Aquaculture nutrition, tập 17, số 5, 2011

The 280 g kg1 dietary protein was supplied by fish meal and soybean pro-tein concentrate, and the remaining by a mixture of crystal-line amino acids CAAs without methionine to simulate an

College of Animal Sciences, Zhejiang University, Hangzhou, China

An 8-week feeding trial was conducted to determine the effects

of dietary methionine level on juvenile black sea bream Sparus

macrocephalus Fish (initial body weight: 14.21 ± 0.24 g)

were reared in eighteen 350-L indoors flow-through circular

fibreglass tanks (20 fish per tank) Isoenergetic and

isonitro-genous diets contained six levels of L-methionine ranging from

7.5 to 23.5 g kg)1of dry diet in 3.0 g kg)1 increments at a

constant dietary cystine level of 3.1 g kg)1 Growth

perfor-mance and feed utilization were significantly influenced by

dietary methionine levels (P < 0.05) Maximum weight gain

(WG), specific growth rate (SGR), feed efficiency ratio, protein

efficiency ratio and protein productive value (PPV) occurred at

17.2 g methionine kg)1 diet, beyond which they showed

declining tendency Protein contents in whole fish body and

dorsal muscle were positively correlated with dietary

methio-nine level, while muscle lipid content was negatively correlated

with it Apparent digestibility coefficients (ADCs) of dietary

nutrients were significantly affected by dietary treatments

except for ADCs of crude lipid Fish fed the grade level of

methionine demonstrated a significant improvement in

whole-body methionine content, total essential amino acids

(PEAA), total non-essential amino acids (PNEAAs) and

P

EAA/P

NEAA ratio (P < 0.05) Regarding serum teristics, significant differences were observed in total choles-

charac-terol, glucose and free methionine concentration (P > 0.05),

while total protein level and triacylglycerol concentration kept

relatively constant among treatments (P < 0.05) Analysis of

dose response with second-order polynomial regression on the

basis of either SGR or PPV, the optimum dietary methionine

requirements of juvenile black sea bream were estimated to

be 17.1 g kg)1of diet (45.0 g kg)1methionine of protein) and

17.2 g kg)1of diet (45.3 g kg)1methionine of protein) in the

presence of 3.1 g kg)1cystine, respectively

Protein, especially when derived from fish meal, is the mostexpensive nutrient in the preparation of diets for aquaticorganisms (El-Saidy & Gaber 2002) Therefore, it is important

to incorporate inexpensive protein ingredients in theformulation of fish feed by taking care of essential amino acids(EAA) balances (Kaushik et al 2004; Azaza et al 2008;Martı´nez-Llorens et al 2009; Sardar et al 2009) Lysine andmethionine are the most limiting amino acids in feed ingredi-ents used in diets for fish, especially, when plant protein sourcesare used to replace fish meal (Abimorad et al 2009; Sardar

et al.2009) Methionine is known as a precursor of choline andvarious other metabolic processes (Ruchimat et al 1997;Kasper et al 2000) As cystine can only be synthesized from amethionine precursor, a portion of the methionine require-ment can be spared by cystine in some fish species (approxi-mately 40–60%) (Moon & Gatlin 1991; Kim et al 1992; Griffin

et al.1994; Goff & Gatlin 2004) Therefore, the requirementfor total sulphur amino acids (TSAA) can be met by eithermethionine alone or the proper mixture of methionine andcystine (Moon & Gatlin 1991) So it is important to considerthe dietary cystine content to quantify the methioninerequirement of the cultured species for maximum growth andefficient feed utilization (Luo et al 2005) In a previous study,

we have evaluated the optimal dietary lysine requirement forblack sea bream (Sparus macrocephalus) (Zhou et al 2010a).However, so far, the quantitative dietary requirement formethionine is still unknown for this fish species

Black sea bream is a valuable commercial fish speciescultured in China, Japan, Korean and some other countries

of Southeast Asia (Nip et al 2003; Gonzalez et al 2008) It is

.

2011 17; 469–481

. doi: 10.1111/j.1365-2095.2010.00823.x

Aquaculture Nutrition

highly appreciated as an excellent aquaculture species for

intensive culture because of its resistance to diseases, ability

to tolerate a wide range of environmental conditions, high

stocking densities and relative fast growth rate under

inten-sive culture and good quality meat (Hong & Zhang 2003;

Shao et al 2008) However, trash fish was used for cultured

black sea bream in China, which could not meet the

nutri-tional requirements, and was difficult to store and easy to

pollute aquaculture environment Thus, the formulation of a

nutritionally adequate and cost-effective feed is most

important for successful and sustainable culture of this fish

species Up to now, a few studies have been conducted on the

nutrient requirements of black sea bream (Ma et al 2008;

Shao et al 2008; Zhou et al 2010a,b; Zhang et al 2010) The

purpose of this study was to quantify the dietary methionine

requirement at a constant dietary cystine level for black sea

bream juveniles

Ingredients and proximate composition of the experimental

diets are presented in Table 1, amino acid compositions

(g kg)1dry diet, L-form) of dietary ingredients in Table 2

and the analysed EAA contents for each diet are given in

Table 3 Six diets were maintained isonitrogenous by

decreasing the levels of glutamic acids as the methionine level

was increased Experimental diets contained 380 g kg)1

crude protein, which was slightly lower than the optimum

protein requirement suggested in our preliminary experiment

(410 g kg)1, Zhang et al 2010) to ensure the maximum

uti-lization of methionine for growth and limited catabolism for

energy (Wang et al 2005; Luo et al 2005) The 280 g kg)1

dietary protein was supplied by fish meal and soybean

pro-tein concentrate, and the remaining by a mixture of

crystal-line amino acids (CAAs) without methionine to simulate an

amino acid profile found in 380 g kg)1whole-body protein of

black sea bream The basal diet (diet 1) contained the

mini-mum level of methionine from fish meal and soybean protein

concentrate The final levels of methionine were confirmed by

amino acid analysis, and the values were 7.5, 10.9, 14.1, 17.2,

20.6 and 23.5 g kg)1, respectively, by adding incremental

levels of crystalline methionine ranging from 0 to 15 g

methionine kg)1diet (Table 3)

The CAAs were coated by carboxymethylcellulose (CMC)

and j-carrageenan as described by Wang et al (2005) In

preparing experimental diets, all dry ingredients as well as

coating CAA mixture were finely ground, weighed, mixed

manually for 5 min and then transferred to a food mixer foranother 15 min mixing Chromic oxide (Cr2O3), which wasused as external indicator for digestibility determination,was dissolved in 100 mL of distilled water (about 40%, v/w)and sprayed with an atomizer on the mash during mixing,then fish oil and corn oil were added slowly while mixing

During mixing, 6 N NaOH was added to establish a pHlevel of 7–8 (Wilson et al 1977) Distilled water was added

to achieve a proper consistency, and the mixture was furtherhomogenized and extruded through a 3-mm die by foodprocessor (Modle L-2730026; EHSY, Co., Shanghai, China)

The noodle-like diets were dried at 23C for 72 h with aircondition and electrical fan Dried noodles were broken intoparticles, sieved to remove particles above 2 mm and thenstored in a refrigerator at )20 C A representative samplewas taken for proximate analysis (Table 1)

Black sea bream were obtained from Marine Fisheries search Institute of Zhejiang province in Zhoushan, China

Re-Prior to initiation of the feeding trial, all fish were kept in800-L circular fiberglass tanks and fed with diet 1 for

2 weeks At the beginning of the experiment, 20 sized and healthy fish (initial mean weight: 14.21 ± 0.24 g,mean ± SD, n = 360) in good health and condition werestocked in each fiberglass tank (350-L water volume) Eachexperimental diet was randomly assigned to triplicate tanks

uniform-in a completely randomized design Each flow-through tankwas supplied with sand-filtered aerated seawater at a flowingrate of 2 L min)1 Fish were maintained under a naturalphotoperiod, and the temperature, ammonia-nitrogen andsalinity of the seawater in tanks were 28 ± 1C, 0.02–

0.04 mg L)1and 29 g L)1, respectively pH was 8.1–8.3, anddissolved oxygen concentrations were above 5.0 mg L)1atany point during the experiment by using air stones withcontinuous aeration Experimental fish were fed by handtwice daily (0800 h and 1600 h), which were fed slowly little

by little to prevent waste of feeds When the experimentalfeeds were supplied, the fish would swim to the water surface

to ingest the feeds As long as fish were fed to satiation, theywould never come up to water surface again Hence, theirapparent satiation could be judged by feeding behaviourobservation, and the feed losses could also be avoided almostcompletely The experiment lasted for 8 weeks and feedconsumption was recorded daily Tanks were thoroughlycleaned as needed and mortality was checked daily

Faeces were collected using a faecal collection columnsimilar to the one described by Cho & Kaushik (1990) All

.

Aquaculture Nutrition 17; 469–481  2010 Blackwell Publishing Ltd

Table 2 Amino acid composition

(g kg)1 diet) of dietary ingredients for

experimental diets (excluding

trypto-phan)

Amino acids

Supplied by 280g fish meal kg)1diet

Supplied by 120 g soybean protein concentrate kg)1diet

Supplied by crystalline amino acids Total

380 g kg)1whole-body protein EAAs

EAAs, essential amino acids; NEAAs, non-essential amino acids.

Table 1 Composition and proximate

analysis of experimental diets (g kg)1

2 Vitamin premix (mg kg)1diet): retinyl acetate, 40; cholecalciferol, 0.1; DL -a-tocopheryl acetate, 80; menadione, 15; niacin, 165; riboflavin, 22; pyridoxine HCl, 40; thiamin mononitrate, 45; D -Ca pantothenate, 102, folic acid, 10; vitamin B-12, 0.9; inositol, 450; ascorbic acid, 150; Na mena- dione bisulphate, 5; thiamin, 5; choline chloride, 320 and p-aminobenzoic acid, 50.

3 Others (%): a-starch, 180; sodium dihydrogen phosphate, 25; j-carrageenan, 25; a-cellulose, 54;

Cr 2 O 3 , 5.

4 Values for the proximate analysis of the test diets are means of triplicate analyses.

.

possible care was taken during feeding so that feed losses

could be avoided almost completely Two hours after the

final feeding of the day, the drain pipe and faecal collection

columns were thoroughly cleaned with a brush to remove the

residual feed and faeces from the system Faeces were then

allowed to settle overnight, and faecal samples were collected

at 06:00 each morning before the next feeding Faeces

col-lected from the settling columns were immediately filtered

with filter papers to separate other materials such as dirt

particles and then stored at )20 C for chemical analysis

Faeces from the same tank were pooled over the sampling

period to provide sufficient faecal matter for analysis

Ten fish at the start of the feeding trial were sampled and

stored frozen ()20 C) for the analysis of proximate carcass

composition At the termination of the 8-week experiment,

approximately 24 h after the last feeding, all fish were

counted and individually weighed Three fish from each tank

were anesthetized (MS-222, Sigma, St Louis, MO, USA at

80 mg L)1) and then stored at)20 C for subsequent

whole-body proximate analysis Blood samples were drawn from

the caudal vein of five fish per tank with a 27-gauge needle

and 1- mL syringe Blood samples were immediately

centri-fuged at 836 g for 10 min (4C) to obtain serum to measure

nutrient levels (Ai et al 2006), and serum was stored at

)20 C until use Dorsal muscles were obtained from all the

remaining fish in each tank and stored at )20 C for

sub-sequent proximate analysis

Pooled fish samples (including whole body, dorsal muscle,

serum and faeces) in each tank were analysed in triplicate for

proximate composition Moisture, ash, crude protein and

crude lipid were determined following methods of the

Asso-ciation of Official Analytical Chemists (AOAC 1995)

Moisture concentration was determined by drying mincedsamples for 6 h in a forced-air oven maintained at 105C

Ash content was analysed by incinerating samples at 600Cfor 24 h in a muffle furnace Crude protein was estimated asKjeldahl-nitrogen using factor 6.25, and crude lipid wasdetermined by Soxhlet extraction with petroleum ether for

6 h The concentrations of total protein, total cholesterol,triacylglycerol and glucose in the serum of juvenile black seabream were all measured within 3 days, using the DiagnosticReagent Kit purchased from Nanjing Jiancheng Bioengi-neering Institute (Nanjing, Jiangsu Province, China)according to the manufacturers instructions Faecal sampleswere oven dried at 105C to a constant weight for thedetermination of dry matter Then the dried samples werefinely ground with a mechanical mortar and pestle and sievedusing a 1-mm screen prior Chromic oxide (Cr2O3) content indiets and faeces was determined by the method of Furukawa

& Tsukahara (1966) Gross energy in feeds and faeces wasdetermined by Automatic Isoperibol Calorimeter (Modle6300; Parr Instrument Company, Moline, IL, USA) in thelaboratory in the Institute of Feed Science, Zhejiang Uni-versity

The amino acid compositions of all samples includingingredients, diets, whole fish body and serum were analysedfollowing acid hydrolysis using an automatic amino acidanalyser (Hitachi 835-50, Tokyo, Japan) with a column(Hitachi custom ion exchange resin no 2619) in the labora-tory in Institute of Feed Science, Zhejiang University Inbrief, performic acid oxidation was performed prior tohydrolysis to oxidize methionine at)10 C for 3 h to obtainmethionine sulfone Then sodium metabisulfite was added todecompose surplus performic acid Subsequently, amino acidwas liberated from protein by hydrolysis with 6 N HCl for

24 h Hydrolysed samples were diluted with sodium citratebuffer, pH was adjusted to 2.2 and individual amino acidcomponents were separated by ion exchange chromatogra-phy Cystine content in diets was determined from the sameacid hydrolysate after treatment with dithiothreitol and so-dium tetrathionate (Inglis & Liu 1970) Tryptophan couldnot be detected after acid hydrolysis and it was excludedfrom analysis at the present experiment

All data were subjected to the analysis of variance and relation analysis when appropriate using the software ofSPSS

cor-for Windows (ver16.0; Chicago, IL, USA) Differencesbetween the means were tested by Tukeys multiple range test

Differences were considered significant at P < 0.05

Broken-Table 3 Analysed essential amino acid (excluding tryptophan)

con-tents in the experimental diets

line regression analysis was performed on specific growth rate

(SGR) and protein productive value (PPV) to establish the

dietary requirement of methionine for black sea bream The

equation used in the model is Y = L + U (R) X), where Y

is the parameter (SGR or PPV) chosen to estimate the

requirement, L is the ordinate and R is the abscissa of the

breakpoint R is taken as the estimated requirement and U is

the slope of the line for X (Robbins et al 1979)

Growth performance, body-organ indices and feed utilization

for juvenile black sea bream given graded levels of methionine

for 8 weeks are shown in Table 4 Survival was the highest for

fish fed the diet containing 17.2 g kg)1 methionine and

showed no significant difference among dietary treatments,

and no other nutritional deficiency signs were observed in

black sea bream fed methionine-deficient diets Mean feed

intake was significantly lower in fish fed 7.5 g methionine kg)1

diet than those of fish fed 14.1 and 17.2 g methionine kg)1

diets, and the values were insignificantly different among the

other groups (P > 0.05) WG and SGR increased with dietary

increasing methionine level up to 17.2 g kg)1, but further

additions of methionine decreased grow rate of black sea

bream Fish fed diet 1 showed the lowest feed efficiency ratio

(FER) (0.78), protein efficiency ratio (PER) (2.10), nitrogen

gain (1.05) and PPV (0.35), and those indices of fish were

significantly improved by methionine supplementation

(P < 0.05), although there were different decline extent for fishfed excessive methionine level diets The highest FER (0.89),PER (2.35) and PPV (0.43) were recorded in the fish fed dietcontaining 17.2 g kg)1 methionine Hepatosomatic index(HSI) was higher in fish fed 23.5 g methionine kg)1diet thanthat of in fish fed diet without methionine supplement, butdifferences among the other treatments were not significant(P > 0.05) Increasing dietary methionine level decreasedcondition factor (CF) values although there was no significantdifference (P > 0.05)

Based on SGR, the optimum requirement of dietarymethionine was estimated to be 17.1 g kg)1 of diet (45.0

g kg)1 of protein) using break-point regression methodanalysis (Fig 1) When PPV was plotted against dietarymethionine, the optimum dietary methionine requirementwas 17.2 g kg)1of diet (45.3 g kg)1of protein) (Fig 2) Be-cause the experimental diets contained 3.1 g kg)1of cystine,the corresponding requirements of this fish for TSAA(Met + Cys, TSAA) were calculated to be 21.1 g kg)1 ofdiet (53.2 g kg)1 of dietary protein) and 21.5 g kg)1 of diet(56.6 g kg)1of dietary protein), respectively

The effects of graded levels of dietary methionine onwhole-body and dorsal muscle composition were described inTable 5 Protein content of whole body showed an increasingtrend with increasing dietary methionine levels (P < 0.05),but there was a slight decline for fish fed the diets over17.2 g kg)1 methionine No significant differences wereobserved in body lipid, ash or moisture among the dietary

Table 4 Growth performance, body-organ indices and feed utilization of black sea bream juvenile fed the diets with graded levels of methionine for 8 weeks

Diets (methionine level, g kg)1) Diet 1 (7.5) Diet 2 (10.9) Diet 3 (14.1) Diet 4 (17.2) Diet 5 (20.6) Diet 6 (23.5)

.

treatments (P > 0.05) Muscle protein content was positively

correlated with dietary methionine level, while lipid content

was negatively correlated with it Ash and moisture contents

were more variable and could not be related to dietarytreatments (P > 0.05)

Data on nutrients digestibility of black sea bream fed thedifferent experimental diets are presented in Table 6 Fish fedthe 17.2 g methionine kg)1diet had higher apparent digest-ibility coefficients (ADCs) of dry matter than that of fish fedthe 7.5 g methionine kg)1diet (P < 0.05), but no significantdifferences were found among fish fed the other diets ADCs

of crude protein was lower in fish fed the diet withoutmethionine supplement (P < 0.05), while the values in therest groups were very stable (P > 0.05) ADCs of gross en-ergy increased significantly with increasing methionine level

up to 17.2 g methionine kg)1diet and then decreased slightly(P < 0.05) However, ADCs of crude lipid were unaffected

by dietary treatments (P > 0.05)

Increasing dietary methionine level increased EAA andnon-essential amino acids (NEAA) contents of whole fishbody, and theP

EAA/PNEAA ratio was also increasedsignificantly (P < 0.05) (Table 7), and the values peaked atfish fed 23.5, 20.6 and 23.5 g methionine kg)1diets, respec-tively The contents of Val, Leu and Ile in different groupswere very stable (P > 0.05); however, the levels of rest EAAs

in whole body showed increasing tendency (P < 0.05) withincreasing dietary methionine level Body methionine con-centration increased significantly with dietary methioninelevels from 7.5 to 20.6 g kg)1, but kept relatively constantthereafter (P > 0.05)

In serum profile, total cholesterol concentration washighest in fish fed 7.5 g methionine kg)1diet (P < 0.05), butshowed no significant differences for fish fed other diets(Table 8) Fish supplied with 7.5 and 23.5 g methionine kg)1diets showed higher glucose content (P < 0.05), compared tothat of fish fed the diets containing 10.9 and 20.6 g kg)1methionine Serum free methionine concentration signifi-

Figure 1 The relationship between weight gain (SGR, %/day, y) and

dietary methionine levels (g kg)1, x) of juvenile black sea bream fed

with the experimental diets for 8 weeks SGR, specific growth rate.

