... Assessment 10 9 Depression 11 1 Anxiety 11 1 Depression And Anxiety Screening 11 1 Structured Interview for Depression 11 2 Cycle of Depression 11 3 Suicide 11 5 Suicide Assessment Outline 11 5 Adolescent Suicide ... Suicide 11 6 Treatment Focus and Objectives 11 7 Depression and Suicide Risk Relapse 11 8 Dangerousness 11 9 Dangerousness Assessment Outline 12 0 Treatment Focus and Objectives 12 2 Clarifying Risk of ... Dependency Assessment 17 9 Chemical Dependency Psychological Assessment 18 2 Withdrawal Symptoms Checklist 18 5 Psychological 18 5 Somatic 18 5 Spousal/Partner Abuse 18 7 Assessing Spousal/Partner Abuse 18 7...
Ngày tải lên: 15/02/2014, 02:20
... Sequencea Regionb GSTM1 GSTM2 Mismatch c (number of bases) AS-ctrl AS-GFP AS -1 AS-2 AS-3 AS-4 AS-5 AS-6 AS-7 AS-8 AS-9 AS -10 AS -11 AS -12 AS -13 AS -14 AS -15 TGAGAGCTGAAAGCAGGTCCAT G*A*GCTGCACGCTGCCG*T*C ... GFP–CDS CDS CDS CDS CDS CDS CDS CDS CDS CDS CDS STOP 3¢-UTR 3¢-UTR 3¢-UTR 3¢-UTR – – 36–55 11 9 13 8 15 2 17 1 17 5 19 4 – 326–345 397–426 480–499 524–543 – – 786–805 – – 978–997 – – – 11 9 13 8 15 2 17 1 17 5 19 4 ... isoform specificity of AS-5 and AS -10 in the EGFP assay, compared to the GST assay In summary, we selected several effective antisense ODNs against rat GSTM1 and GSTM2 from a set of 15 PS-ODNs...
Ngày tải lên: 31/03/2014, 15:20
ELSEVIER''''S DICTIONARY OF PSYCHOLOGICAL THEORIES phần 1 docx
... Masking in visual recognition: Effects of twodimensional filtered noise Science, 18 0, 11 94 -11 96 ABSOLUTE STIMULUS THEORY See SPENCE S THEORY ABSTRACTION, LAWS AND PRINCIPLES OF See COGNITIVE STYLE ... this approach is the classical frustration-aggression hypothesis, which states in its modified form that frustration produces instigations to a number of different types of responses, one of ... theories in this area of the stimulation of cutaneous senses are the concentration the- 25 ory of cutaneous cold and the spot theory of temperature senses (Jenkins, 19 41) See also NAFE S THEORY OF...
Ngày tải lên: 24/07/2014, 11:21
English Language Tests-Intermediate level''''s archiveElements of Organizational Behavior (1) potx
... benefits and dependence on the organization finances funds money wages The employee need that is met is security, and the performance result is cooperation passive pensive penurious persuasive ... the supportive organizational model, the basis is leadership with a managerial orientation of , while the employees are oriented towards job performance and participation success succession support ... type of leadership, communication, and group within the organization dynamics kinetics physics psychics The workers perceive this as the quality of work life which directs their degree of motivation,...
Ngày tải lên: 25/07/2014, 01:20
Báo cáo y học: "Segregation of a M404V mutation of the p62/sequestosome 1 (p62/SQSTM1) gene with polyostotic Paget''''s disease of bone in an Italian family" pps
... http://arthritis-research.com/content/7/6/R1289 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Eekhoff EW, Karperien M, Houtsma D, Zwinderman AH, Dragoiescu C, Kneppers AL, Papapoulos SE: Familial Paget 's disease in The Netherlands: ... members [16 ,17 ] Although specific genetic mechanisms remain to be elucidated, some authors reported loss of heterozygosity for loci at chromosome 18 q 21- 22 in Pagetoid osteosarcomas as well as in sporadic ... of the forward and reverse sequences was performed on an ABI Prism 310 0 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA) Results Clinical data Suspicion or diagnosis of PDB was based...
Ngày tải lên: 09/08/2014, 07:20
schaum s easy outline of principles of economics based on schaum s outline of theory and problems of principl phần 1 pot
... Schaum s Easy Outline: Trigonometry Schaum s Easy Outline: Business Statistics Schaum s Easy Outline: Principles of Accounting Schaum s Easy Outline: Applied Physics Schaum s Easy Outline: Biology Schaum s ... SCHAUM S Easy OUTLINES PRINCIPLES OF ECONOMICS Other Books in Schaum s Easy Outlines Series Include: Schaum s Easy Outline: Calculus Schaum s Easy Outline: College Algebra Schaum s Easy Outline: ... PRINCIPLES OF ECONOMICS ics studies the economic behavior of individual decision makers such as consumers, resource owners, and business firms The discipline of economics has developed principles, theories,...
Ngày tải lên: 09/08/2014, 19:22
báo cáo khoa học: " Multi-drug resistance 1 genetic polymorphism and prediction of chemotherapy response in Hodgkin’s " pot
... polymorphisms Bull Exp Biol Med 2003, 13 6 :18 3 -18 5 11 Hampson FA, Shaw AS: Response assessment in lymphoma Clin Radiol 2008, 63 :12 5 -13 5 12 Cascorbi I, Gerloff T, Johne A, Meisel C, Hoffmeyer S, Schwab ... Advanced stages (III & IV) 38 (39.6) 12 (35.3) Missed data 17 (17 .7) (5.9) Age at diagnosis Gender Stage Presence of B symptoms Yes 54 (56.3) 19 (55.9) No Missed data 31 (32.3) 11 (11 .4) 13 (38.2) ... 1. 5 cm in their axial diameter to less than 1. 5 cm, and nodes of 1. 1 -1. 5 to less than cm Relapsed disease (RD) was defined as: 1) the appearance of any new lesion 2) or increase in the size of...
