 reflects a moment in time

DNA evidence is a frozen moment in time pdf

DNA evidence is a frozen moment in time pdf

... •Ideal annealing temperature can be mathematically estimated It should be just 1-2 C below Tm Tm = (4 x [G+C]) + (2 x [A+ T]) • GATCTACCACTGATA ATACGTATCTAGTTA GCTCGGGGCATGCC DNA Quality DNA should ... should be intact and free of contaminants that inhibit amplification • Contaminants can be heme from blood, humic acid from soil and melanin from hair • Contaminants can be introduced during the ... of a DNA denaturation step, a primer annealing step and a primer extension step • DNA Denaturation: Expose the DNA template to high temperatures to separate the two DNA strands and allow access...

Ngày tải lên: 07/07/2014, 18:20

112 406 0
Tài liệu ADX Active Digital Cross-Connect A Space in Time pptx

Tài liệu ADX Active Digital Cross-Connect A Space in Time pptx

... quantity of backhaul links rises exponentially Aggregation of traffic invariably leads to lower opex (operating expenses) Operators can deal with increased uncertainty by using technology that ... Cross-Connect – A Space in Time Early GSM operators chose TDM because of its many advantages The technology is time- tested and relatively simple, enabling operators at any given time to know what traffic ... expensive—real estate in remote cabinets housing this equipment For many operators, acquiring additional space is not an option either because of the associated cost of leasing expensive housing cabinets...

Ngày tải lên: 10/12/2013, 20:15

4 298 0
A switch in time saves nine doc

A switch in time saves nine doc

... report” At times we are truly sick The problem is in determining when we use our physical state as a way of avoiding something we consider unpleasant We blame our inaction or inability on our mental ... This kind of excuse making often occurs in large companies and government bureaucracies Let’s say a company loses a million dollars because of a bad investment The president of the company blames ... just can’t go outside and wash the car,” or “he made me it,” or “I had a terrible headache” It seems as we all, at one time or another, a person feel the need to explain why something happened...

Ngày tải lên: 22/07/2014, 04:20

10 477 0
Báo cáo sinh học: "A stitch in time: Efficient computation of genomic DNA melting bubbles" potx

Báo cáo sinh học: "A stitch in time: Efficient computation of genomic DNA melting bubbles" potx

... characterized as follows (i) (a, b) is a 2D peak and a fractal frame iff (a, b) is a fractal frame and D (a, b)

Ngày tải lên: 12/08/2014, 17:20

20 485 0
Báo cáo y học: "Point of care technology or standard laboratory service in an emergency department: is there a difference in time to action?" ppt

Báo cáo y học: "Point of care technology or standard laboratory service in an emergency department: is there a difference in time to action?" ppt

... results are available after 15-20 minutes depending on the parameter analyzed The AQT-90 analysis for TnI has been shown to be marginally inferior to two laboratory assays in diagnosing AMI [10], and ... assay compared to three laboratory troponin assays Clin Chim Acta 2011, 30:370-375 11 Sidelmann JJ, Gram J, Larsen A, Overgaard K, Jespersen J: Analytical and clinical validation of a new point-of-care ... et al.: Point of care technology or standard laboratory service in an emergency department: is there a difference in time to action? A randomised trial Scandinavian Journal of Trauma, Resuscitation...

Ngày tải lên: 13/08/2014, 23:20

6 338 0
Báo cáo khoa học: "A Speech-based Just-in-Time Retrieval System using Semantic Search" doc

Báo cáo khoa học: "A Speech-based Just-in-Time Retrieval System using Semantic Search" doc

... Joint Conference on Artificial Intelligence), pages 6–12, Hyderabad, India Philip N Garner, John Dines, Thomas Hain, Asmaa El Hannani, Martin Karafiat, Danil Korchagin, Mike Lincoln, Vincent Wan, ... this increases to about 41% These values indicate that enough correct words are sensed by the real -time ASR to make it applicable to the ACLD, and that a robust search mechanism could help avoiding ... SUS: A ‘quick and dirty’ usability scale In Patrick W Jordan, Bruce Thomas, Bernard A Weerdmeester, and Ian L McClelland, editors, Usability evaluation in industry, pages 189–194 Taylor and Francis,...