Figure 2 The relationship between protein productive value (PPV, y)

and dietary methionine levels (g kg)1, x) of juvenile black sea bream

fed with the experimental diets for 8 weeks.

Table 5 Effect of dietary methionine level on proximate compositions of whole body and muscle of juvenile black sea bream (% on wet matter

basis)

Diets (methionine level, g kg)1)

Diet 1 (0.75) Diet 2 (10.9) Diet 3 (14.1) Diet 4 (17.2) Diet 5 (20.6) Diet 6 (23.5)

cantly increased with increasing dietary methionine levels

(P < 0.05) although there was no statistical difference for fish

fed 20.6 and 23.5 g methionine kg)1diets (P > 0.05) Serum

total protein content (ranging from 27.68 to 32.80 g L)1)

showed an insignificantly increasing trend with increasing

methionine level, while triacylglycerol concentration

de-creased from 5.47 to 3.93 mmol L)1, and no significant

dif-ferences were observed among treatments (P > 0.05)

Dose–response experiments with increasing supply of amino

acid are accepted in principle as a method for determining

dietary amino acid requirements (Cowey 1995), and themodel used to analyse the dose–response relationship willinfluence the estimate of requirements Because the SGRresponse of fish in the current study was linear, a broken-linemodel resulted in the lowest error term for estimating therequirement appeared to give a more precise empirical figure

In previous studies, some researchers have demonstrated thatcystine could spare dietary methionine portion about 60% inchannel catfish (Harding et al 1977), 51% in yellow perch(Twibell et al 2000), 50% in red drum (Moon & Gatlin 1991;Goff & Gatlin 2004), 42% in rainbow trout (Kim et al 1992)and 40% in hybrid striped bass (Griffin et al 1994); thepresence of dietary cystine reduces the amount of methionine

Table 7 Effect of dietary methionine levels on amino acid contents of whole body (g kg)1on a dry matter basis) in juvenile black sea bream fed for 8 weeks

Diets (methionine level, g kg)1) Diet 1 (7.5) Diet 2 (10.9) Diet 3 (14.1) Diet 4 (17.2) Diet 5 (20.6) Diet 6 (23.5) EAA

EAA 27.34 ± 0.06 d 27.60 ± 0.15 cd 28.01 ± 0.26 c 28.46 ± 0.21 b 28.78 ± 0.11 ab 29.05 ± 0.06 a P

NEAA 28.99 ± 0.08 d 29.26 ± 0.27 cd 29.54 ± 0.15 c 29.62 ± 0.10 bc 30.08 ± 0.19 a 29.83 ± 0.04 ab P

EAA/ P

NEAA 0.94 ± 0.09 c 0.94 ± 0.01 c 0.95 ± 0.01 bc 0.96 ± 0.02 ab 0.96 ± 0.01 a 0.97 ± 0.01 a Values are presented as mean ± SD (n = 3); values with different superscripts in the same row differ significantly (P < 0.05).

EAA, essential amino acids; NEAA, non-essential amino acids; P

EAA, total essential amino acids; P

NEAA, total essential amino acids.

Table 6 Effect of dietary methionine level on apparent digestibility coefficients (ADCs) of main nutrients in diets for juvenile black sea bream for 8 weeks

Diets (methionine level, g kg)1) Diet 1 (7.5) Diet 2 (10.9) Diet 3 (14.1) Diet 4 (17.2) Diet 5 (20.6) Diet 6 (23.5) Dry matter 85.17 ± 1.24 b 87.86 ± 1.29 ab 88.18 ± 1.68 ab 90.21 ± 0.77 a 88.04 ± 0.54 ab 87.47 ± 1.39 ab Protein 95.32 ± 0.50 b 97.15 ± 0.42 a 96.65 ± 0.48 a 97.30 ± 0.63 a 96.78 ± 0.22 a 96.63 ± 0.35 a

Gross energy 88.17 ± 0.40 c 89.12 ± 0.43b c 90.29 ± 0.30 b 91.83 ± 0.21 a 91.45 ± 0.72 ab 90.19 ± 0.53 b ADC of dry matter (%) = 100 · [1 ) (dietary Cr 2 O 3 )/faecal Cr 2 O 3 ].

ADCs of nutrients or energy (%) = 100 · [1 ) (F/D ) DY/FY)], where F is the per cent of nutrients or energy in faeces, D is the per cent of nutrients or energy in diet, DY is the per cent of Cr 2 O 3 in diet and FY is the per cent of Cr 2 O 3 in faeces.

Values are presented as mean ± SD (n = 3); means with different superscript letters in the same row differ significantly (P < 0.05).

.

required for maximum growth Thus, Wilson & Halver

(1986) suggested that fish have a TSAA (Met + Cys)

requirement rather than a specific methionine requirement

Methionine or total sulphur amino acids requirements have

been reported varying from 22.0 to 65.0 g kg)1 of dietary

protein in different fish species (De Silva & Anderson 1995)

In the present study, the TSAA requirement of juvenile black

sea bream was determined to be 53.2 g kg)1of dietary

pro-tein (in the presence of dietary 3.1 g kg)1cystine) based on

growth performance This value was higher than that

re-ported for some commercially important finfish species,

namely, milkfish (43.7 g kg)1, Borlongon & Coloso 1993),

Jian carp (42.9 g kg)1, Tang et al 2009), large yellow croaker

(40.2 g kg)1, Mai et al 2006), catla (35.5 g kg)1, Ravi &

Devaraj 1991), yellowtail (32.8 g kg)1, Ruchimat et al 1997),

grouper (32.3 g kg)1, Luo et al 2005), African catfish

(32 g kg)1, Fagbenro et al 1998), Japanese flounder

(31 g kg)1, Alam et al 2000) and yellow perch (30 g kg)1,

Twibell et al 2000) But, the requirement of black sea bream

is nearer to Indian major carp (55.0 g kg)1, Ahmed et al

2003) and rohu (55.8 g kg)1, Khan & Jafri 1993) The wide

variation observed in the methionine requirement among

species may be because of fish size, age, laboratory condition

including feeding regime, feed allowance, water temperature,

stock density and ingredients used for basal diet such as zein,

casein, gelatin, gluten, soybean meal, fishmeal and CAAs in

various combinations (Tacon & Cowey 1985; Rodehutscord

et al.1997; Forster & Dominy 2006; Nguyen & Davis 2009b)

In the current work, higher levels of cystine were not tested

so that it is not apparent whether this dietary level of cystine

is adequate, and it could also be a possible reason for the

relatively higher methionine requirement in this study

However, in the study of rainbow trout, Walton et al (1982)

observed similar growth performance of fish fed diets with or

without cystine provided that the level of methionine was

adjusted to meet the requirement level Because a portion of

dietary methionine is converted to cystine the presence of

dietary cystine reduces the amount of methionine required

for maximum growth The replacement value of cystine formethionine and the use of methionine to provide for the totalsulphur amino acid requirement of black sea bream should

be further evaluated

Amino acid balance in diets is necessary for optimalgrowth of fish (Wilson & Halver 1986), and most authorsreported that fish fed dietary increasing methionine showedtwo different growth pattern: (i) increased with increasingdietary methionine and then remained constant when dietarymethionine is higher than requirement (Ruchimat et al 1997;

Coloso et al 1999; Alam et al 2001; Luo et al 2005; Nguyen

& Davis 2009a) (ii) increased with increasing dietary onine level and then decreased significantly when dietarymethionine is higher than requirement (Murthy & Varghese1998; Mai et al 2006; Yan et al 2007) A few studiesreported that none of the fish fed the test diets containingincreased methionine showed a significant difference ingrowth (Sveier et al 2001; Espe et al 2008) In the presentstudy, the growth response black sea bream fed increasingmethionine diets is in accordance with the second pattern

methi-Reduction in the growth rate in fish fed diets with ous level of TSAA may be because of toxic effects (Choo

superflu-et al.1991), and excess amount of total sulphur amino acid infish body would lead to extra energy expenditure towardsdeamination and excretion (Walton 1985; Murthy & Var-ghese 1998; Sveier et al 2001)

FER obtained in the present study ranged from 0.78 to 0.89,which exhibited correlation with fish growth and seems satis-factory One possible reason may be that fish were slowly fed

by hand little by little till apparent satiation (visual tion of fish feeding behaviour) and prevent the waste of feeds

observa-On the other hand, generally high FER suggested that blacksea bream is able to utilize CAAs well in diets However, therewas a marked decline in FER when fish fed methionine defi-ciency diet or superfluous methionine diets, indicating that thesupplementing level of methionine should be optimized Feedintake was much lower when fish fed diet methionine-unsup-plemented diets These results are similar to those reported in

Table 8 Determination of serum parameters in juvenile black sea bream, fed with graded levels of methionine for 8 weeks

Diets (methionine level, g kg)1) Diet 1 (7.5) Diet 2 (10.9) Diet 3 (14.1) Diet 4 (17.2) Diet 5 (20.6) Diet 6 (23.5) Total protein (g L)1) 27.68 ± 1.06 30.56 ± 2.16 31.29 ± 1.94 32.79 ± 3.08 30.52 ± 2.10 32.80 ± 1.76

T-CHO (mmol L)1) 9.33 ± 0.70 a 7.27 ± 0.42 b 6.76 ± 0.21 b 6.60 ± 0.11 b 6.61 ± 0.54 b 6.99 ± 0.52 b

GLU (mmol L)1) 9.66 ± 1.37 a 6.52 ± 1.35 b 6.43 ± 1.21 b 6.61 ± 0.58 b 6.39 ± 0.74 b 7.45 ± 0.68 a

Free met (mmol 100 mL)1) 8.22 ± 0.06 e 8.39 ± 0.05 d 8.61 ± 0.07 c 8.79 ± 0.03b c 8.96 ± 0.11 ab 9.14 ± 0.07 a

Values are presented as mean ± SD (n = 3); values with different superscripts in the same row differ significantly (P < 0.05).

T-CHO, total cholesterol; TG, triacylglycerol; GLU, glucose concentration.

.

Aquaculture Nutrition 17; 469–481  2010 Blackwell Publishing Ltd

large yellow croaker (Mai et al 2006), Indian major carp

(Ahmed et al 2003) and yellow perch (Twibell et al 2000) In

more recent work, Li et al (2009) reported that methionine

deficiency in aquafeeds may reduce/exhaust reservoirs of

an-tioxidants such as ascorbic acid, glutathione and vitamin E in

various tissues of fish, which may result in irreversible

oxida-tive stress, further aggravating growth retardation and feeding

depression, which could also partly explain the preset results

The present study showed significantly decreased PER at high

dietary methionine It may be because of unbalance amino

acids composition in diets and diverting amino acids into

catabolic rather than anabolic processes (Cowey & Sargent

1979) However, values of nitrogen gain and PPV decreased

insignificantly at higher methionine level diets when compared

with fish fed optimal methionine level diet Similar results were

observed in some previous studies (Ruchimat et al 1997; Luo

et al.2005; Yan et al 2007) This is to be expected as growth is

largely driven by protein deposition (Sa´ et al 2008) Indeed, it

was concluded that using maximum nitrogen gain as response

criteria results in higher EAAs requirement estimates than

WG in rainbow trout and Atlantic salmon (Rodehutscord

et al.1997; Hauler & Carter 2001; Espe et al 2007) Results

were similar to our observation; the optimal methionine for

PPV was estimated to be 17.2 g kg)1diet (corresponding to

53.2 g kg)1of dietary protein), which was slightly higher than

the optimum requirement for growth in the present study

In Asian sea bass, HSI were unaffected by dietary

methi-onine level (Coloso et al 1999), and in Atlantic salmon, low

methionine intake resulted in a significantly higher liver

weight relative to body weight (Espe et al 2008) However,

HSI was reported to increase with increased dietary

methi-onine up to requirement level and kept constant at higher

methionine levels in yellowtail (Ruchimat et al 1997) and

rockfish (Yan et al 2007), similar in the present study In

addition, Walton et al (1982) pointed out that the

methio-nine/cystine ratio affected HSI, and HSI decreased when

methionine increased with the cystine level was 0.5 g kg)1

diet However, when the cystine level was 20.5 g kg)1,

increasing methionine level resulted in a slight increase in

HSI There were, however, no significant differences

ob-served in CF of black sea bream among dietary treatments

Similar result was also found in Atlantic salmon (Sveier et al

2001) and cobia (Zhou et al 2006), but in contradiction with

the observation in grouper (Luo et al 2005)

Methionine has three major metabolic functions: as an

EAA for protein synthesis; as a sulphur source for synthesis

of other sulphur-containing biochemicals; and as a methyl

donor for methylation reactions (Mehler 1986) In the

pres-ent study, protein contpres-ents in whole body and muscle of

black sea bream both tended to increase with dietarymethionine level up to the requirement level, beyond which itremained nearly unchanged, which is in agreement with otherreports (Kim et al 1992; Ruchimat et al 1997; Alam et al.2000; Luo et al 2005) De la Higuera et al (1997) suggestedprotein synthesis and accretion in fish required all aminoacids present simultaneously at the synthesis sites, or theprocess is impaired or prevented The variational tendency

on protein accretion was also consistent to nitrogen retentionvalues that obtained in the present study Among aminoacids, the branched-chain amino acid leucine is clearly rec-ognized as a most effective nutrient regulator of mRNAtranslation and proteolysis (Kimball & Jefferson 2004; Yo-shizawa 2004; Nakashima et al 2005) However, the role ofmethionine acting a nutrient signal to regulate protein syn-thesis still needs extensive studies It has demonstrated thatthe first step of the initiation of mRNA translation consists

of the binding of initiator Met-tRNAi to the 40S ribosomalsubunit to form the 43S preinitiation complex This initiationstep may be inhibited by methionine deficiency (Me´tayer

et al.2008) With regard to the potential effect of methionine

on intracellular kinases, studies are sparse but indicate thatthis sulphur amino acid may exert a signal function byinducing 70-kDa ribosomal protein S6 kinase (p70S6K)activation in mammals (Shigemitsu et al 1999; Stubbs et al.2002) Similar results have been found in an avian myoblastcell line (QM7) of quail origin (Tesseraud et al 2003), inwhich the methionine or leucine regulates S6K1 phosphory-lation and protein synthesis It seems there may be also aregulation of protein synthesis by methionine in fish; how-ever, the mechanism was not clear and more investigationsare needed to confirm these aspects Lipid content of dorsalmuscle in the present study was higher in fish fed methionine-unsupplemented diet than those of fish fed the high-methio-nine diets, which might be because of better utilization ofprotein with reduced deposition of lipid in the presence ofmethionine resulting lean growth of fish (Sardar et al 2009).The results were consistent with Kim et al (1992) and Sch-warz et al (1998), but in contrast with the study in grouper(Luo et al 2005)

With regard to the effect of methionine levels on dietarynutrients digestibility, studies are sparse Digestibility dataare important to the fish nutritionist because the nutrientscontained in poorly digested ingredients are less available tosupport growth and metabolism (Lin et al 2004) ADCs ofcrude protein in this study were higher than 95.32% andaveraging 96.64%, indicating that all the nitrogen sourcesprovided in the experimental diets were well absorbed andutilized by the juvenile black sea bream It has reported that

.

