characters – are normally owned by the companies that make the food and ... upplevelser av medier, 2 010. Available at: http://www.statensmedierad.se/upload/Rapporter_pdf/Ungar_&_medier_2 010. pdf 58 Ofcom. Children and parents: media use and attitude report, UK Office of ... marketing of a wide range of foods and beverages to children under age 18, across a wide range of media. 8 Trends In the last decade there have been dramatic changes in the technology available...
Ngày tải lên: 18/02/2014, 21:20
GUIDELINES TO THE CONSTRUCTION OF A SOCIAL ACCOUNTING MATRIX ppt
... that a SAM is meant to fit into the existing national statistical and planning infrastructure. That is to say that, first, a SAM is typically built on the basis of data which are already available. ... a certain period, so that the results may not agree with a straightforward disaggrega- tion of national accounts totals. Finally, a SAM always has a matrix format 72 A classification conversion ... easier to trace. Moreover, if a second SAM, in constant prices, is ever calibrated, better deflators are available at a more disaggregated level. On the other hand, a casual reader of a SAM...
Ngày tải lên: 06/03/2014, 21:20
A JOINT PROJECT OF THE AMERICAN ACCOUNTING ASSOCIATION AND THE ACCOUNTING PROGRAMS LEADERSHIP GROUP pdf
... Current Ph.D. Students as a Percentage of the Total Latin and South Other Australia United American Asian and States Canada Countries Europe Africa China Korea India Countries Oceania 51.7 < 1 < ... second largest category, with 26.1 percent. Canada, Latin and South America, and Australia and Oceania as categories each provide less than 1 percent of the current students. When asked “What percentage ... currently offer a doctorate could develop accounting Report of the AAA/AAPLG Ad Hoc Committee to Assess the Supply and Demand for Accounting Ph.D.s 1 REPORT OF THE AAA/AAPLG AD HOC COMMITTEE TO ASSESS...
Ngày tải lên: 06/03/2014, 21:20
An-Najah National University Faculty of Graduate Studies - Project Management for Construction Projects pdf
... results and analysis of the interviews with project managers ã A framework is designed to help managers organize their work and improve the quality of managing construction projects in West Bank. ... according to the goals and needs of the organization. 22 calculations in complex projects, because templates for most charts, diagrams and reports are easily available through such software, ... software, after entering the data the user can easily create different types of project management planning and monitoring tools such as GANTT charts, PERT charts and CPM charts. Software can also...
Ngày tải lên: 07/03/2014, 02:20
Báo cáo khoa học: "Automatic construction of a hypernym-labeled noun hierarchy from text" docx
... amount of memory. With 50,000 nouns, we would initially require a 50,000 x 50,000 array of values (or a trian- gular array of about half this size). With our current hardware, the largest array ... Recall that the tree is binary. In many cases, a group of nouns really do not have an in- herent tree structure, for example, a cluster of countries. Although it is possible that a reasonable ... Thomas Ahlswede and Martha Evens. 1988. Parsing vs. text processing in the analysis of dictionary definitions. In Proceedings of the 29th Annual Meeting of the Associa- tion for Computational...
Ngày tải lên: 08/03/2014, 06:20
The Project Gutenberg EBook of A First Book in Algebra, pot
... −0, a, 2a, 3a, 4a, 5a. What must be added to 2a to obtain 5a? What then must be subtracted from 5a to obtain 2a? 5a − 3a =? What must be added to − 3a to obtain 4a? What then must be subtracted from ... subtracted from 4a to obtain − 3a? 4a − 7a =? What must be added to 3a to obtain − 2a? What then must be subtracted from − 2a to obtain 3a? (− 2a) − (− 5a) =? What must be added to a to obtain − 4a? What then ... oranges, and bananas for $1.08; each apple cost 2 cents, each orange 4 cents, and each banana 3 cents. How many of each did he buy? 6. I bought some 2-cent stamps and twice as many 5-cent stamps, paying...
Ngày tải lên: 15/03/2014, 00:20
The Role and Responsibilities of Accounting Officers: A Memorandum for Accounting Officers pdf
... C&AG Audits of Departmental Accounts other than the Appropriation Accounts and the Finance Accounts Apart from the Appropriation Accounts and the Finance Accounts, the C&AG audits a ... internationally. The risks to be addressed as part of a risk assessment and management programme are wide-ranging and include strategic, operational, financial and reputational risk. A risk strategy ... requirements of Parliamentary accountability have meant that there has traditionally been an emphasis on internal control, particularly internal financial control, in Government Departments and Offices....