Ngày tải lên: 10/08/2014, 10:21
Báo cáo khoa học: " The construction and characterization of the bi-directional promoter between pp38 gene and 1.8-kb mRNA transcripts of Marek''''s disease viruses" doc
... suspension was mixed with two parts (by cell number) of fresh secondary CEF suspension and placed into 35 mm dishes (1 10 6 cells per dish) To prepare the secondary CEF monolayers, 1 10 6 cells ... M, Ueda S, Kato S, Hirai K: Analysis of Marek 's disease virus serotype 1- specific phosphorylated polypeptides in virus-infected cells and Marek 's disease lymphoblastoid cells J Gen Virol 19 87, ... maintenance of transformation of MDCC-MSB1 MDV-transformed lymphoblastoid cells J Virol 19 96, 70 :11 25 -11 31 Ikuta K, Nakajima K, Naito M, Ann SH, Ueda S, Kato S, Hirai K: Identification of Marek 's disease...
Ngày tải lên: 12/08/2014, 04:21
Báo cáo y học: " Discovery of novel targets for multi-epitope vaccines: Screening of HIV-1 genomes using association rule mining" pot
... B *14 01 B *15 01 73 93 10 7 13 7 14 2 260 12 82 10 1 11 5 14 6 14 9 2 71 188 12 4 38 14 11 11 2 10 0 73 31 A*3002 263 2 71 114 10 51 RT-RNase IVTDSQYAL VTDSQYALGI Cw*0802 B *15 03 495 496 503 505 14 9 15 3 69 RT-Integrase ... http://www.retrovirology.com/content/6 /1/ 62 Table 2: Summary of the discovered CTL epitope association rules Data sets Association rules 62-all 44-non-CRFs 18 -CRFs * Pseudo-set 19 61 1095 18 67 19 44 Associations with epitopes $ Associations ... Associations with epitopes Associations with epitopes Associations with epitopes Associations with epitopes Associations with epitopes 46 217 15 3 59 48 16 6 10 2 26 45 71 59 27 46 217 15 1 58 Total...
Ngày tải lên: 12/08/2014, 23:21
Báo cáo y học: "The discovery of the first human retrovirus: HTLV-1 and HTLV-2" doc
... http://www.retrovirology.com/content/2 /1/ 17 Table 1: Factors that led to consensus that human retroviruses did not exist Failure to discover them after an extensive survey by many investigators in the 19 5 0s, 19 6 0s, and 19 7 0s Ease ... and I presented our results in detail This included description of several isolates of HTLV -1, characteristics of purified HTLV -1 p24 as well as reverse transcriptase proteins, evidence of integrated ... Nature 19 70, 226 :12 09 -12 11 Temin HM, Mizutani S: RNA-dependent DNA polymerase in virions of Rous sarcoma virus Nature 19 70, 226 :12 11- 1 213 Robert-Guroff M, Gallo RC: Serological analysis of cellular...
Ngày tải lên: 13/08/2014, 09:21
Automatic discovery of connections between Vietnamese's anthropometric features
... soft tissue thickness at vertex landmark soft tissue thickness at trichion landmark soft tissue thickness at glabella landmark soft tissue thickness at nasion landmark soft tissue thickness at ... reconstruction system with accurate soft tissue thickness prediction 2.6 Available Soft Tissue Thickness Data There are several published soft tissue thickness data collections Some datasets of ... 2.5 Soft tissue thickness studies 2.6 Available Soft Tissue Thickness Data 4 10 10 12 13 13 13 13 13 15 Automatic discovery of connections...
Ngày tải lên: 25/03/2015, 09:41
Ebook Escourolle poirier’s manual of basic neuropathology Part 1
... artifactual This reactive process accompanies almost any type of subacute or chronic injury of the CNS The process of gliosis is in essence the response of astrocytes to CNS tissue injury The associated ... https://kat.cr/user/Blink99/ 1. 1.2 ASTROCYTIC LESIONS 1. 1.2 .1 Gliosis (astrogliosis) The presence of gliosis (alternate term astrogliosis) is the most certain indication that a microscopic finding is of pathological significance ... Diseases 16 1 Hans Lassmann, Raymond A. Sobel, and Danielle Seilhean 59 Colin Smith Neuropathology of Vascular Disease 76 Pathology of Degenerative Diseases of the Nervous System 17 3 Charles Duyckaerts,...
Ngày tải lên: 26/05/2017, 17:57
Web Mining and Knowledge Discovery of Usage Patterns
... Besides creating the server session, WebSIFT system performs content and 14 15 structure preprocessing, and provides the option to convert server sessions into episodes The server session or episode ... collection of user clicks to a single Web server during a user session Also called a visit Episode - A subset of related user clicks that occur within a user session 3 .1. 1 Content Preprocessing Content ... a specific point in time Click stream – A sequential series of page view request User session – A delimited set of user clicks (click stream) across one or more Web servers Server session (visit)...
Ngày tải lên: 31/08/2012, 16:46