CAAs coated with CMC and j-carrageenan used in diets can

improve the utilization effectiveness by reducing its solubility

in water, and encapsulation or covalent binding may also

help to slow the rate of release of CAAs to transport sites in

the intestinal mucosa of fish (Millamena et al 1996; Alam

et al.2004), thus protecting free amino acids in the gut long

enough to improve their utilization efficiency

(Segovia-Quintero & Reigh 2004) ADCs of crude protein was

significantly higher in black sea bream fed the test diets

supplying methionine when compared to those fed the

con-trol diet, which was consistent with the findings by Espe et al

(2008) and Chi et al (in press) In the present study, ADCs

of gross energy showed a similar tendency among the groups

as the FER; it is according to the result observed in salmon,

in which the reduced feed efficiency was to a large extent

explained by reduced energy and protein digestibility

(Mundheim et al 2004) The ADCs of crude of lipid in all

groups were relatively higher (more than 96.59%) in present

study, and independent of the dietary treatments, the values

compare favourably to data obtained in other sparids

(Santinha et al 1996; Robaina et al 1995; Biswas et al

2007) Nevertheless, it should be noted that extraction of

faeces with petroleum ether does not extract the fatty acids

bound as calcium soaps, and this extraction will therefore to

some extent underestimate the amount of lipids in the faeces

and overestimate lipid digestibility (Santinha et al 1996) In

general, few investigations with effects of methionine

sup-plemented on nutrients digestibility were reported Di- and

tripeptides are absorbed into the enterocytes without any

hydrolysis by microvillous peptidases (Jose et al 1997), and

c-glutamyltransferase (c-GT) is involved in peptide transport

(Griffith & Meister 1980), and in the study with Jian carp,

Tang et al (2009) found that there was significant

improve-ment in intestine and hepatopancreas weight, as well as c-GT

activity by dietary methionine level Also in the study by

Tang et al (2009), methionine was reported to improve

intestinal creatine kinase activity, which plays a role in energy

transfer in tissue Anyhow, it is necessary to conduct further

studies to make clear this aspect

To support the requirement estimated by growth response,

whole fish body EAA contents of experimental black sea

bream were analysed (Table 7) Dietary amino acid profiles

are known to influence the postfeeding levels of free amino

acids in fish tissues, such as plasma, liver, muscle and whole

body (Twibell et al 2000; Zhou et al 2006; Espe et al 2007)

Both the total EAA and NEAA content of whole fish body

showed marked increase with increasing dietary methionine

level, which was similar to other results which have

demon-strated that dietary methionine level affects tissue free amino

acids in fish (Griffin et al 1994; Luo et al 2005) It wasprobably because dietary restriction of one EAA led to anincrease in oxidation of other essential and non-essentialamino acids present at normal levels in the diets (Ronnestad

et al 2000; Ozo´rio et al 2002) Mai et al (2006) suggestedmethionine deficiency in diet could inhibit methionine par-ticipating in protein synthesis and reduce its level in aminoacid pool in tissues; however, in the present study, methio-nine concentration in fish body increased significantly withdietary methionine levels, similar result was also observed ingroup (Luo et al 2005) According to Espe et al (2007), theratio ofP

EAA toP

NEAA was held close to 1 to maximizeamino acid utilization; however, in the present trial, theP

EAA/PNEAA ratio was observed to increase significantlywith dietary methionine level It has been demonstrated thatexcessive intake of one amino acid or disproportionateamounts of one amino acid affect the utilization of the otheramino acids (Choo et al 1991; Coloso et al 1999), but themaximum value of P

EAA/PNEAA ratio in whole fishbody occured in fish fed the highest methionine level diet

The reason for this discrepancy is uncertain, and black seabream might be able to assimilate excess dietary amino acidsinto tissues within a short period

Currently, little information is available on the effect ofdietary methionine on serum characteristics The free aminoacid content in the blood initially reflects the content ofamino acids in the dietary protein following absorption(Yamada et al 1981; Simmons et al 1999), and methioninemay accumulate in blood when the total dietary methioninesupply exceeds the requirement (Mambrini et al 1999) Incorroboration with the present findings, Harding et al

(1977), Schwarz et al (1998) and Zhou et al (2006) allobserved that free methionine concentration in bloodincreased with increasing dietary methionine Plasma orserum methionine levels have been used to confirm dietaryTSAA requirements derived from WG and FER data insome fish species (Harding et al 1977; Griffin et al 1994);

however, Cowey (1995) considers the free amino acids inplasma to be relatively unsuitable for the determination ofamino acid requirements, because no close relationshipexists between intake and concentration in animal tissues

In the current study, serum methionine concentrations werepositively related to the dietary supply; consequently, itcould not be used evaluating methionine requirement forblack sea bream There was an increasing tendency in serumprotein concentration with dietary methionine level, whichwas similar with Luo et al (2005) The observation ofhigher serum cholesterol content for fish fed low-methioninediets compared with high-methionine diets was also

.

Aquaculture Nutrition 17; 469–481  2010 Blackwell Publishing Ltd

reported by Yan et al (2007), but inconsistent with Luo

et al (2005) Contrary to the study in cobia (Zhou et al

2006), serum glucose content in black sea bream

signifi-cantly decreased while dietary methionine levels increased;

however, it increased significantly at the maximum dietary

methionine level Ruchimat et al (1997) suggested that

plasma triacylglycerol in yellowtail significantly increased

with dietary methionine levels, while triacylglycerol

con-centrations in serum of black sea bream were more variable

and could not be related to dietary treatments Zhou et al

(2007) pointed out the effects on blood parameters were

more likely because of the nutritional stress of the fish

instead of a specific effect of the deficient amino acid The

mechanism of methionine for those observations was not

clear and needs further investigation

In conclusion, the current results on feeding methionine to

juvenile black sea bream (initial average weight: 14.21 ±

0.24 g) showed the improvement effects on growth

perfor-mance and feed utilization Based on SGR and PPV, the

optimum requirement of dietary methionine for juvenile

black sea bream was estimated to be 17.1 g kg)1 of diet

(45.0 g kg)1methionine of protein) and 17.2 g kg)1 of diet

(45.3 g kg)1 methionine of protein), in the presence of

3.1 g kg)1 of dietary cystine Hence, under the present

experimental conditions, the corresponding TSAA

require-ments of this fish were calculated to be 20.2 g kg)1of diet

(53.2 g kg)1 of dietary protein) and 20.3 g kg)1 of diet

(53.4 g kg)1of dietary protein), respectively The potential

for cystine sparing methionine and regulation mechanisms of

methionine on growth and protein synthesis warrant further

investigation

The study was supported by Oceanic public-beneficial

scien-tific fund (State Oceanic Administration Peoples Republic Of

China, 201005013-08) and Scientific support program for

mariculture and demonstration in the East China Sea (The

Ministry of Science and Technology of the Peoples Republic

Of China, 2011)

We thank the Key Lab of Mariculture and Enhancement

of Zhejiang Province, and China-Norwegian Joint

Labora-tory of Nutrition and Feed for Marine Fish (Zhoushan,

ZheJiang province) for supplying the experimental black sea

bream, allowing us to use the experimental base and their

logistic support during the feeding experiment We also

thank J.Z Xu, Z Sun, Y.J Xu, F.P Yu, G.Y Zhong, W.X

Song and W Xiong for their assistance with caring for the

Ai, Q.H., Mai, K.S., Tan, B.P., Wei, X., Zhang, W.B., Ma, H.M & Liufu, Z.G (2006) Effects of dietary vitamin C on survival, growth, and immunity of large yellow croaker, Pseudosciaena crocea Aquaculture, 261, 327–336.

Alam, M.S., Teshima, M., Ishikawa, M & Koshio, S (2000) Methionine requirement of juvenile Japanese Flounder Paralich- thys olivaceus J World Aquac Soc., 31, 618–626.

Alam, M.S., Teshima, M., Ishikawa, M., Koshio, S & Yaniharto, D (2001) Methionine requirement of juvenile Japanese flounder Paralichthys olivaceus estimated by the oxidation of radioactive methionine Aquac Nutr., 7, 201–209.

Alam, M.S., Teshiima, S., Kodhiio, S & Ishikawa, M (2004) Effects

of supplementation of coated crystalline amino acids on growth performance and body composition of juvenile kuruma shrimp Marsupenaeus japonicus Aquac Nutr., 10, 309–316.

AOAC (1995) Official Methods of Analytical of the Association of Official Analytical Chemists, 16th edn AOAC, Arlington, VA Azaza, M.S., Mensi, F., Ksouri, J., Dhraief, M.N., Brini, B., Abd- elmouleh, A & Kraı¨em, M.M (2008) Growth of Nile tilapia (Oreochromis niloticus L.) fed with diets containing graded levels of green algae ulva meal (Ulva rigida) reared in geothermal waters of southern Tunisia J Appl Ichthyol., 24, 202–207.

Biswas, A.K., Kaku, H., Ji, S.C., Seoka, M & Takii, K (2007) Use

of soybean meal and phytase for partial replacement of fish meal in the diet of red sea bream, Pagrus major Aquaculture, 267, 284–291 Borlongon, I.G & Coloso, R.M (1993) Requirements of juvenile milkfish (Chanos chanos Forsskal) for essential amino acids.

J Nutr., 123, 125–132.

Chi, S.Y., Tan, B.P., Lin, H.Z., Mai, K.S., Ai, Q.H., Wang, X.J., Zhang, W.B., Xu, W & Liufu, Z.G (in press) Effects of supple- mentation of crystalline or coated methionine on growth perfor- mance and feed utilization of the pacific white shrimp, Litopenaeus vannamei Aquac Nutr., in press.

Cho, C.Y & Kaushik, S.J (1990) Nutritional energetics in fish: ergy and protein utilization in rainbow trout (Salmo gairdneri) World Rev Nutr Diet., 61, 132–172.

en-Choo, P.S., Smith, T.K., Cho, C.Y & Ferguson, W.H (1991) tary excesses of leucine influence on growth and body composition

Die-of rainbow trout J Nutr., 121, 1932–1939.

Coloso, R.M., Murillo-Gurrea, D.P., Borlongan, I.G & Catacutan, M.R (1999) Sulphur amino acid requirement of juvenile Asian sea bass Lates calvarifer J Appl Ichthyol., 15, 54–58.

Cowey, C.B (1995) Protein and amino acids requirements: a critique

of methods J Appl Ichthyol., 11, 199–204.

Cowey, C.B & Sargent, J.R (1979) Nutrition In: Fish Physiology, Vol VIII Bioenergetics and Growth (Hoar, W.S., Randall, D.J & Brett, J.R eds), pp 1–69 Academic Press, New York.

De la Higuera, M., Garzo´n, A., Hidalgo, M.C., Perago´n, J., denete, G & Lupia´n˜ez, J.A (1997) Influence of temperature and dietary-protein supplementation either with free or coated lysine

Car-on the fractiCar-onal protein-turnover rates in the white muscle of carp Fish Physiol Biochem., 18, 85–95.

De Silva, S.S & Anderson, T.A (eds) (1995) Fish Nutrition in Aquaculture, pp 319 Chapman and Hall, London, UK.

.

El-Saidy, D.M.S.D & Gaber, M.M.A (2002) Complete replacement

of fish meal by soybean meal with dietary L-lysine

supplementa-tion for Nile tilapia Oreochromis niloticus (L.) fingerlings J World

Aquac Soc., 33, 297–306.

Espe, M., Lemme, A., Petri, A & El-Mowafi, A (2007) Assessment

of lysine requirement for maximal protein accretion in Atlantic

salmon using plant protein diets Aquaculture, 263, 168–178.

Espe, M., Hevrøy, E.M., Liaset, B., Lemme, A & El-Mowafi, A.

(2008) Methionine intake affect hepatic sulphur metabolism in

Atlantic salmon, Salmo salar Aquaculture, 274, 132–141.

Fagbenro, O.A., Balogun, A.M & Fasakin, E.A (1998) Dietary

methionine requirement of the African catfish, Clarias gariepinus.

J Appl Aquac., 8, 47–54.

Forster, I.P & Dominy, W.G (2006) Efficacy of three methionine

sources in diets for Pacific white shrimp, Litopenaeus vannamei.

J World Aquac Soc., 37, 474–480.

Furukawa, A & Tsukahara, H (1966) On the acid digestion method

for the determination of chromic oxide as an index substance in

the study of digestibility in fish feed Bull Jpn Soc Sci Fish., 32,

502–508.

Goff, J.B & Gatlin, D.M III (2004) Evaluation of different sulfur

amino acid compounds in the diet of red drum, Sciaenops

ocella-tus, and sparing value of cystine for methionine Aquaculture, 241,

465–477.

Gonzalez, E.B., Umino, T & Nagasawa, K (2008) Stock

enhance-ment programme for black sea bream, Acanthopagrus schlegelii

(Bleeker), in Hiroshima Bay, Japan: a review Aquac Res., 39,

1307–1315.

Griffin, M.E., White, M.R & Brown, P.B (1994) Total sulfur amino

acid requirement and cystein replacement value for juvenile hybrid

striped bass (Morone chrysops · M saxatilis) Comp Biochem.

Physiol., 108A, 423–429.

Griffith, O.W & Meister, A (1980) Excretion of cysteine and

c-glutamylcysteine moities in human and experimental animal

c-glutamyl transpeptidase deficiency Proc Natl Acad Sci USA,

77, 3384–3387.

Harding, D.C., Allen, O.W & Wilson, R.P (1977) Sulfur amino acid

requirement of channel catfish: L-methionine and L-cystine.

J Nutr., 107, 2031–2035.

Hauler, R.C & Carter, C.G (2001) Lysine deposition responds

lin-early to marginal lysine intake in Atlantic salmon (Salmo salar L.)

parr Aquac Res., 32(Suppl 1), 147–156.

Hong, W.S & Zhang, Q.Y (2003) Review of captive bred species

and fry production of marine fish in China Aquaculture, 227, 305–

318.

Inglis, A.S & Liu, T (1970) The stability of cysetine and cystine

during acid hydrolysis of protein and peptides J Biol Chem., 245,

112–116.

Jose, L.Z.I., Chantal, L.C & Armande, P (1997) Partial substitution

of di- and tripeptides for native proteins in sea bass diet improves

Dicentrarchus labrax larval development J Nutr., 127, 608–614.

Kasper, C.S., White, M.R & Brawn, P.B (2000) Choline is required

by tilapia when methionine is not in excess J Nutr., 130, 238–244.

Kaushik, S.J., Coves, D., Dutto, G & Blanc, D (2004) Almost total

replacement of fish meal by plant protein sources in the diet of a

marine teleost, the European seabass, Dicentrarchus labrax.

Aquaculture, 230, 391–404.

Khan, M.A & Jafri, A.K (1993) Quantitative dietary requirement

for some indispensable amino acids in the Indian major carp,

Labeo rohita (Hamilton) fingerling J Aquac Trop., 8, 67–80.

Kim, K.I., Kayes, T.B & Amundson, C.H (1992) Requirements for

sulphur amino acids and utilization of D-methionine by rainbow

trout (Oncorhynchus mykiss) Aquaculture, 101, 95–103.

Kimball, S.R & Jefferson, L.S (2004) Regulation of global and specific mRNA translation by oral administration of branched- chain amino acids Biochem Biophys Res Commun., 313, 423–

427.

Li, P., Burr, G.S., Wen, Q., Goff, J.B., Murthy, H.S & Gatlin, D.M.

III (2009) Dietary sufficiency of sulfur amino acid compounds influences plasma ascorbic acid concentrations and liver peroxi- dation of juvenile hybrid striped bass (Morone chrysops · M.

saxatilis) Aquaculture, 287, 414–418.

Lin, H., Liu, Y.J., Tian, L.X., Wang, J.T., Zheng, W.H., Huang, J.N.

& Chen, P.J (2004) Apparent digestibility coefficients of various feed ingredients for Grouper Epinephelus cowides J World Aquac.

Soc., 35, 134–142.

Luo, Z., Liu, Y.J., Mai, K.S., Tian, L.X., Yang, H.J., Tan, X.Y &

Liu, D.H (2005) Dietary L-methionine requirement of juvenile grouper Epinephelus coioides at a constant dietary cystine level.

Aquaculture, 249, 409–418.

Ma, J.J., Xu, Z.R., Shao, Q.J., Xu, J.Z., Hung, S.S.O., Hu, W.L &

Zhuo, L.Y (2008) Effect of dietary supplemental L-carnitine on growth performance, body composition and antioxidant status in juvenile black sea bream, Sparus macrocephalus Aquac Nutr., 14, 464–471.

Mai, K.S., Wan, J.L., Ai, Q.H., Xu, W., Liufu, Z.G., Zhang, L., Zhang, C.X & Li, H.T (2006) Dietary methionine requirement of large yellow croaker, Pseudosciaena crocea R Aquaculture, 253, 564–572.

Mambrini, M., Rome, A.J., Carvedi, J.P., Lalles, J.P & Kaushik, S.J (1999) Effects of replacing fish meal with soy protein con- centrate and of DL-methionine supplementation in high-energy, extruded diets on the growth and nutrient utilization of rainbow trout, Oncorhynchus mykiss J Anim Sci., 77, 2990–2999.