Ngày tải lên: 15/03/2014, 22:20
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf
... AAACGCCTTCGCCCAAAGTTTAAAAGATGA 22 TCATCTTTTAAACTTTGGGCGAAGGCGTTT 23 TTTTCTCGAGAAAGATGCCGATTTGGGCGC 24 GGGGCTCGAGGTTTTATATTTGTTGTAAAA 25 ATATTATATATATATATAGGGTCGTATATA 26 AAATTATAGAAAGCAGTAGA TAAAACAATG 27 CTTCGAAGAATATACTAAAAAATGAGCAGG CAAGATAAACGAAGGCAAAGTTCAATTCA TCATTTTTTTTTTATTCTTTT 28 ... GCCCGGATCCTGATAGTAATAGAATCCAAA 4 CCCCGAATTCAAATTATAGAAAGCAGTAGA 5 AAGGCTCGAGAGATCTGTTTAGCTTGCCTC 6 AAAAGTCGACGAGCTCGTTTTCGACACTGG 7 TTTTGTCGACATGGCGCAACACGATGAAGC CGTAGACAAC 8 GGGGGGATCCTTACATAAGCGTACAACAAA CACTATTTGATTTCGGCGCCTGAGCATCA TTTAGCTTTTT 9 ... TTTTGTCGACATGGCGCAACACGATGAAGC CGTAGACAAC 18 GGGGGGATCCTTACATAAGCGTACAACAAA CACTATTTGATTTCGGCGCCTGAGCATCA TTTAGCTTTTT 19 ATCCAAAGTTTAGCCGATGACCCAAGCCAA 20 TTGGCTTGGGTCATCGGCTAAACTTTGGAT 21 AAACGCCTTCGCCCAAAGTTTAAAAGATGA 22...
Ngày tải lên: 16/03/2014, 01:20
Báo cáo khoa học: Construction and biological activity of a full-length molecular clone of human Torque teno virus (TTV) genotype 6 pptx
... numbering accord- ingly), and found to be 3748 nucleotides in length. A TATA-box (TATAA) was located at nucleotides 83–87 and a poly (A) sequence ATTAAA at nucleotides 2978–2983. A GC-rich area was 107 ... 3177–3182. 4 Okamoto H, Nishizawa T, Kato N, Ukita M, Ikeda H, Iizuka H, Miyakawa Y & Mayumi M (1998) Molecular cloning and characterization of a novel DNA virus (TTV) associated with posttransfusion ... Miyata H, Tsunoda H, Kazi A, Yamada A, Khan MA, Murakami J, Kamahora T, Shiraki K & Hino S (1999) Identification of a novel GC-rich 113-nucleotide region to complete the circular, single-stranded...
Ngày tải lên: 16/03/2014, 05:20
Báo cáo khoa học: Cytokinin-induced structural adaptability of a Lupinus luteus PR-10 protein potx
... estimated spectrophotometrically. Antifungal assays The antifungal activity of the LlPR -10. 2B protein was tested by a radial growth inhibition assay adapted from the method of Schlumbaum et al. ... L7 and L9, and the C-terminal a3 -helix. (B) ‘Sausage’ representation of the deviations between the Ca atoms of LlPR -10. 2BN,NÂ- DPU and LlPR -10. 2A. (C) Sausage repre- sentation of the deviations ... Hayrinen J, Laatikainen R, Perakyla M, Tervahauta AI & Karen- lampi SO (2005) Birch PR-10c interacts with several biologically important ligands. Phytochemistry 66, 2524–2533. 37 Ilari A, ...
Ngày tải lên: 23/03/2014, 06:20
Why (Special Agent) Johnny (Still) Can’t Encrypt: A Security Analysis of the APCO Project 25 Two-Way Radio System docx
Ngày tải lên: 23/03/2014, 13:20
A Collaborative Project of The Mickey Leland National Urban Air Toxics Research Center and The National Center for Health Statistics pot
Ngày tải lên: 28/03/2014, 19:20
Evolution of a Prototype Financial Privacy Notice: A Report on the Form Development Project pptx
Ngày tải lên: 29/03/2014, 18:20