Ngày tải lên: 07/03/2014, 22:20

6 381 0
Báo cáo khoa học: "A Component for Just-In-Time Incremental Speech Synthesis" pdf

Báo cáo khoa học: "A Component for Just-In-Time Incremental Speech Synthesis" pdf

... Language Cambridge University Press Thierry Dutoit, Maria Astrinaki, Onur Babacan, Nicolas d’Alessandro, and Benjamin Picart 2011 pHTS for Max/MSP: A Streaming Architecture for Statistical Parametric ... Matsuyama, Kazunori Komatani, Ryu Takeda, Toru Takahashi, Tetsuya Ogata, and Hiroshi G Okuno 2010 Analyzing User Utterances in Barge -in- able Spoken Dialogue System for Improving Identification Ac- ... Tokuda, Takayoshi Yoshimura, Takashi Masuko, Takao Kobayashi, and Tadashi Kitamura 2000 Speech Parameter Generation Algorithms for HMMbased Speech Synthesis In Proceedings of ICASSP 2000, pages...

Ngày tải lên: 16/03/2014, 20:20

6 334 0
Báo cáo sinh học: "Time-course of sFlt-1 and VEGF-A release in neutropenic patients with sepsis and septic shock: a prospective study" pptx

Báo cáo sinh học: "Time-course of sFlt-1 and VEGF-A release in neutropenic patients with sepsis and septic shock: a prospective study" pptx

... diagnostic research, setting the stage for a future and planned validating study [31], as well as to gain insights about the time- course of sFlt-1 and VEGFA release during the very initial phase ... in continuous and categorical variables were analyzed using the Mann-Whitney or Fisher’s exact test respectively Data are expressed as median and range unless otherwise stated Correlation analysis ... complications In addition, preliminary data from animal studies suggest that sFlt-1 could play an important role in the treatment of sepsis, as an endothelial barrier stabilizing agent, provided that...

Ngày tải lên: 18/06/2014, 19:20

8 495 0
Báo cáo khoa học: "A multiplex real-time PCR for differential detection and quantification of Salmonella spp., Salmonella enterica serovar Typhimurium and Enteritidis in meats" pps

Báo cáo khoa học: "A multiplex real-time PCR for differential detection and quantification of Salmonella spp., Salmonella enterica serovar Typhimurium and Enteritidis in meats" pps

... SsA-F SsA-R SE-Cy5 aggccttcgggttgtaaagt gttagccggtgcttcttctg FAM-aaccgcagcaattgacgttaccc-BHQ 1a tgcagaaaattgatgctgct ttgcccaggttggtaatagc JOE-acctgggtgcggtacagaaccgt-BHQ 1a ggtaaaggggcttcggtatc ... Although the multiplex real -time PCR assay was demonstrated as an applicable assay in artificially inoculated meats, it needs further research for natural meat cases and other types of food and ... multiplex real -time PCR A total of 128 bacterial strains including 110 Salmonella strains (51 S Typhimurium strains, 12 S Enteritidis strains and 47 other Salmonella serotype strains) and 18 nonSalmonella...

Ngày tải lên: 07/08/2014, 23:22

9 411 0
báo cáo khoa học: " Changes in time-use and drug use by young adults in poor neighbourhoods of Greater Buenos Aires, Argentina, after the political transitions of 2001-2002: Results of a survey" potx

báo cáo khoa học: " Changes in time-use and drug use by young adults in poor neighbourhoods of Greater Buenos Aires, Argentina, after the political transitions of 2001-2002: Results of a survey" potx

... supported by a Fogarty International Center/NIH grant through the AIDS International Training and Research Program at Mount Sinai School of Medicine-Argentina Program (Grant # D43 TW001037) and by ... Values, Attitudes, and Behaviours Journal of Occupational & Organizational Psychology 2001, 74:543-559 Aguiar N: Time Use Analysis in Brazil: How far will time use studies have advanced in Brazil ... truncadas: el abandono escolar en el nivel medio en la Argentina UNICEF, Buenos Aires; 2005 46 Spinelli H, Alazraqui M, Macías G, Zunino MG, Nadalich JC: Muertes violentas en la Ciudad Autónoma...