Martı´nez-Llorens, S., Vidal, A.T., Garcia, I.J., Torres, M.P &

Ceada´, M.J (2009) Optimum dietary soybean meal level for maximizing growth and nutrient utilization of on-growing gilthead sea bream (Sparus aurata) Aquac Nutr., 15, 320–328.

Mehler, A.H (1986) Amino acid metabolism II: metabolism of the individual amino acids In: Textbook of Biochemistry: With Clin- ical Correlations (Devlin, T.M ed.), pp 462–464 John Wiley &

Sons Inc, USA.

Me´tayer, S., Collin, A., Ducheˆne, S., Mercier, Y., Pierre-Andre´, G &

Tesserau, S (2008) Mechanisms through which sulfur amino acids control protein metabolism and oxidative status J Nutr Bio- chem., 19, 207–215.

Millamena, O.M., Bautista-Temel, M.N & Kanazawa, A (1996) Methionine requirement of juvenile tiger shrimp Penaeus monodon Fabricius Aquaculture, 143, 403–410.

Moon, H.Y & Gatlin, D.M III (1991) Total sulfur amino acid requirement of juvenile red drum, Sciaenops ocellatus Aquaculture,

95, 97–106.

Mundheim, H., Aksnes, A & Hope, B (2004) Growth, feed ciency and digestibility in salmon (Salmo salar L.) fed different dietary proportions of vegetable protein sources in combination with two fish meal qualities Aquaculture, 237, 315–331.

effi-Murthy, H.S & Varghese, T.J (1998) Total sulphur amino acid requirement of the Indian major carp, Labeo rohita (Hamilton).

Aquac Nutr., 4, 61–65.

Nakashima, K., Ishida, A., Yamazaki, M & Abe, H (2005) cine suppresses myofibrillar proteolysis by down-regulating ubiquitin–proteasome pathway in chick skeletal muscles Bio- chem Biophys Res Commun., 336, 660–666.

Leu-Nguyen, T.N & Davis, D.A (2009a) Methionine requirement in practical diets of juvenile Nile tilapia, Oreochromis niloticus.

J World Aquac Soc., 40, 410–416.

.

Aquaculture Nutrition 17; 469–481  2010 Blackwell Publishing Ltd

Nguyen, T.N & Davis, D.A (2009b) Re-evaluation of total sulphur

amino acid requirement and determination of replacement value of

cystine for methionine in semi-purified diets of juvenile Nile

tila-pia, Oreochromis niloticus Aquac Nutr., 15, 247–253.

Nip, T.H.M., Ho, W.Y & Wong, C.K (2003) Feeding ecology of

larval and juvenile black seabream (Acanthopagrus schlegeli) and

Japanese seaperch (Lateolabrax japonicus) in Tolo Harbour, Hong

Kong Environ Biol Fish, 66, 197–209.

Ozo´rio, R.O.A., Booms, G.H.R., Huisman, E.A & Verreth, J.A.J.

(2002) Changes in amino acid composition in the tissues of African

catfish (Clarias gariepinus) as a consequence of dietary L-cartinine

supplements J Appl Ichthyol., 18, 140–147.

Ravi, J & Devaraj, K.V (1991) Quantitative essential amino acid

requirements for growth of catla, Catla catla (Hamilton)

Aqua-culture, 96, 281–291.

Robaina, L., Izquierdo, M.S., Moyano, T.F.J., Socorro, J., Vergara,

J.M., Montero, D & Ferna´ndez-Palacios, H (1995) Soybean and

lupin seed meals as protein sources in diets for gilthead seabream

(Sparus aurata): nutritional and histological implications

Aqua-culture, 130, 219–233.

Robbins, K.R., Norton, H.W & Baker, D.H (1979) Estimation of

nutrient requirements from growth data J Nutr., 109, 1710–1714.

Rodehutscord, M., Becker, A., Pack, M & Pfeffer, E (1997)

Re-sponse of rainbow trout (Oncorhynchus mykiss) to supplements of

individual essential amino acids in a semipurified diet, including an

estimate of the maintenance requirement of essential amino acids.

J Nutr., 126, 1166–1175.

Ronnestad, I., Conceicao, L.E.C., Aragao, C & Dinis, M.T (2000)

Free amino acids are absorbed faster and assimilated more

effi-ciently than protein in postlarval Senegal sole (Solea senegalensis).

J Nutr., 130, 2809–2812.

Ruchimat, T., Masumoto, T., Hosokawa, H & Shimeno, S (1997)

Quantitative methionine requirement of yellowtail (Seriola

quin-queradiata) Aquaculture, 150, 113–122.

Sa´, R., Pousa˜o-Ferreira, P & Oliva-Teles, A (2008) Dietary protein

requirement of white sea bream (Diplodus sargus) juveniles Aquac.

Nutr., 14, 309–317.

Santinha, P.J.M., Gomes, E.F.S & Coimbra, J.O (1996) Effects of

protein level of the diet on digestibility and growth of gilthead sea

bream, Sparus auratus L Aquac Nutr., 2, 81–87.

Sardar, P., Abid, M., Randhawa, H.S & Prabhakar, S.K (2009)

Effect of dietary lysine and methionine supplementation on

growth, nutrient utilization, carcass compositions and

haemato-biochemical status in Indian Major Carp, Rohu (Labeo rohita H.)

fed soy protein-based diet Aquac Nutr., 15, 339–346.

Schwarz, F.J., Kirchgessner, M & Deuringer, U (1998) Studies on

the methionine requirement of carp (Cyprinus carpio L.)

Aqua-culture, 161, 121–129.

Segovia-Quintero, M.A & Reigh, R.C (2004) Coating crystalline

methionine with tripalmitin-polyvinyl alcohol slows its absorption

in the intestine of Nile tilapia, Oreochromis niloticus Aquaculture,

238, 355–367.

Shao, Q.J., Ma, J.J., Xu, Z.R., Hu, W.L., Xu, J.Z & Xie, S.Q (2008)

Dietary phosphorus requirement of juvenile black sea bream,

Sparus macrocephalus Aquaculture, 277, 92–100.

Shigemitsu, K., Tsujishita, Y., Miyake, H., Hidayat, S., Tanaka, N.

& Hara, K (1999) Structural requirement of leucine for activation

of p70S6 kinase FEBS Lett., 447, 303–306.

Simmons, L., Moccia, R.D & Bureau, D.P (1999) Dietary

methi-onine requirement of juvenile Arctic charr Salvelinus alpinus (L.).

Aquac Nutr., 5, 93–100.

Stubbs, A.K., Wheelhouse, N.M., Lomax, M.A & Hazlerigg, D.G.

(2002) Nutrient-hormone interaction in the ovine liver: methionine

supply selectively modulates growth hormone-induced IGF-I gene expression J Endocrinol., 174, 335–341.

Sveier, H., Norda˚s, H., Berge, G.E & Lied, E (2001) Dietary inclusion of crystalline D- and L-methionine: effects on growth, feed and protein utilization, and digestibility in small and large Atlantic salmon (Salmo salar L.) Aquac Nutr., 7, 169–181.

Tacon, A.G & Cowey, C.B (1985) Protein and amino acid requirements In: Fish Energetics and New Perspectives (Tytler, P.

& Calow, P eds), pp 155–183 Croom-Helm, London.

Tang, L., Wang, G.X., Jiang, J., Feng, L., Yang, L., Li, S.H., Kuang, S.Y & Zhou, X.Q (2009) Effect of methionine on intestinal enzymes activities, microflora and humoral immune of juvenile Jian carp (cyprinus carpio var Jian) Aquac Nutr., 15, 477–483.

Tesseraud, S., Bigot, K & Taouis, M (2003) Amino acid availability regulates S6K1 and protein synthesis in avian insulin-insensitive QM7 myoblasts FEBS Lett., 540, 176–180.

Twibell, R.G., Wilson, K.A & Brown, P.B (2000) Dietary sulfur amino acid requirement of juvenile yellow perch fed the maxi- mum cystine replacement value for methionine J Nutr., 130, 612–616.

Walton, M.J (1985) Aspects of amino acid metabolism in teleost fish In: Nutrition and Feeding in Fish (Cowey, C.B., Mackie, A.M.

& Bell, J.G eds), pp 47–67 Academic Press, London.

Walton, M.J., Cowey, C.B & Adron, J.W (1982) Methionine metabolism in rainbow trout fed diets of differing methionine and cystine content J Nutr., 112, 1525–1535.

Wang, S., Liu, Y.J., Tian, L.X., Xie, M.Q., Yang, H.J., Wang, Y & Liang, G.Y (2005) Quantitative dietary lysine requirement of juvenile grass carp Ctenopharyngodon idella Aquaculture, 249, 419–429.

Wilson, R.P & Halver, J.E (1986) Protein and amino acid requirements of fishes Annu Rev Nutr., 6, 225–244.

Wilson, R.P., Harding, D.E & Garling, J.D.L (1977) Effect of dietary pH on amino acid utilization and the lysine requirement of fingerling channel catfish J Nutr., 107, 166–170.

Yamada, S., Simpson, K.L., Tanaka, Y & Katayama, T (1981) Plasma amino acid changes in rainbow trout (Salmo gairdneri) forcefed casein and a corresponding amino acid mixture Jap Soc Fish Sci., 47, 1035–1040.

Yan, Q., Xie, S., Zhu, X., Lei, W & Yang, Y (2007) Dietary methionine requirement for juvenile rockfish, Sebastes schlegeli Aquac Nutr., 13, 163–169.

Yoshizawa, F (2004) Regulation of protein synthesis by chain amino acids in vivo Biochem Biophys Res Commun., 313, 417–422.

branched-Zhang, J.Z., Zhou, F., Wang, L.L., Shao, Q.J., Xu, Z.R & Xu, J.Z (2010) Dietary protein requirement of juvenile black sea bream, Sparus macrocephalus J World Aquac Soc., 41, 151–164 Zhou, Q.C., Wu, Z.H., Tan, B.T., Chi, S.Y & Yang, Q.H (2006) Optimal dietary methionine requirement for juvenile cobia (Rachycentron canadum) Aquaculture, 258, 551–557.

Zhou, F., Shao, Q.J., Xu, Z.R., Ma, J.J & Xu, J.Z (2010a) titative L-lysine requirement of juvenile black sea bream (Sparus macrocephalus) Aquac Nutr., 16, 194–204.

Quan-Zhou, F., Xiong, W., Xiao, J.X., Shao, Q.J., Ngandzali, O.B., Hua,

Y & Chai, X.J (2010b) Optimum arginine requirement of juvenile black sea bream, Sparus macrocephalus Aquac Res., doi:10.1111/ j.1365-2109.2009.02474.x.

Zhou, Q.C., Wu, Z.H., Chi, S.Y & Yang, Q.H (2007) Dietary lysine requirement of juvenile cobia (Rachycentron canadum) Aquacul- ture, 273, 634–640.

.

1 2 2 3

1

Department of Basic Sciences, Fisheries Faculty, Canakkale Onsekiz Mart University, Canakkale, Turkey;2 Department of

Aquaculture, Ege University, Fisheries Faculty, Bornova, Izmir, Turkey; 3 Department of Fisheries, Agricultural Faculty,

Atatu¨rk University, Erzurum, Turkey

Dietary mannanoligosaccharide (MOS) from commercial

product, Bio-Mos supplementation, has been examined for

its effects on weight gain and feed conversion of domestic

mammals and birds, but very few studies have evaluated the

responses of aquacultural species to MOS A feeding and

digestibility trial was performed to asses the potential

bene-ficial effect of two levels of Bio-Mos on growth, feed

utili-zation, survival rate and nutrientsÕ digestion of gilthead sea

bream (Sparus aurata) with an initial average weight of

170 g Bio-Mos was added at 2 or 4 g kg)1to a fish meal–

based control diet, and each diet was fed to triplicate groups

of 1-year-old gilthead sea bream After 12 weeks, there were

no differences in survival rate among fish fed experimental

diets (P > 0.05) It was observed that a significant

improv-ability existed for both growth and feed utilization in fish fed

diets supplemented with Bio-Mos (P < 0.05) Body

proxi-mate composition remained unaffected by Bio-Mos

supple-mentation in fish fed experimental diets (P > 0.05) Apparent

digestibility values for protein, carbohydrate and energy were

appreciably affected by the inclusion of two different levels of

Bio-Mos, only lipid digestibility was the exception In

con-clusion, the results of this trial indicate that 2 g kg)1dietary

supplementation with BIO-MOS seem to be most positive for

gilthead sea bream production

prebiotics, sea bream

Received 4 February 2010, accepted 4 August 2010

Correspondence: Nejdet Gultepe, Canakkale Onsekiz Mart University,

Fisheries Faculty, Department of Basic Sciences, 17100 Canakkale, Turkey.

Fish diseases in Turkey are mainly caused by bacterialpathogens, including Edwardsiella tarda, Vibrio anguillarum,Vibrio alginolyticus, etc (Tanrikul 2006) Antibiotics areheavily used for therapy or prophylactic reasons However,the use of antibiotics used in fish farming is restricted inmany countries because of increasing development of anti-biotic resistance in aquatic bacteria (Smith et al 1994) Also,the occurrence of antimicrobial residues in products ofaquaculture threat human health (World Health Organiza-tion 2006) Nowadays, several environment-friendly pro-phylactic and preventive methods are being developed tocontrol such diseases and to maintain a healthy microbialenvironment in aquaculture systems (Vadstein 1997; Ver-schuere et al 2000; Bache`re 2003; Defoirdt et al 2005)

As a defined by Gibson & Roberfroid (1995), Ôa prebiotics

is a non-digestible food ingredientÕ that allows specificchanges in the composition and/or activity in the gastroin-testinal microflora that confers benefits upon host well-beingand health Many studies have shown the effects of prebioticssuch as fructo-, galacto-, glyco-, malto- and mannanoligo-saccharides (MOS) on the health of human and livestockspecies (Flickinger et al 2003; Patterson & Burkholder 2003;

prevents attachment and colonization of pathogenic bacteria

in the digestive tract and reduces adverse effects of

micro-flora metabolites that could be related to its bonding to and

accompanying the enteric pathogens through the

gastroin-testinal tract where the pathogens are voided with the

undi-gested MOS and excreta (Newman 1994) Other types of

bacteria are unaffected from MOS supplementations because

it is supposed that their surfaces do not attach to MOS

(Spring et al 2000)

To our knowledge, most investigations into dietary MOS

supplementation have examined its improving effects on

immune status and stress resistance in fish, but very few

studies have evaluated the effects of MOS on growth in

aquacultural species Sparus aurata is one of the most

important marine non-salmonid species of business

aqua-culture farmed in Turkey where it reaches up to 40% total

fish production (Memis et al 2002) Therefore, the objective

of this study was to examine growth performance and

nutrients digestion of S aurata fed diets supplemented with

20 or 40 g kg)1commercial MOS product, Bio-Mos (Alltech

Biotechnology, Lexington, KY, USA)

The experiment was performed with 9000 1-year-old gilthead

sea bream with an initial average weight of 170 g and was

conducted at commercial gilthead sea bream and sea bass

production farm (Kilic Seafish Aquaculture Import – Export

Co.) Bodrum in Mugla, Turkey during the period from

September 2009 to November 2009 (90 days) The fish had

been raised in fibreglass tanks supplied with untreated

sea-water at natural temperatures and under a natural light

regime the last months until the start of the experiment At

the start of the experiment, 9000 fish were distributed among

nine 100 m3sea cages (1000 fish in each) The initial stocking

density was identical in the cages (20 kg m)3) To avoid the

negative effects of sun exposure, the sea cage was covered by

a sun shade (Foss et al 2004) This experiment consisted of a

growth and a subsequent digestibility determination of the

experimental diets

Control diet was based on fish and soybean meal, wheat

and fish oil To this mixture, 0, 2 or 4 g kg)1Bio-Mos was

added (Table 1), and diets (pellet size 3 mm) were produced

by extrusion at Kilic Feed Factory (Mugla, Turkey) Three

diets were given to triplicate groups of fish The growth trial

lasted for 12 weeks During the trial, the fish were fed twice

daily mid-morning and mid-afternoon to apparent satiation

Water temperature was virtually identical for the entireexperimental period, ranging from 24.7 to 19.6C Salinity,dissolved oxygen and pH of the water were 36 ± 0.5,

8 ± 0.5 mg L)1and 7.5, respectively

Fish were sampled biweekly For this, 10% of fish in eachcage were captured, anaesthetized with 1/10 000% of tricainemethanesulphonate (MS-222; SIGMA, St Louis, MO, USA)and weighed after a 2-day fast After each sampling period,the amount of feed given was adjusted according to meanweight in each cage From results of the last sample, wecalculated weight gain (WG = final weight) initial weight),food conversion rate (FCR = feed consumption/WG) andsurvival (%) Six fish from each cage were also sampled andstored at)20 C for body composition at the end of the trial.The collection of faeces was conducted in triplicate foreach respective dietary treatment The faeces were collected,which is during 06:00–08:30, 14 h after the last feeding with15-min interval between cages, allowing the maintenance of

Table 1 Formulation and chemical composition of the control and experimental diets for Sparus aurata

Diet

Control (basal)

Experimental diet I

Experimental diet II Ingredients (g kg)1)

18 mg niacin (nicotinic acid), 36 mg pantothenic acid, 9 mg doxine, 10.8 mg riboflavin, 1.8 mg thiamin.

pyri-2 Provided per kg of diet: 2.46 mg sodium chloride (NaCl), 0.05 mg ferrous sulphate (FeSO 4 ), 0.02 copper sulphate (CuSO 4 ), 0.07 mg manganese sulphate (MnSO 4 ), 0.008 mg potassium iodide (KI), 0.01 mg zinc sulphate (ZnSO 4 ).

