công nghệ nano_Nanopracticical

Ribonucleoprotein delivery of CRISPR-Cas9 reagents for increased gene editing efficiency Rolf Turk PhD, Staff Scientist Integrated DNA Technologies 1... CRISPR genome editingDNA incorpor

Ribonucleoprotein delivery of CRISPR-Cas9

reagents for increased gene editing efficiency

Rolf Turk PhD, Staff Scientist Integrated DNA Technologies

1

Outline—Alt-R™ CRISPR-Cas9 System

• Ribonucleoprotein complex (RNP)

– Generation of RNP complex

– Stability of RNP complex

– Editing efficiency of RNP

• Cas9 electroporation enhancer

– Increases editing efficiency

• RNP delivery using the Amaxa ® Nucleofector ® System ( Lonza )

– Optimization

• RNP delivery using the Neon ® System ( Thermo Fisher )

– Optimization

2

CRISPR genome editing

DNA incorporation or

gene knockout

• Homology-directed repair—add or

replace gene sequences

destroy a gene

CRISPR guide RNAs

3

Cas9 protein RNA-directed dsDNA endonuclease

Implementing CRISPR-Cas9 gene editing

4

CRISPR-Cas9 products from IDT

5

3-step transfection using Alt-R™ CRISPR-Cas9

System

6

+ +

gRNA complex formation

Cas9 protein is rapidly degraded—fewer off-target effects

7

Liang X, Potter J, et al (2015) Rapid and highly efficient mammalian cell

engineering via Cas9 protein transfection J Biotechnol, 208:44–53.

Benefits of RNP: Cas9 protein rapidly degraded,

Nucleofection, EMX1 targeting gRNA, 48h

On target Off target

• Sustained expression of Cas9 allows for OTEs Even

low-expression HEK-293–Cas9 cells allow for off target editing.

• RNP is “fast on and fast off,” and has fewer OTEs

05101520253035404550

RNP, HEK-293 cells Nucleofection, EMX1 targeting gRNA, 48h

On target Off target

Ribonucleoprotein ease of use—highly stable

• Loss in activity seen at –20°C (likely due to freeze–thaws)

• Premade complexes are stable at 4°C and –80°C with no loss in activity

CRISPR workflow

10

Assemble RNP

Collect genomic DNA Analyze

unknown à hard to optimize

Neon ® Transfection System (Thermo Fisher)

Considerations when doing electroporation

lipofection

– More accessible to nucleases

– More accessible to proteinases

– Amaxa Nucleofector

• Cell database

• Optimization protocol (96-well format)

– Neon Transfection System

• Optimization protocols

13

Optimization strategy for electroporation

– Nucleofector System: Electroporation program

– Neon Transfection System: Voltage, pulse width, number of pulses

– Use cells with low passage numbers

– Use appropriate cell density (should be sub-confluent)

14

Electroporation—verify reagents free of RNases

Cell dissociation method

Cell resuspension media

• Testing shows that commercially purchased trypsin contains RNases

• RNaseAlert®Assay (IDT)

dissociation solution

Electroporation enhancer DNA improves gene

Cas9 electroporation enhancer

• IDT custom Ultramer ® Oligonucleotide; available at

www.idtdna.com/ultramer

TTAGCTCTGTTTACGTCCCAGCGGGCATGAGAGTAACAAGAGGGTGTGGT

AATATTACGGTACCGAGCACTATCGATACAATATGTGTCATACGGACACG (100 nt)

• Note: This oligo does not have significant homology to the human, mouse,

or rat genomes, and has been tested as carrier DNA in multiple human cell

lines, including HEK-293, Jurkat, and K562.

• Before use in other species, verify that this oligo does not have similarity to

your host cell genome to limit participation of the oligo in the

double-stranded DNA break repair process.

17

Positive and negative controls

19

• Electroporation enhancer DNA,

4 µM

• 48 hr incubation, following Nucleofection

• 3X genomic DNA dilution

• Digest with T7EI, 2 U

• Fragment Analyzer™

(Advanced Analytical Technologies)

• Electroporation enhancer DNA,

4 µM

• 48 hr incubation, following Nucleofection

• 3X genomic DNA dilution

• Digest with T7EI, 2 U

• Electroporation enhancer DNA,

4 µM

• 48 hr incubation, following Nucleofection

• 3X genomic DNA dilution

• Digest with T7EI, 2 U

• Fragment Analyzer™

(Advanced Analytical Technologies)

24

HEK-293 electroporation optimization—Neon ®

low cell density

high cell density

high editinglow editing

Jurkat electroporation optimization—Neon ®

low cell density

high cell density

high editinglow editing

Genome editing in mouse primary T-cells

31

Collaboration with Jennifer Barr & Scott Lieberman, Dept of Pediatrics, University of Iowa

IDT collaborator protocols available on the web

32

• 48 hr incubation, following Nucleofection

• 3X genomic DNA dilution

• Digest with T7EI, 2 U

• Fragment Analyzer™

(Advanced Analytical Technologies)

Nikolai Braun

Contact us by web chat, email, or phone.

“Best tech support ever, @idtdna!”

Lauren Sakowski

34

THANK YOU!

We will email you the webinar recording and slides next week.

35