Ngày tải lên: 11/08/2014, 18:20

10 331 0
Báo cáo y học: "he impact of the introduction of critical care outreach services in England: a multicentre interrupted time-series analys" pdf

Báo cáo y học: "he impact of the introduction of critical care outreach services in England: a multicentre interrupted time-series analys" pdf

... general critical care units participating in the Case Mix Programme, which is the national comparative audit of critical care in England, Wales and Northern Ireland Materials and methods The analysis ... survey Data sources Case Mix Programme Database The Case Mix Programme Database (CMPD) is a high-quality clinical database of case mix, outcome and activity data on consecutive admissions to adult, ... general critical care units in England, Wales and Northern Ireland [5] Data are collected by trained data collectors according to precise rules and definitions, and are validated both locally and...

Ngày tải lên: 13/08/2014, 08:20

9 309 0
ứng dụng mô hình Just in time vào hoạt động quản trị hàng tồn kho trong các doanh nghiệp Dệt may Việt Nam.doc

ứng dụng mô hình Just in time vào hoạt động quản trị hàng tồn kho trong các doanh nghiệp Dệt may Việt Nam.doc

... triết lý kinh doanh dài hạn, quản lý trực quan, chuẩn h a qui trình cân sản xuất Hai trụ cột vững Just -in- Time (V a lúc – JIT) ngh a sản xuất v a lúc cần đến, không sản xuất th a; Jidoka (Tự kiểm ... rẻ mẫu mã a dạng tìm thấy khắp c a hàng siêu thị, chợi Việt Nam hàng Việt Nam vắng bóng Gần đây, hàng may mặc Việt Nam với số thương hiệu May 10, Việt Tiến, Ninomax, Made in Vietnam, v.v… dần ... K10 Nghiên cứu khoa học may Việt Nam cho biết xuất dệt may Việt Nam vào Hoa Kỳ quý v a qua đạt tỷ đô la tổng kim ngạch Việt Nam xuất toàn giới 1,9 tỷ đô la, giảm 4% so với thời gian năm ngoái Năm...

Ngày tải lên: 22/09/2012, 16:50

91 4,2K 53
Điều kiện, khả năng áp dụng hệ thống JIT (just in time) trong các doanh nghiệp sản xuất và lắp ráp ô tô Việt Nam.doc

Điều kiện, khả năng áp dụng hệ thống JIT (just in time) trong các doanh nghiệp sản xuất và lắp ráp ô tô Việt Nam.doc

... produces a unit to replace the one taken by the Assembly Line people in the first place Machine Center Withdrawal kanban Storage Part A Storage Part A Production kanban The process begins by the Assembly ... Learned, " Production and Inventory Managemenl, 3rd Quarter, 25-29 Sohal, A S., Ramsay, L., and Samson, D (1993) "JIT Manufacturing: Industry Analysis and a Methodology for Implementation, " International ... "Just -in- Time Production in Small Job Shops, " Industrial Management, July/August, 23-26 Billesbach, T J (1991) "A Study of Implementation of Just -In- Time in the United States, " Production and Inventory...

Ngày tải lên: 28/09/2012, 09:01

50 1,7K 17
Learning express Just In Time Vocabulary

Learning express Just In Time Vocabulary

... important learning strategies is to be an active reader Interact with what you are reading by STU DY S K I LLS 11 asking questions, making notes, and marking passages instead of simply reading ... you can practice every day As you read the daily newspaper, your favorite magazine, or a good book, have a dictionary handy Look up as many unfamiliar words as you can so that your bank of vocabulary ... feet and gesticulate a lot while speaking They tend to learn best by doing rather than observing Kinesthetic learners may want to walk around as they practice what they are learning, because using...

Ngày tải lên: 05/10/2012, 09:48

222 704 2
Báo cáo y học: "Teaching child and adolescent psychiatry to undergraduate medical students - A survey in German-speaking countries"

Báo cáo y học: "Teaching child and adolescent psychiatry to undergraduate medical students - A survey in German-speaking countries"

... at each medical school focusing on a separate area: “examination and standards in examination,” “e-learning in medicine,” “evaluation of teaching,” “practical year,” and “preparation for final ... CAP in the German-speaking parts of Europe: 26 in Germany, in Austria, and in Switzerland After mailings and some personal reminders, the response rate was 100% Further information was obtained ... Seminars 22 Problem-based learning 14 E-learning 10 Communication and interaction training Video seminars 2 6 Interactive learning Adult psychiatry 24 73 Pediatrics 16 48 Psychosomatic medicine...

Ngày tải lên: 25/10/2012, 10:06

8 538 0
w