3 Supplied by SIGMA, St Louis, MO, USA.

.

sampling time, over six consecutive days from gilthead sea

bream using stripping techniques (Glencross et al 2005), for

analysis

Proximate analysis on diets, fish bodies and faecal samples

was performed according to the methods of AOAC (1984)

Samples were freeze-dried prior to analysis Dry matter was

calculated by gravimetric analysis following oven drying at

105C for 24 h Gross ash content was determined

gravi-metrically following loss of mass after combustion of a

sample in a muffle furnace at 600C for 12 h Protein levels

were calculated from the determination of total nitrogen by

Kjeldhal digestion, based on N· 6.25 Crude fat content was

determined gravimetrically following extraction of the lipids

according to the Soxhlet method Carbohydrate content of

experimental diets, fish bodies and resulting faeces samples

was determined by the method of Gouveia & Davies (2000)

Gross energy was determined by adiabatic bomb calorimetry

(Parr 6300 adiabatic bomb calorimeter; Parr Instrument

Company, Moline, IL, USA) Chromic oxide (SIGMA) in

faeces was determined according to the method of Furukawa

& Tsukahara (1966) The apparent digestibility (AD) of each

of the nutritional variables examined was based on the

where Crdietand Crfaecesrepresent the chromium rate of the

diet and faeces, respectively, and Nutrientdiet and

Nutri-entfaeces represent the nutritional parameter of concern

(protein, carbohydrate, lipid or energy) rate of the diet and

faeces, respectively

Data were analysed for homogeneity of variances using

CochranÕs test Effects of diets on the growth parameters and

effects of ingredient on digestibility of protein, carbohydrate

and gross energy in each of the diet were examined byANOVA

using the software package STATISTICA (StatsoftR, Tulsa,

OA, USA) Levels of significance were determined using

Tukeys HSD test, with critical limits being set at P < 0.05

Table 2 shows the growth performance of fish fed with the

three experimental diets There was no significant effect of

diets on survival rate of fish However, the body weight ofeach group measured at 0, 30, 60 and 90 days showed sig-nificant difference from the mean body weight (P < 0.05) atevery interim measurement of body weight except that ofinitial The WG and FCR were significantly better in thegilthead sea bream fed the diet with 2 g kg)1Bio-Mos than

in those fed the basal diet and the diet with 4 g kg)1 Mos

Bio-Analysis of body proximate composition (Table 3)revealed that moisture, crude protein, lipids, ash and energywere unaffected (P > 0.05) in present trial However, themoisture in fish fed the diets with Bio-Mos tended to be lowerthan that in fish fed the basal diet On the other hand, thelipid and protein per cents, and energy values tended to behigher in fish fed the diets with Bio-Mos than in those fed thebasal diet

While protein, carbohydrate (starch) and energy ibility were significantly affected by dietary treatment(P < 0.05), lipid digestibility was not improved by adding

digest-Table 2 Growth performance in fish fed experimental diets

Diets

Initial body weight (g) 172 ± 9a 172 ± 7a 172 ± 5aBody weight at 30th

day (g)

266 ± 10 a 292 ± 11 b 295 ± 12 b

Body weight at 60th day (g)

Energy (MJ kg)1) 7.6 ± 0.06 7.9 ± 0.04 7.8 ± 0.05 MOS, mannanoligosaccharide.

No significant difference was observed in these data (P > 0.05).

.

Aquaculture Nutrition 17; 482–487  2010 Blackwell Publishing Ltd

two levels of Bio-Mos to diets (P > 0.05) Moreover,

carbohydrate digestibility was significantly higher in the

gilthead sea bream fed the diet with 2 g kg)1Bio-Mos than in

those fed the both other diets (Table 4)

In the present study, it was tested whether the addition of

two levels of Bio-Mos would improve the growth

perfor-mance of gilthead sea bream and the diet digestibility

Although inclusion of dietary Bio-Mos at 2 and 4 g kg)1did

not significantly affect diet proximate composition, fish fed

Bio-Mos supplemented diets showed a significant growth

improvement The growth response to the MOS is in

agreement with results from studies on broiler chickens

(Kumprecht & Zobac 1997), pigs (Rozeboom et al 2005),

common carp (Atar & Ates 2009) or rainbow trout (Staykov

et al.2007) and European sea bass (Torrecillas et al 2007)

On the other hand, no effect of MOS supplementation on

growth was observed by Pryor et al (2003) in gulf sturgeon;

by Mahious et al (2006) in turbot larvae; by Genc et al

(2007) in hybrid tilapia; by Grisdale-Helland et al (2008) in

Atlantic salmon; and by Gultepe & Hossu (2008) in sea

bream Interpretation of the conflicting results is more

complicated than originally meets the eye, however, and may

be affected by species, dietary supplementation level and

duration of use Moreover, in many cases, prebiotics was

added to the fish diets after pellets were prepared or to pellets

that were not extruded or coated It is possible because of the

fact that a large proportion of the supplemented MOS

lea-ched into the water and only a small portion actually realea-ched

the fish Hence, it cannot be determined by the effect of MOS

supplementation on growth parameters in experimental

aquatic animals Similarly, Genc et al (2007) reported that

experimental diets were prepared from commercial trout

diet, supplemented with MOS at different levels and there

were no significant differences between treatment groups in

growth parameters of fish

Some studies investigated the effects of different prebiotics

on fish growth For instance, the effect of dietary inulin,oligofructose and lactosucrose on the growth and intestinalbacteria of Psetta maxima was investigated by Mahious et al.(2006) The final mean weight of turbot larvae weaned with

20 g kg)1 oligofructose was significantly higher than thoseobserved with the other diets Another recent investigationwith Litopenaeus vannamei showed that WG and specificgrowth rate of the juvenile white shrimp (Litopenaeus van-namei) increased with the increment of dietary short-chainfructooligosaccharides (FOS), while their feed conversionratio decreased (Zhou et al 2007)

Body proximate analysis in the present study showed thatnone of the examined parameters were affected by Bio-Mossupplementation, whereas previous studies on rainbow trout(Yilmaz et al 2007) and hybrid tilapia (Genc et al 2007)using 4 g kg)1 MOS supplementation reported increasedbody protein levels

The diet composition and nutrient digestibility exert aconsiderable effect on growth Both factors, singly or incombination, can affect the food intake of fish and the effi-ciency of conversion of the ingested nutrients into biomassgain It was also commented that in most terrestrial animalsstudied, maximum growth efficiency occurs at maximumfood intake, but this is not the case in fish Various expla-nations have been offered to account for this and for theapparent difference between fish and higher vertebrates.These include decreasing digestion efficiency at high rationsand disproportionately higher metabolic costs of capturing,digesting, and metabolizing larger meals (Talbot 1993).Grisdale-Helland et al (2008) speculated that lipid, proteinand energy digestibility in Atlantic salmon were not affected

by dietary supplements of the prebiotics such as MOS, FOSand galactooligosaccharide In contrast, protein, carbohy-drate and energy digestibility were significantly (P < 0.05)affected by supplementing the diet with 20 or 40 g kg)1Bio-Mos in this study, in accordance with the results of Yilmaz

et al.(2007) and Genc et al (2007), in which rainbow troutand hybrid tilapia were fed diets containing 1.5 to 4.5 g kg)1.The reason for the greater protein digestibility in the giltheadsea bream fed the Bio-Mos diets may be related to theenhanced amino acid absorption as it has been shown inchicken (Iji et al 2001) Lipid digestibility was not improved

by adding two levels of Bio-Mos to diets (P > 0.05) ever, the lipid digestibility of the control and experimentaldiets containing 2 and 4 g kg)1Bio-Mos resulted in fish with

How-a close to the mHow-aximum limits

In conclusion, these results indicated that dietary inclusion

of Bio-Mos at 2 g kg)1enhances gilthead sea bream growth

Table 4 Apparent digestibility (%) of protein, carbohydrate, lipid

and energy in the experimental diets

and nutrientsÕ digestibility Further studies are needed to

determine potential positive effects of the prebiotics on the

health and resistance of the fish to stress and disease-causing

factors

AOAC Association of Official Analytical Chemists (1984) Official

Methods of Analysis, 14th edn Association of Official Analytical

Chemists, Washington, DC, pp 1141.

Atar, H.H & Ates, M (2009) The effects of commercial diet

sup-plemented with mannanoligosaccharide (MOS) and vitamin B-12

on the growth and body composition of the carp (Cyprinus carpio

L 1758) J Anim Vet Adv., 8, 2251–2255.

Bache`re, E (2003) Anti-infectious immune effectors in marine

invertebrates: potential tools for disease control in larviculture.

Aquaculture, 227, 427–438.

Bondad-Reantaso, M.G., Subasinghe, R.P., Arthur, J.R., Ogawa,

K., Chinabut, S., Adlard, R., Tan, Z & Shariff, M (2005) Disease

and health management in Asian aquaculture Vet Parasitol., 132,

249–272.

Bruge`re, C & Ridler, N (2004) Global Aquaculture Outlook in the

Next Decades: an Analysis of National Aquaculture Production

Forecasts to 2030 FAO Fisheries Circular No.1001, FIPP/C1001,

FAO, Rome.

Defoirdt, T., Bossier, P., Sorgeloos, P & Verstraete, W (2005) The

impact of mutations in the quorum sensing systems of Aeromonas

hydrophila, Vibrio anguillarum and Vibrio harveyi on their

viru-lence towards gnotobiotically cultured Artemia franciscana

Envi-ron Microbiol., 7, 1239–1247.

Flickinger, E.A., Van Loo, J & Fahey, G.C (2003) Nutritional

responses to the presence of inulin and oligofructose in the diets of

domesticated animals: a review Crit Rev Food Sci Nutr., 43,

19–60.

Foss, A., Imsland, A.K., Falk-Petersen, I.-B & Øiestad, V (2004) A

review of the culture potential of spotted wolffish Anarhichas minor

Olafsen Rev Fish Biol Fish., 14, 277–294.

Furukawa, A & Tsukahara, H (1966) On the acid digestion method

for the determination of chromic oxide as an index substance in

the study of digestibility of fish feed Bull Jpn Soc Sci Fish., 32,

502–506.

Genc, M.A., Yilmaz, E., Genc, E & Aktas, M (2007) Effects of

dietary mannan oligosaccharides (MOS) on growth, body

com-position, and intestine and liver histology of the hybrid Tilapia

(Oreochromis niloticus · O aureus) Isr J Aquaculture-Bamidgeh,

59, 10–16.

Gibson, G.R & Roberfroid, M.B (1995) Dietary modulation of the

human colonic microbiota: introducing the concept of prebiotics.

J Nutr., 125, 1401–1412.

Glencross, B.D., Hawkins, W.E., Evans, D., McCafferty, P., Dods,

K., Maas, R & Sipsas, S (2005) Evaluation of the digestible

value of lupin and soybean protein concentrates and isolates when

fed to rainbow trout, Oncorhynchus mykiss, using either stripping

or settlement faecal collection methods Aquaculture, 245, 211–

220.

Gouveia, A & Davies, S.J (2000) Inclusion of an extruded dehulled

pea seed meal in diets for juvenile European sea bass

(Dicentrar-chus labrax) Aquaculture, 182, 183–193.

Grisdale-Helland, B., Helland, S.J & Gatlin, D.M (2008) The effects

of dietary supplementation with mannanoligosaccharide,

fruc-tooligosaccharide or galacfruc-tooligosaccharide on the growth and

feed utilization of Atlantic salmon (Salmo salar) Aquaculture, 283, 163–167.

Gultepe, N & Hossu, B (2008) Effects of dietary supplementation with mannanoligosaccharide on growth, feed utilization and sur- vival rate of gilthead sea bream (Sparus aurata) Alınteri Zirai Bilimler Dergisi, 15(B), 1–8.

Iji, P.A., Saki, A.A & Tivey, D.R (2001) Intestinal structure and function of broiler chickens on diets supplemented with a mannan oligosaccharide J Sci Food Agric., 81, 1186–1192.

Kumprecht, I & Zobac, P (1997) The effect of charides in feed mixtures on the performance of chicken broilers.

mannan-oligosac-Czech J Anim Sci., 42, 117–124.

Mahious, A.S., Gatesoupe, F.J., Hervi, M., Metailler, R & Ollevier,

F (2006) Effect of dietary inulin and oligosaccharides as prebiotics for weaning turbot, Psetta maxima (Linnaeus, C 1758) Aquacult.

eds), pp 167–174 Nottingham University Press, Nottingham, UK.

Patterson, J.A & Burkholder, K.M (2003) Application of otics and probiotics in poultry production Poult Sci., 82, 627–

prebi-631.

Pryor, G.S., Royes, J.B., Chapman, F.A & Miles, R.D (2003) Mannanoligosaccharides in fish nutrition: effects of dietary supplementation on growth and gastrointestinal villi structure in Gulf of Mexico sturgeon North Am J Aquac., 65, 106–111.

Ringø, E., Olsen, R.E., Gifstad, T.Ø., Dalmo, R.A., Amlund, H., Hemre, G.-I & Bakke, A.M (2010) Prebiotics in aquaculture: a review Aquac Nutr., 16, 117–136.

Rozeboom, D.W., Shaw, D.T., Tempelman, R.J., Miguel, J.C., Pettigrew, J.E & Connolly, A (2005) Effects of mannan oligo- saccharide and an antimicrobial product in nursery diets on performance of pigs reared on three different farms J Anim Sci.,

83, 2637–2644.

Smith, P., Hiney, M.P & Samuelsen, O.B (1994) Bacterial resistance

to antimicrobial agents used in fish farming: a critical evaluation of method and meaning Annu Rev Fish Dis., 4, 273–313.

Spring, P., Wenk, C., Dawson, K.A & Newman, K.E (2000) The effects of dietary mannanoligosaccharides on cecal parameters and the concentrations of enteric bacteria in the ceca of salmonella- challenged broiler chicks Poult Sci., 79, 205–211.

Staykov, Y., Spring, P., Denev, S & Sweetman, J (2007) Effect of a mannan oligosaccharide on the growth performance and immune status of rainbow trout (Oncorhynchus mykiss) Aquacult Int., 15, 153–161.

Talbot, C (1993) Symposium on ÔFish and NutritionÕ Some aspects

of the biology of feeding and growth in fish Proc Nutr Soc., 52, 403–416.

Tanrikul, T.T (2006) Outbreaks of vibrio alginolyticus in gilthead sea bream in Turkey Indian Vet J., 83, 599–601.

Torrecillas, S., Makol, A., Caballero, M.J., Montero, D., Robaina, L., Real, F., Sweetman, J., Tort, L & Izquierdo, M.S (2007) Immune stimulation and improved infection resistance in European sea bass (Dicentrarchus labrax) fed mannan oligosac- charides Fish Shellfish Immunol., 23, 969–981.

Vadstein, O (1997) The use of immunostimulation in marine larviculture: possibilities and challenges Aquaculture, 155, 401–

417.

.

Aquaculture Nutrition 17; 482–487  2010 Blackwell Publishing Ltd

Verschuere, L., Rombaut, G., Sorgeloos, P & Verstraete, W (2000)

Probiotic bacteria as biological control agents in aquaculture.

Microbiol Mol Biol Rev., 64, 655–671.

World Health Organization (2006) Report of a joint FAO/OIE/

WHO expert consultation on antimicrobial use in aquaculture and

antimicrobial resistance: Seoul, Republic of Korea, 13–16 June

2006.

Yilmaz, E., Genc, M.A & Genc, E (2007) Effects of dietary mannan

oligosaccharides on growth, body composition, and intestine and

liver histology of rainbow trout, Oncorhynchus mykiss Isr J Aquaculture-Bamidgeh, 59, 182–188.

Zhou, Z.G., Ding, Z.K & Huiyuan, L.V (2007) Effects of dietary short-chain fructooligosaccharides on intestinal microflora, sur- vival, and growth performance of juvenile white shrimp, Litope- naeus vannamei J World Aquac Soc., 38, 296–301.

.

Norwegian College of Fishery Science, Faculty of Biosciences, Fisheries and Economics, University of Tromsø, Tromsø, Norway

The aims of this study was to assess the effect of two lactic

acid bacteria (LAB), Lactobacillus curvatus and Leuconostoc

mesenteroides, originally isolated from gastrointestinal (GI)

tract of beluga (Huso huso) and Persian sturgeon (Acipenser

persicus), respectively, on growth, survival and digestive

enzyme (amylase, lipase and protease) activities and the

population level of LAB in the GI tract The treatments

included 10 different groups; control, separate supplements of

L curvatus and Leu mesenteroides at three different counts

added in lyophilized form to chopped Chironomidae In the

beluga study, highest specific growth rate, survival and

improved intestinal enzyme activities were noted in the

rear-ing group fed 9· 109

L curvatusper gram food In Persiansturgeon, the inclusion level of 2· 109

Leu mesenteroideshad similar positive effect The ability of LAB to colonize the

digestive tract seems to involve host specificity, and our

bac-teriological results are relevant to initiate future probiotic

studies in sturgeons and future directions will be discussed

sturgeon, probiotic

Received 23 April 2010, accepted 2 August 2010

Correspondence: Fatemeh Askarian, Norwegian College of Fishery

Sci-ence, Faculty of Biosciences, Fisheries and Economics, University of

Tromsø, Tromsø, Norway E-mail: fatemehaskarian@yahoo.com

Sturgeon is one of the oldest anadromous or

potamodrom-ous family (Acipenseridea) among the bony fishes with 28

species (Bahmani et al 2001; Asadi et al 2006), and themost important genera includes; Acipenser, Huso, Scap-hirhynchus and Pseudoscaphirhynchus (Bemis et al 1997;

Bahmani et al 2001; Askarian et al 2009) Of the six cies, living in the Caspian Sea are beluga (Huso huso) andPersian sturgeon (Acipenser persicus) two of them (Bahmani

spe-et al.2001), and nowadays, these two species are mentioned

as endangered species because of over fishing, loss of habitatand decrease of water quality according to IUCN list(www.iucnredlist.org)

Some information is available on the microbiota onexternal surface (skin, gills and fins) and in the gastrointes-tinal (GI) tract of sturgeon (Shenavar Masouleh et al 2006;

Delaedt et al 2008; Huys et al 2008; Akrami et al 2009;

Askarian et al 2009; Ghanbari et al 2009) However, to ourknowledge, there is no information available about the use ofprobiotics in sturgeon aquaculture The term probiotics isconstructed from the Latin word pro (for) and the Greekword bios (life) (Zivkovic 1999) and was created in the 1950s

by Kollath (1953) Lilley & Stillwell (1965) used this term todenote bacteria that promote the health of other organisms,but the definition of a probiotic used in aquaculture differsgreatly depending on the source (Gram & Ringø 2005;

Merrifield et al 2010) Generally, probiotics offer potentialalternatives by providing benefits to the host primarily viathe direct or indirect modulation of the intestinal microbiota,enhanced immune system and growth, stimulate enzymeactivity and improved disease resistance As described bynumerous authors, several lactic acid bacteria (LAB) strainshave been used as probiotic in aquaculture to increase theimmune enhancement, disease resistance, modulate the gutmicrobiota and competitive exclusion of pathogens throughthe production of inhibitory compounds (Gatesoupe 1991,

1999, 2008; Gildberg et al 1997; Gildberg & Mikkelsen 1998;

Ringø & Gatesoupe 1998; Phianphak et al 1999; Ringø &

Birkbeck 1999; Robertson et al 2000; Nikoskelainen et al

2001, 2003; Panigrahi et al 2004; Ringø 2004; Ringø et al.

2005, 2010; Balcazar et al 2006, 2007, 2008; Merrifield

et al.2010) Furthermore, there are several reports available

about the influence of probiotics on digestive enzyme activity

in fish (Tovar et al 2002; Tovar-Ramirez et al 2004;

El-Haroun et al 2006; Wache et al 2006; Ghosh et al

2008; Suzer et al 2008; Saenz de Rodriganez et al 2009)

This topic is highly relevant to evaluate as the intestinal tract,

where digestion and absorption take place, is very important

for fish The first aim of this study was therefore to

inves-tigate the effect of two LAB, Lactobacillus curvatus and

Leuconostoc mesenteroides originally isolated from the GI

tract of beluga and Persian sturgeon, respectively (Askarian

et al 2009), on growth, survival and digestive enzyme

(amylase, lipase and protease) activities

The increased interest during the last decade in LAB in

the GI tract of fish is related to the fact that LAB often

produce bacteriocins and other chemical compounds that

may inhibit colonization of pathogenic bacteria in the GI

tract (Ringø et al 2005; Ringø 2008; Merrifield et al 2010)

However, even if these bacteria produce antimicrobial

compounds, they might not be applicable as probiotics in

aquaculture if they are not able to adhere to and colonize

gut mucus Finally, we addressed the issue as to whether

dietary supplement of LAB modulate the population level

of LAB in the GI tract and evaluate whether host specificity

is involved

The present investigation was carried out at the International

Sturgeon Research Institute, Gilan Province, Iran Three

thousand fry of Persian sturgeon (A persicus) and beluga

(H huso) with mean weight and length of 40.30 ± 2.06 mg

and 12.01 ± 0.90 mm and 50.10 ± 1.03 mg and 13.00 ±

0.90 mm, respectively, were used Sixty 20-L fibre glass tanks

(100 fish per tank) supplied with fresh water were used and

the experiment lasted for 50 days Ten treatments with three

replicates were used for each species Mean temperature, pHand oxygen level during the experiment were 17C, 7.1 and8.1 mg L)1 for Persian sturgeon and 15C, 7.1 and8.6 mg L)1for beluga

In this study, two species of LAB were used TheLeu mesenteroides strain showed 99% similarity to acces-sion no AB362705 and was originally isolated from the

GI tract of Persian sturgeon (Askarian et al 2009), while

L curvatus (similarity = 98% to accession no AY204891)was originally isolated from the GI tract of beluga(Askarian et al 2009) The bacteria were added at differentcounts in lyophilized form to chopped Chironomidae (bloodworms collected daily from natural environment) andimmediately fed to the respective tanks The viability offreeze-dried bacteria was determined by plate counting onMRS agar and was 2.8· 109CFU g)1 for Leu mesentero-ides and 1.2· 1013 CFU g)1for L curvatus The fish werefed approximately 6% of their body weight every day and adetailed description the 10 different treatments presented inTable 1

Sampling was carried out seven times (every week) during theexperiment Thirty fry from each treatment were randomlysampled for determination of specific growth rate (SGR) asdescribed by Kissil et al (2001)

SGR = (ln W2) W1) (g)/(t2) t1) (day)

At the end of the experiment after 50 days, were 30 fishesfrom each treatment group transferred to laboratory forenzymatic determination The head and tail of fish were cut

off and the remaining part homogenized on ice in an electrichomogenizer (Heidolph instruments, Schwabach, Germany)

Table 1 Experimental treatments applied in studies with beluga (Huso huso) and Persian sturgeon (Acipenser persicus)

as described elsewhere (Furne´ et al 2005) Thereafter, were

the homogenates centrifuged at 30 000 g for 30 min at 4C

in a Kontron centrifuge model Centrikon H-401 (Zurich,

Switzerland) and the supernatant collected and frozen at

)80 C (Furne´ et al 2005) Protease, amylase and lipase

activities were determined according to the methods

described by Furne´ et al (2005)

Bacterial analyses were carried out at the end of experiment,

after 50 days of feeding The fish were starved for 24 h

before sampling to clear their alimentary tracts (Bairagi

et al.2002) The head and tail of 30 fishes, 3· 10 fish from

each tank treated separately, were cut off, and the

remain-ing parts were thoroughly rinsed three times with sterile

saline (0.85% w/v), transferred to betadine (a mixture of

povidone–iodine and detergent used to disinfect skin)

solution (0.01% v/v) for 15 min, and washed three times

with sterile saline to remove non-adherent bacteria Three

replicates consisting of 10 fish from each tank were

sus-pended in 10 mL sterile saline Pooled samples of 10 fish

were used to avoid individual variations in the gut

micro-biota (Spanggaard et al 2000; Ringø et al 2006) The

suspended samples were homogenized with an electric

homogenizer The homogenates were serially diluted with

sterile saline; 0.1 mL of the appropriate dilutions spread on

the surface of triplicate plates of tryptic soy agar added 5%

glucose (TSAg), MRS and lactic agar and incubated at

30C under aerobic conditions for 2 days Preliminary

identification of the gut bacteria was carried out by light

microscopy (CH3-BH-PC; Olympus, Tokyo, Japan) and

standard biochemical tests (Gram-staining, oxidase, nitrate

reduction, catalase tests, aerobic and anaerobic growth)

LAB strains from each treatment were identified based on

CO2 production from glucose, production of NH3 from

arginine, growth at different temperatures (15 and 45C),

different pH (4.2 and 9.6) and their ability to grow in

dif-ferent concentrations of NaCl (6.5% w/v, 10% w/v and

18% w/v) in MRS broth, as described elsewhere (Sujaya

et al 2001; Thapa et al 2006) for determination of

Leu mesenteroides and L curvatus

All results are presented as the average and standard deviation

and one-wayANOVAwas performed to determine the

signifi-cant difference (P < 0.05) between parameters according to

Ribeiro et al (1999) and Nikoskelainen et al (2003)

The SGR of Persian sturgeon (A persicus) displayed highestvalue in treatment 4 (supplemented 2· 109

Leu ides) while lowest value was noted in treatment 3 (supple-mented with 9· 109

mesentero-L curvatus) (Fig 1) SGR wassignificant different (P < 0.05) between these two treatments

The results of the beluga (H huso) study revealed mum and minimum SGR in treatment 3 and 6 (supplemented

maxi-9· 109Leu mesenteroides), respectively (Fig 1) No icant difference (P > 0.05) was observed in SGR betweentreatment 1, 2 and 3 fed L curvatus

signif-The highest and lowest survival of Persian sturgeon wasnoted in treatment 4 and 3, respectively (Fig 2) Further-more, treatment 4, 5 and 6 fed only Leu mesenteroides

012345678910

Treatment 1 Treatment 2 Treatment 3 Treatment 4 Treatment 5 Treatment 6 Treatment 7 Traetment 8 Treatment 9

–1 )

Persian sturgeonBeluga

Figure 1 Specific growth rate (SGR) of Persian sturgeon and beluga.

Each value represents the mean value ± SD of 30 fry from each treatment.

0102030405060708090100

Treatment 1 Treatment 2 Treatment 3 Treatment 4 Treatment 5 Treatment 6 Treatment 7 Traetment 8 Treatment 9

Persian sturgeon Beluga

Figure 2 Survival (%) of Persian sturgeon and beluga Each bar represents mean ± SD N = 300 in each treatment.

.

Aquaculture Nutrition 17; 488–497  2011 Blackwell Publishing Ltd

showed significant higher (P < 0.05) survival compared to

the other treatments According to Fig 2 highest and lowest

survival of beluga were noticed in treatment 3 and 6,

respectively, and the difference between these two

treat-ments was significantly different (P < 0.05) The three

treatments (1–3) of beluga fed L curvatus had a

signifi-cantly (P < 0.05) higher survival compared to the other

treatment groups

Amylase, lipase and protease activities in Persian sturgeon

and beluga are showed in Fig 3 Highest enzymatic activities

in Persian sturgeon were detected in treatment 4 while lowest

activities was observed in treatment 3 Generally, the enzyme

activities in treatments fed Leu mesenteroides (group 4–6)

were significantly (P < 0.05) higher compared to the other

treatments

In beluga, maximum amylase, lipase and protease activities

were noticed in treatment 3 while lowest enzyme activities

were noticed in the control group, fish fed control diet for

50 days (Fig 3) The enzyme activities in three treatments

(1–3) fed L curvatus were significantly higher than the other

treatments

Total viable counts (TVC) of aerobic gut bacteria in

Per-sian sturgeon and beluga are showed in Table 2 In all the

treatment groups fed LAB for 50 days, the population level

of bacteria per g increased from the initial sampling,

4.2· 104TVC g)1 (log = 4.62) in Persian sturgeon and

6.9· 104TVC g)1(log = 4.84) in beluga, to approximately

5.4· 104

TVC g)1 (log = 4.73) in Persian sturgeon andaround 8.2· 104TVC g)1 (log = 4.91) in beluga, respec-

tively However, the TVC levels in experimental groups of

Persian sturgeon and beluga fed LAB were more or less

similar to that of control fish after 50 days of feeding

indi-cating that LAB feeding does not affect the population level

of the adherent aerobic gut microbiota

Generally, higher population levels of intestinal LAB were

observed in Persian sturgeon fed Leu mesenteroides,

treat-ment groups 4–6, compared to fish fed L curvatus (treattreat-ment

groups 1–3), the LAB mixture and control fish (Table 2) In

contrast to these results, highest LAB levels in beluga were

noticed when the fish were fed L curvatus, treatment groups

1–3 In fish fed a mixture of the two LAB strains, generally

higher LAB levels were observed in beluga compared to that

of Persian sturgeon However, the population levels of LAB

in Persian sturgeon and beluga fed a LAB mixture were more

or less similar to that noticed in the control group after

50 days of feeding (Table 2) The ratio of LAB versus TVC

(%) in the GI tract of Persian sturgeon and beluga is showed

in Table 2 Compared to the approximate value of 0.80% at

initial sampling, prior to experimental start, and values of

051015202530354045

–1 protein)

Persian sturgeonBeluga

051015202530354045

–1 protein)

Persian sturgeon Beluga

020406080100120140

Treatment 1 Treatment 2 Treatment 3 Treatment 4 Treatment 5 Treatment 6 Treatment 7 Traetment 8 Treatment 9

Figure 3 Mean amylase, lipase and protease activities in Persian sturgeon and beluga Each bar represents mean value ± SD of 30 fry from each treatment.

.

0.60% and 0.74% in Persian sturgeon and beluga fed thecontrol diet for 50 days, respectively, the highest values(between 1.25% and 1.47%) were noted in Persian sturgeonfed Leu mesenteroides In contrast to these results, thehighest ratio of 1.32% in beluga was demonstrated in fish fed

9· 109

L curvatus

Identification of L curvatus and Leu mesenteroides in thedigestive tract of Persian sturgeon and beluga showed sur-prising results (Table 2) In Persian sturgeon, few L curvatusstrains were identified while the number of Leu mesentero-ides strains were clearly higher in treatment groups exposedonly to Leu mesenteroides In contrast to these results, acompletely different situation occurred in beluga, as in thisfish species few strains of Leu mesenteroides were identifiedeven when the fish were fed Leu mesenteroides On the otherhand, high level of L curvatus strains was detected whenbeluga were fed L curvatus Based on the results presented inTable 2, we suggest that the ability of LAB to colonize thedigestive tract of sturgeon seems to involve host specificity

However, when the sturgeons were fed a mixture of the twoLAB, treatment 7–9, the population level of L curvatus andLeu mesenteroideswas more or less similar to that observedfor the control fish

Sturgeons are important contributor to fish production inmany countries located around the Caspian Sea Concertedresearch efforts have concentrated on optimizing productionwith eco-friendly alternatives to the therapeutic use of anti-biotics The first studies on screening of probiotic bacteriafrom aquaculture environments were initiated during the1980s (Schro¨der et al 1980; Dopazo et al 1988; Kamei et al

1988; Strøm 1988), has garnered attention for disease vention in aquaculture (Gatesoupe 1999, 2008; Gomez-Gil

pre-et al 2000; Verschuere et al 2000; Irianto & Austin 2002;

Balcazar et al 2006; Kim & Austin 2006; Merrifield et al

2010; Sharifuzzaman & Austin 2010) Moreover, probioticshave been attributed with improved food safety in a moreenvironmentally friendly way (Macey & Coyne 2005) Cer-tainly, FAO has now suggested the use of probiotics as amean of improving the quality of the aquatic environment(Subasinghe et al 2003)

The results of the present study revealed that tation of LAB to the food of Persian sturgeon and belugasignificantly improved SGR and survival of treatment groupsfed LAB originally isolated from the fish species investigated

supplemen-To our knowledge, improved SGR and survival on the use

of probiotics have been reported in two shrimp species

Fenneropenaeus indicus(Ziaei-Nejad et al 2006) and Penaeus

vannamei (Wang 2007), common carp (Cyprinus carpio)

(Wang & Xu 2006) and rohu (Labeo rohita) (Ghosh et al

2003), red drum (Sciaenops ocellatus) (Li et al 2005),

Japanese flounder (Paralichthys olivaceus) (Taoka et al

2006) and gilthead sea bream (Sparus aurata) (Suzer et al

2008) Positive effect of Bacillus subtilis on growth and

survival of ornamental fishes (Poecilia sphenops, Poecilia

reticulata, Xiphophorus maculates and Xiphophorus helleri) is

also documented (Ghosh et al 2008) The enhanced growth

performance might be because of increasing digestive enzyme

activity induced by the probiotics, as it has been reported

that Gram-positive bacteria, particularly members of the

genus Lactobacillus, have ability to secrete a wide range of

exo-enzymes (Moriarty 1996, 1998; Suzer et al 2008) With

respect to SGR and fry survival, it was interesting to notice

that Persian sturgeon fed L curvatus originally isolated from

beluga (treatment 1–3) and beluga fed Leu mesenteroides

(treatment 4–6) originally isolated from Persian sturgeon

were significantly lower than that observed for the control

group These findings have not been elucidated but it can be

speculated that the bacteria has a detrimental effect on gut

morphology, health parameters and the protective gut

microbiota However, to clarify this, additional studies are

necessary

It has been documented in a number of aquatic animals

that the GI microbiota plays an important role in nutrition

(Sakata 1990; Ringø et al 1995; Thompson et al 1999;

Verschuere et al 2000; Suzer et al 2008) In addition, some

bacteria may participate in the digestion processes of bivalves

by producing extracellular enzymes, such as proteases,

lip-ases, as well as providing necessary growth factors (Prieur

et al.1990) Similar observations have been reported for the

microbiota of adult penaeid shrimp (Penaeus chinensis),

where a complement of enzymes for digestion and synthesize

compounds that are assimilated by the animal (Wang et al

2000) Microbiota may serve as a supplementary source of

food, and microbial activity in the digestive tract may be a

source of vitamins, essential amino acids and fatty acids

(Dall & Moriarty 1983; Sakata 1990)

Various mechanisms have been proposed to explain the

beneficial effects of probiotics such as: (i) antagonism

towards pathogens, (ii) competitions for adhesion sites, (iii)

competition for nutrients, (iv) improvement of water quality,

stimulation of host immune responses and (v) enzymatic

contribution to digestion Several studies have documented

nutritional effect of algae, probiotic bacteria and

Saccharo-myceson the digestive enzymes of fish and shellfish larvae

(Cahu et al 1998; Tovar et al 2002; Tovar-Ramirez et al

2004; Wache et al 2006; Wang & Xu 2006; Ghosh et al.2008; Suzer et al 2008; Saenz de Rodriganez et al 2009) Inthe present study, the enhancement of SGR and survival insturgeon fry was simultaneously noticed with increase indigestive enzyme activity Our results are in agreement withthe results of Tovar-Ramirez et al (2004) that reportedimproved activity of the digestive enzyme, trypsin, amylaseand lipase, in European sea bass (Dicentrarchus labrax) larva

by adding live yeast (Debaryomyces hansenii) to the diet.Furthermore, Wang & Xu (2006) showed significant differ-ence (P < 0.05) of digestive enzymes activity, protease,amylase and lipase, in common carp by using Bacillus sp asprobiotics In a later study, Suzer et al (2008) reportedimproved activity of the intestinal enzymes, alkaline phos-phatase and leu–ala-peptidase and pancreatic trypsin, amy-lase and lipase, by using the Lactobacillus spp as probiotic ingilthead sea bream larvae The enhanced digestive enzymeactivities observed in some of the treatment groups in thepresent study might be attributed to improved gut matura-tion as previously suggested by Tovar et al (2002) in a studyusing D hansenii originally isolated from the gut of rainbowtrout (Oncorhynchus mykiss) In addition to this direct effect,some authors have suggested that the main modes of actionand beneficial effects of probiotics are prevention of intestinaldisorders and predigestion of antinutrient factors present

in the ingredients (Thompson et al 1999; Verschuere et al.2000; Suzer et al 2008) To clarify the mechanisms involved,further sturgeon studies have to be carried out Moreover,further investigations need to be carried out to clarifywhy gut enzyme activities were generally lower in Persiansturgeon fed L curvatus originally isolated from beluga(treatment 1–3)

The results of the present study displayed that LAB do notbelong to the dominant GI microbiota of sturgeon, as thebacteria only accounted for 0.3–1.4% of the total culturablegut microbiota in all treatments (Table 2) Even though

L curvatus and Leu mesenteroides to some extent wasdetected in the gut of beluga and Persian sturgeon, respec-tively, at experimental start, their population levels remainunaffected even after 50 days of feeding on the control diet.Based on this finding, we conclude that these bacteria do notbelong to the dominant gut microbiota in beluga and Persiansturgeon Ringø & Gatesoupe (1998) also reported that LAB

do not belong to the dominant intestinal microbiota of fish.However, in the present study, the numbers of L curvatusand Leu mesenteroides increased in the gut of beluga(treatments 1, 2 and 3) and Persian sturgeon (treatments 4, 5and 6), respectively, compared to initial sampling and controlafter 50 days of feeding (Table 2) It is also worth to notice

.

that the highest number of LAB was observed in sturgeon

groups with highest SGR and gut enzyme activity

In probiotic studies, one can speculate whether the

pro-biont can tolerate the pH of the fish stomach and survive the

passage to the intestine As the pH of stomach in fish is

between 3.0 and 4.5 (Ringø et al 2003) and the evacuation

time of food is relatively short, it is generally accepted that

bacteria such as LAB can survive passage to the intestine

Furthermore, one should bear in mind that Lactobacillus and

Leuconostoccan tolerate relative low pH (4.5)

Difficulties in analysing the complexity of bacterial

com-munity by classic methods of cultivation have necessitated

the development of molecular methods To overcome these

problems, various methods such as denaturing gradient gel

electrophoresis (DGGE), fluorescence in situ hybridization

and temporal temperature gradient electrophoresis and clone

libraries have been developed to circumvent the need for

isolation To the authorsÕ knowledge, only one preliminary

study of Siberian sturgeon (Acipenser baeri) has investigated

the gut microbiota by DGGE (Delaedt et al 2008) using

eubacterial primers as described by Muyzer et al (1993)

Therefore, in future studies, we recommend using DGGE

when evaluating the bacterial gut community in Persian

sturgeon and beluga Furthermore, we recommend that

future probiotic studies on sturgeon include the topics:

sup-plementation duration, mucosal immune system, challenge

studies and GI morphology evaluation as golden standards

Nikoskelainen et al (2001) suggested that mucosal

adhe-sion is one of the five important criteria for the selection of

probiotics in fish Whereas some authors postulate that

probiotic colonization of intestinal epithelial surface include

host specificity (Lin & Savage 1984; Fuller 1986), other have

reported the absence of specificity in LAB when binding host

intestinal mucus Gildberg & Mikkelsen (1998) suggested

that there seems to be no host specificity between the two

strains of Carnobacterium divergens, originally isolated from

the gut of Atlantic cod (Gadus morhua L.) and Atlantic

sal-mon (Salmo salar L.) in the GI tract of Atlantic cod fry

Ringø (1999) questioned whether C divergens originally

isolated from the gut of Atlantic salmon (Strøm 1988) was

able to attach the mucosal surface and colonize the gut of

turbot (Scophthalmus maximus L.) larvae, and concluded

that no host specificity was involved in the gut of turbot

larvae at the time of hatching Two later studies also reported

the absence of specificity in LAB when binding host intestinal

mucus (Rinkinen et al 2003; Salinas et al 2008) As the fish

were starved for 24 h prior to sampling, we suggest that the

gut bacteria isolated in the present study probably belong to

the autochthonous microbiota However, one critical

com-ment to this statecom-ment is that the sampling procedure isinsufficient to distinguish between the autochthonous andallochthonous gut bacteria However, few strains ofLeu mesenteroides were identified in the digestive tract ofbeluga even when the fish were fed Leu mesenteroides(Table 2) Based on the results presented in Table 2, we putforward the controversial hypothesis that host-specificadherence of Leu mesenteroides in the digestive tract ofPersian sturgeon and L curvatus in the GI tract of beluga frymight occur However, more information concerning themechanism of action eventually involved in the host-specificadhesion of LAB in sturgeon merits further research

In the present study, the fry were continuously fed theprobiotic diets However, as the fish were not reverted back

to the control diet for a longer period, we cannot concludethat the LAB used in the present study are permanentlycolonizing the digestive tract To clarify this additionalstudies are necessary

Another aspect on the use of probiotics is dose-dependentstudies According to Merrifield et al (2010), such studies arecurrently limited and somewhat contradictory This was alsodemonstrated in the present study, as supplementation of

9· 109

L curvatus in the diet to beluga improved the gutenzyme activities, while addition of 2· 109Leu mesentero-ides enhanced gut activities in Persian sturgeon To clarifythe mechanisms, further studies have to be carried out

Thanks to Dr Mahmoud Bahmani, Dr Ali Reza Shenavarand their colleagues at the International Sturgeon ResearchInstitute, Gilan Province, Iran for their inestimable helpduring the experiment

Akrami, R., Hajimoradloo, A., Matinfar, A & Abedian, K.S (2009) Effect of dietary prebiotic inulin on growth performance, intestinal microflora, body composition and haematological parameters of juvenile beluga, Huso huso (Linnaeus, 1758) J World Aquac Soc.,

40, 771–779.

Asadi, F., Masoudifard, M., Vajihi, A., Lee, K., Pourkabir, M &

Khazraeinia, P (2006) Serum biochemical parameters of Acipenser persicus Fish Physiol Biochem., 32, 43–47.

Askarian, F., Kousha, A & Ringø, E (2009) Isolation of lactic acid bacteria from the gastrointestinal tracts of beluga (Huso huso) and Persian sturgeon (Acipenser persicus) J Appl Ichthyol., 25(Suppl.

2), 91–94.

Bahmani, M., Kazemi, R & Donskaya, P (2001) A comparative study of some hematological features in young reared sturgeons (Acipenser persicus and Huso huso) Fish Physiol Biochem., 24, 135–140.

.

Aquaculture Nutrition 17; 488–497  2011 Blackwell Publishing Ltd

Bairagi, A., Ghosh, K.S., Sen, S.K & Ray, A.K (2002) Enzyme

producing bacterial flora isolated from fish digestive tracts Aquac.

Int., 10, 109–121.

Balcazar, J.L., de Bias, I., Ruiz-Zarzuela, I., Cunningham, D.,

Vendrell, D & Muzquiz, J.L (2006) The role of probiotics in

aquaculture Vet Microbiol., 114, 173–186.

Balcazar, J.L., de Bias, I., Ruiz-Zarzuela, I., Vendrell, D., Girones,

O & Muzquiz, J.C (2007) Sequencing of variable regions of the

16S rRNA gene for identification of lactic acid bacteria isolated

from the intestinal microbiota of healthy salmonids Comp.

Immunol Microbiol Infect Dis., 30, 111–118.

Balcazar, J.L., Vendrell, D., de Bias, I., Ruiz-Zarzuela, I., Muzquiz,

J.L & Girones, O (2008) Characterisation of probiotic properties

of lactic acid bacteria isolated from intestinal microbiota of fish.

Aquaculture, 278, 188–191.

Bemis, W.E., Findeis, E.K & Grande, L (1997) An overview of

Acipenseriformes Environ Biol Fish, 48, 25–71.

Cahu, C.L., Zambonino Infante, J.L., Peres, A., Quazuguel, P & Le

Gall, M.M (1998) Algal addition in sea bass (Dicentrarchus

lab-rax) larvae rearing effect on digestive enzymes Aquaculture, 161,

479–489.

Dall, W & Moriarty, D.J.W (1983) Functional aspects of nutrition

and digestion In: The Biology of Crustacea, vol 5 (Mantel, L.H.

ed.) Internal Anatomy and Physiology Regulation pp 1–52.

Academic Press, New York.

Delaedt, Y., Diallo, M.D., Rurangwa, E., Courtin, C.M., Delcour,

J.A & Ollevier, F (2008) Impact of Arabinoxylooligosaccharides on

Microbial Community Composition and Diversity in the Gut of

Siberian Sturgeon (Acipenser baeri) Aquaculture Europe,

Kra-kow, Poland, September 15–18, 2008, pp 183–184.

Dopazo, C.P., Lemos, M.L., Lodeiros, C., Boliches, J., Barja, J.L &

Toranzo, A.E (1988) Inhibitory activity of antibiotic-producing

marine bacteria against fish pathogens J Appl Bacteriol., 65,

97–101.

El-Haroun, E.R., Goda, A.-S.A.M & Chowdury, M.A.K (2006)

Effect of dietary probiotic Biogen supplementation as a growth

promotor on growth performance and feed utilization of

Nile tilapia Oreochromis niloticus (L.) Aquacult Res., 37, 1473–

1480.

Fuller, R (1986) Probiotics J Appl Bacteriol Symposium

Supple-ment, 1S–7S.

Furne´, M., Hidalgo, M.C., Lo´pez, A., Garcı´a-Gallego, M., Morales,

A.E., Domezain, A., Domezaine, J & Sanz, A (2005) Digestive

enzyme activities in Adriatic sturgeon Acipenser naccarii and

rainbow trout Oncorhynchus mykiss A comparative study

Aqua-culture, 250, 391–398.

Gatesoupe, F.J (1991) The effect of three strains of lactic bacteria on

the production rate of rotifers, Brachionus plicatilis, and their

dietary value for larval turbot, Scophthalmus maximus

Aquacul-ture, 96, 335–342.

Gatesoupe, F.J (1999) The use of probiotics in aquaculture

Aqua-culture, 180, 147–165.

Gatesoupe, F.J (2008) Updating the importance of lactic acid

bac-teria in fish farming: natural occurrence and probiotics treatments.

J Mol Microbiol Biotechnol., 14, 107–114.

Ghanbari, M., Rezaie, M., Jami, M & Nazari, R.M (2009) Isolation

and characterization of Lactobacillus species from intestinal

con-tents of beluga (Huso huso) and Persian sturgeon (Acipenser

per-sicus) Iranian J Vet Res Shiraz Univ., 27, 152–157.

Ghosh, K., Sen, S.K & Ray, A.K (2003) Supplementation of an

isolated fish gut bacterium, Bacillus circulans, in formulated diets

for rohu, Labeo rohita, fingerlings Isr J Aquac Bamidgeh., 55,

13–21.

Ghosh, S., Sinha, A & Sahu, C (2008) Dietary probiotic mentation in growth and health of live-bearing ornamental fishes Aquac Nutr., 14, 289–299.

supple-Gildberg, A & Mikkelsen, H (1998) Effect of supplementing the feed of Atlantic cod (Gadus morhua) fry with lactic acid bacteria and immunostimulating peptides during a challenge trial with Vibrio anguillarum Aquaculture, 167, 103–113.

Gildberg, A., Mikkelsen, H., Sandaker, E & Ringø, E (1997) Probiotic effect of lactic acid bacteria in the feed on growth and survival of fry of Atlantic cod (Gadus morhua) Hydrobiologia, 352, 279–285.

Gomez-Gil, B., Roque, A & Turnbull, J.F (2000) The use and selection of probiotic bacteria for use in the culture of larval aquatic organisms Aquaculture, 191, 259–270.

Gram, L & Ringø, E (2005) Prospects of fish probiotics In: Microbial Ecology in Growing Animals (Holzapfel, W & Naugh- ton, P eds), pp 379–417 Elsevier, Edinburgh, UK.

Huys, G., Vanhoutte, T., Joossens, M., Mahious, A.S., Brandt, E.D., Vermeire, S & Swings, J (2008) Coamplification of eukaryotic DNA with 16S rRNA gene-based PCR primers: possible conse- quences for population fingerprinting of complex microbial com- munities Curr Microbiol., 56, 553–557.

Irianto, A & Austin, B (2002) Probiotics in aquaculture J Fish Dis., 25, 633–642.

Kamei, Y., Yoshimizu, M., Ezura, Y & Kimura, T (1988) Screening

of bacteria with antiviral activity from fresh water salmonid hatcheries Microbiol Immunol., 32, 67–73.

Kim, D.H & Austin, B (2006) Innate immune responses in rainbow trout (Oncorhynchus mykiss, Walbaum) induced by probiotics Fish Shellfish Immunol., 21, 513–524.

Kissil, G.W., Lupatsch, I., Elizur, A & Zohar, Y (2001) Long photoperiod delayed spawing and increased somatic growth in gilthead sea bream (Sparus aurata) Aquaculture, 200, 363–379 Kollath, W (1953) The increase of the diseases of civilization and their prevention Mu¨nch Med Wochenschr., 95, 1260–1262.

Li, P., Burr, G.S., Goff, J., Whiteman, K.W., Davis, K.B., Vega, R.R., Neill, W.H & Gatlin, D.M III (2005) A preliminary study

on the effects of dietary supplementation of brewers yeast and nucleotides, singularly or in combination, on juvenile red drum (Sciaenops ocellatus) Aquacult Res., 36, 1120–1127.

Lilley, D.M & Stillwell, R.J (1965) Probiotics: growth promoting factors produced by micro organisms Science, 147, 747–748 Lin, J.H.C & Savage, D.C (1984) Host specificity of the coloniza- tion of murine gastric epithelium by lactobacilli FEMS Microbiol Lett., 24, 67–71.

Macey, B.M & Coyne, V.E (2005) Improved growth rate and ease resistance in farmed Haliotis midae through probiotic treat- ment Aquaculture, 245, 249–261.

dis-Merrifield, D.L., Dimitroglou, A., Foey, A., Davies, S.J., Baker, R.T., Bøgwald, J., Castex, M & Ringø, E (2010) The current status and future focus of probiotic and prebiotic applications for salmonids Aquaculture, 302, 1–18.

Moriarty, D.J.W (1996) Microbial biotechnology: a key ingredient for sustainable aquaculture Infofish Int., 4, 29–33.

Moriarty, D.J.W (1998) Control of luminous Vibrio species in penaeid aquaculture ponds Aquaculture, 164, 351–358.

Muyzer, G., Dewaal, E.C & Uitterlinden, A.G (1993) Profiling of complex microbial populations by denaturing gradient gel elec- trophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA Appl Environ Microbiol., 59, 695– 700.

Nikoskelainen, S., Salminen, S., Bylund, G & Ouwehand, A (2001) Characterization of the properties of human and dairy-derived

probiotics for prevention of infectious diseases in fish Appl.

Environ Microbiol., 67, 2430–2435.

Nikoskelainen, S., Ouwehand, A., Bylund, G., Salminen, S & Lilius,

E.M (2003) Immune enhancement in rainbow trout

(Oncorhyn-chus mykiss) by potential probiotic bacteria (Lactobacillus

rhamnosus) Fish Shellfish Immunol., 15, 443–452.

Panigrahi, A., Kiron, V., Kobayashi, T., Puangkaew, J., Satoh, S &

Sugita, H (2004) Immune responses in rainbow trout

Oncorhyn-chus mykiss induced by a potential probiotic bacteria Lactobacillus

rhamnosus JCM 1136 Vet Immunol Immunopathol., 102, 379–388.

Phianphak, W., Rengpipat, S., Piyatiratitivorakul, S & Menasveta,

P (1999) Probiotic use of Lactobacillus spp for black tiger shrimp

Penaeus monodon J Sci Res., Chulalongkorn Univ., 24, 42–51.

Prieur, G., Nicolas, J.L., Plus uellec, A & Vigneulle, M (1990)

Interactions between bivalves molluscs and bacteria in the marine

environment Oceanogr Mar Biol Annu Rev., 28, 227–352.

Ribeiro, L., Zambonino Infante, J.L., Cahu, C & Dinis, M.T (1999)

Development of digestive enzymes in larvae of Solea senegalensis,

Kaup 1858 Aquaculture, 179, 465–473.

Ringø, E (1999) Is Carnobacterium divergens, isolated from Atlantic

salmon (Salmo salar) able to colonize the gut of turbot

(Scoph-thalmus maximus) larvae? Aquacult Res., 30, 229–232.

Ringø, E (2004) Lactic acid bacteria in fish and fish farming In:

Lactic Acid Bacteria (Salminen, S., Ouwehand, A & von Wrigth,

A eds), pp 581–610 Marcel Dekker Inc, New York.

Ringø, E (2008) The ability of carnobacteria isolated from fish

intestine to inhibit growth of fish pathogenic bacteria: a screening

study Aquacult Res., 39, 171–180.

Ringø, E & Birkbeck, T.H (1999) Intestinal microflora of fish larvae

and fry Aquacult Res., 30, 73–93.

Ringø, E & Gatesoupe, F.J (1998) Lactic acid bacteria in fish: a

review Aquaculture, 160, 177–203.

Ringø, E., Strøm, E & Tabacheck, J (1995) Intestinal microflora of

salmonids: a review Aquacult Res., 26, 773–789.

Ringø, E., Olsen, R.E., Mayhew, T.M & Myklebust, R (2003)

Electron microscopy of the intestinal microflora of fish

Aquacul-ture, 227, 395–415.

Ringø, E., Schillinger, U & Holzapfel, W (2005) Antibacterial

abilities of lactic acid bacteria isolated from aquatic animals and

the use of lactic acid bacteria in aquaculture In: Microbial Ecology

in Growing Animals (Holzapfel, W & Naughton, P eds), pp 418–

453 Elsevier, Edinburgh, UK.

Ringø, E., Sperstad, S., Myklebust, R., Mayhew, T.M., Mjelde, A.,

Melle, W & Olsen, R.E (2006) The effect of dietary krill

supple-mentation on epithelium-associated bacteria in the hindgut of

Atlantic salmon (Salmo salar L.): a microbial and electron

microscopical study Aquacult Res., 37, 1644–1653.

Ringø, E., Løvmo, L., Kristiansen, M., Salinas, I., Myklebust, R.,

Olsen, R.E & Mayhew, T.M (2010) Lactic acid bacteria vs.

pathogens in the gastrointestinal tract of fish: a review Aquacult.

Res., 41, 451–467.

Rinkinen, M.E., Westermarck, S., Salminen, A.C & Ouwehand,

A.C (2003) Absence of host specificity for in vitro adhesion of

probiotic lactic acid bacteria to intestinal mucus Vet Microbiol.,

9, 56–61.

Robertson, P.A.W., Dowd, C.Õ., Burrells, C., Williams, P &

Aus-tin, B (2000) Use of Carnobacterium sp as a probiotic for Atlantic

salmon (Salmo salar L.) and rainbow trout (Oncorhynchus mykiss,

Walbaum) Aquaculture, 185, 235–243.

Saenz de Rodriganez, M.A., Diaz-Rosales, P., Chabrillon, M et al.

(2009) Effect of dietary administration of probiotics on growth and

intestine functionality of juvenile Senegalese sole (Solea

senegal-ensis, Kaup 1858) Aquac Nutr., 15, 177–185.

Sakata, T (1990) Microflora in the digestive tract of fish and fish In: Microbiology in Poecilotherms (Lesel, R ed.), pp 171–176.

shell-Elsevier, Amsterdam.

Salinas, I., Myklebust, R., Esteban, M.A., Olsen, R.E., Meseguer, J.

& Ringø, E (2008) In vitro studies of Lactobacillus delbrueckii subsp lactis in Atlantic salmon (Salmo salar L.) foregut: tissue responses and evidence of protection against Aeromonas salmoni- cida subsp salmonicida epithelial damage Vet Microbiol., 128, 167–177.

Schro¨der, K., Clausen, E., Sandberg, A.M & Raa, J (1980) chrotropic Lactobacillus plantarum from fish and its ability to produce antibiotic substances In: Advances in Fish Science and Technology (Connell, J.J ed.), pp 480–483 Fishing News Books Ltd Farnham, Surrey.

Psy-Sharifuzzaman, S.M & Austin, B (2010) Kocuria SM1 controls vibriosis in rainbow trout (Oncorhynchus mykiss, Walbaum).

J Appl Microbiol., 108, 2162–2170.

Shenavar Masouleh, A.S., Sharifpour, I & Arani, A.S (2006) The aerobic bacterial flora of hatchery reared Caspian Sea sturgeon fingerlings J Appl Ichthyol., 22, 261–264.

Spanggaard, B., Huber, I., Nielsen, J., Nielsen, T., Appel, K.F &

Gram, L (2000) The microflora of rainbow trout intestine: a comparison of traditional and molecular identification Aquacul- ture, 182, 1–15.

Strøm, E (1988) Melkesyrebakterier i fisketarm Isolasjon, terisering og egenskaper Norwegian College of Fishery Science, University of Tromsø, Tromsø, Norway MSc Thesis (in Nor- wegian), 88 pp.

karak-Subasinghe, R.P., Curry, D., McGladdery, S.E & Bartley, D.

(2003) Recent Technological Innovations in Aquaculture Review

of the State of World Aquaculture, FAO Fisheries Circular,

pp 59–64.

Sujaya, I.N., Amachi, S., Yokota, A., Asana, K & Tomita, F (2001) Identification and characterization of lactic acid bacteria in ragi tape World J Microbiol Biotechnol., 17, 349–357.

Suzer, C., Coban, D., Kamaci, H.O., Saka, S., Firat, K., Otgucuoglu, O¨ & Ku¨cu¨ksari, H (2008) Lactobacillus spp bacteria as probiotics

in gilthead sea bream (Sparus aurata, L.) larvae: effects on growth performance and digestive enzyme activities Aquaculture, 280, 140–145.

Taoka, Y., Maeda, H., Jo, J.Y., Jeon, M.J., Bai, S.C., Lee, W.J., Yuge, K & Koshio, S (2006) Growth, stress tolerance and non- specific immune response of Japanese flounder Paralichthys oli- vaceus to probiotics in a closed recirculating system Fish Sci., 72, 310–321.

Thapa, N., Pal, J & Tamang, J (2006) Phenotype identification and technological properties of lactic acid bacteria isolated from tra- ditionally processed fish products of eastern Himalayas Int J.

Tovar-Ramirez, D., Infante, J.Z., Cahu, C., Gatesoupe, F.J &

Vazquez-Juarez, R (2004) Influence of dietary live yeast on European sea bass (Dicentrarchus labrax) larval development.

Wache, Y., Auffray, F., Gatesoupe, F.-J., Zambonino, J., Gayet, V.,

Labbe, L & Quentel, C (2006) Cross effects of the strain of dietary

Saccharomyces cerevisiae and rearing conditions on the onset of

intestinal microbiota and digestive enzymes in rainbow trout,

Onchorhynchus mykiss, fry Aquaculture, 258, 40–478.

Wang, Y.B (2007) Effect of probiotic on growth performance and

digestive enzyme activity of shrimp Penaeus vannamei

Aquacul-ture, 269, 259–264.

Wang, Y.B & Xu, Z.R (2006) Effect of probiotics for common carp

(Cyprinus carpio) based on growth performance and digestive

enzyme activities Anim Feed Sci Technol., 127, 283–292.

Wang, X., Li, H., Zhang, X., Li, Y., Ji, W & Xu, H (2000) Microbial flora in the digestive tract of adult penaeid shrimp (Penaeus chinensis) J Ocean Univ Qingdao, 30, 493–498 Ziaei-Nejad, S., Rezaei, M.H., Takami, G.A., Lovett, D.L., Mir- vaghefi, A.R & Shakouri, M (2006) The effect of Bacillus spp bacteria used as probiotics on digestive enzyme activity, survival and growth in the Indian white shrimp Fenneropenaeus indicus Aquaculture, 252, 516–524.

Zivkovic, R (1999) Probiotics or microbes against microbes Acta Med Croatica, 53, 23–28.

.

1 1 1 2

3 1

Department of Fisheries & Environmental Sciences, Faculty of Natural Resources, University of Tehran, Karaj, Iran;2 Iranian

fisheries research organization (IFRO), Inland waters fisheries research of Gorgan, Gorgan, Iran; 3 Aquaculture and Fish

Nutrition Research Group, School of Biomedical and Biological Sciences, The University of Plymouth, Plymouth, UK

Preliminary experiments were undertaken to investigate the

effects of oligofructose on beluga sturgeon (Huso huso)

growth performance, survival and culturable autochthonous

intestinal microbiota Juveniles (20 g) were fed diets

con-taining varying levels of oligofructose (10, 20 and 30 g kg)1)

at 2–3% body weight per day for 7 weeks Compared to the

control group, no significant (P > 0.05) effect on growth

performance was observed in fish fed diets supplemented

with oligofructose at 10 and 20 g kg)1 However, compared

to the 20 g kg)1 group, feeding oligofructose at 30 g kg)1

resulted in adverse effects on growth performance Dietary

supplementation of oligofructose at 20 g kg)1 significantly

increased survival rate Microbiological assessment indicated

that the viable culturable autochthonous levels were not

affected by dietary oligofructose Although lactic acid

bac-teria (LAB) were not a dominant component of the

endog-enous autochthonous microbiota, LAB levels were

significantly elevated in fish fed 20 g kg)1dietary

oligofruc-tose This elevated LAB population was able to persist for at

least 1 week after reverting the prebiotic group back to a

control diet This study encourages further research on

dif-ferent aspects of oligofructose in sturgeon culture with clear

emphasis on optimizing dosage levels

oligo-fructose, prebiotic, survival

Received 31 January 2010, accepted 20 August 2010

Correspondence: S.H Hoseinifar, Department of Fisheries &

Environ-mental Sciences, Faculty of Natural Resources, University of Tehran,

31585-4314 Karaj, Iran E-mail: hoseinifar@ut.ac.ir

Sturgeons are commercially valuable species, which are rently highly endangered because of over fishing, loss ofhabitat and decreased water quality (Carmona et al 2009)

cur-Sturgeon culture has seen considerable progress in recentyears because artificial culture up to marketable size isimportant to reduce pressure on natural population of stur-geon in the Caspian Sea (Pourkazemi 1997) Great sturgeon

or beluga (Huso huso) is an endangered species that is thesubject of restoration and restocking schemes, but because ofits fast growth rates, like other sturgeon species, appears to

be very suitable for aquaculture for meat and caviar duction (Williot et al 2001; Sudagar & Hosseinifar 2005;

pro-Mohseni et al 2008) At present, however, very little mation is available about the nutritional requirements of

infor-H huso(Hung & Deng 2002)

Prebiotics, defined as non-digestible food ingredients thatbeneficially affect the host by selectively stimulating thegrowth of and/or activity of health-promoting bacteria in theintestinal tract (Gibson 2004), have been demonstrated toshow great potential as dietary supplements in aquafeeds(Merrifield et al 2010; Ringø et al 2010) Inulin and oligo-fructose are among the most commonly used prebiotic foodingredients (Van Loo et al 1999) Dietary supplementation

of oligofructose or inulin (a heterogeneous blend of fructosepolymers) has been shown to enhance growth rates and/orthe survival of aquatic animals such as Siberian sturgeonAcipenser baeri (Mahious & Ollevier 2005), African catfishClarias gariepinus(Mahious & Ollevier 2005), turbot Psettamaxima larvae (Mahious et al 2006) and Indian whiteshrimp Fenneropenaeus indicus (Hosseinifar et al 2010a)

Furthermore, it has been reported that dietary oligofructose

modulates the gut microbiota of turbot larvae (Mahious

et al.2006), and dietary inulin has been observed to modulate

the intestinal microbiota of Arctic charr Salvelinus alpinus

(Ringø et al 2006) and Atlantic salmon Salmo salar

(Bakke-McKellep et al 2007) Despite recent progress of inulin-type

prebiotics in many fish species (for reviews see Merrifield

et al.2010; Ringø et al 2010), limited information is

avail-able on the effects of oligofructose on beluga

Thus, the aim of this study was to determine the effects of

oligofructose as a prebiotic on growth parameters, survival

and intestinal microbiota of beluga Huso huso juveniles

Oligofructose consists predominantly of polydisperse

b-(2fi 1)-linked fructans produced by partial enzymatic

hydrolysis of chicory inulin (Niness 1999) The degree of

polymerization of the fructans in oligofructose (Raftilose

P95) ranges from 2% to 8% (Mahious & Ollevier 2005) The

minimum level of fructans guaranteed by the manufacturer

(Raffinerie Tirlemontoise, Tienen, Belgium) was 930 g kg)1

with the main remaining components consisting of glucose,

fructose and sucrose Chemical composition of the product

according to manufacturer was 982 g kg)1 dry matter and

18 g kg)1crude ash

A basal diet was formulated (for the control group), and the

prebiotic diets were prepared by supplementing the basal

for-mula with varying levels of oligofructose (10, 20 and 30 g kg)1;

Table 1) The ingredients were blended with an additional

100 mL of water per 1 kg to form a paste The pastes were

passed through a meat grinder equipped with a 2-mm die to

obtain uniform pellets The pelleted diets were air-dried and

stored in plastic bags at)2 C (Abdel-Tawwab et al 2008)

Beluga juveniles were supplied by the Shahid Marjani

Stur-geon Fish Propagation & Cultivation Center (Golestan

prov-ince, Iran) and randomly allocated in 12 tanks (800 L tanks; 50

fish per tank) Each feeding group was conducted in triplicate

Water temperature, dissolved oxygen, pH and salinity were

monitored daily and maintained at 24.38 ± 0.57C,

5.13 ± 0.40 mg L)1, 7.97 ± 0.06 and 2.62 g L)1,

respec-tively Continuous aeration was provided to each tank through

an air stone connected to a central air compressor Juvenileswere fed at 2–3% of body weight per day (at 06:00, 09:00,13:00, 16:00 and 20:00) for 7 weeks All growth data and car-cass composition are reported from weights and samples taken

at week 7, which is classed as the end of the feeding experiment

Growth performance and feed utilization were calculatedaccording to the following formulae: WG = W2) W1;specific growth rate (SGR) = 100 (ln W2)ln W1)/T, feedconversion ratio (FCR) = FO/WG (g), condition fac-tor = fish weight (g)/(fish length cm)3· 100 and hepatoso-matic index (HSI) = liver weight (g)/fish weight (g)· 100,where W1is the initial weight (g), W2is the final weight (g), T

is time (days), FO is feed offered (g) and WG is the weightgain In addition, survival rate was calculated at the end ofthe experiment: survival = (Nf/N0)*100; where N0 is theinitial number of fish and Nfis the final number of fish

Proximate analysis of the formulated diets and fish carcasses(at week 7) from each treatment were determined according

Table 1 Dietary formulations (g kg ) and proximate composition

2 Amet binderTM, Mehr Taban-e- Yazd, Iran.

3 ToxiBan antifungal (Vet-A-Mix, Shenan- doah, IA, USA).

4 Butylated hydroxytoluene (BHT) (Merck, Germany).

5 Dry matter basis.

6 Nitrogen-free extracts (NFE) = dry matter ) (crude protein + crude lipid + ash + fibre).

7 Gross energy (MJ kg)1) calculated according to 23.6 kJ g)1for protein, 39.5 kJ g)1for lipid and 17.0 kJ g)1for NFE.

.

to standard AOAC (1990) methodology Gross energy was

calculated using the conversion factors of 23.6, 39.5 and

17.0 kJ g)1 for protein, lipid and nitrogen-free extract

(NFE), respectively (Brett & Groves 1979)

The analysis of intestinal microbiota was conducted at week

0 (initial fish), week 7 (the end of the nutrition trial) and week

8 Between week 7 and week 8, all groups were fed the control

diet to investigate the persistence of any potential differences

caused by the prebiotic Total viable autochthonous

hetero-trophic aerobic bacteria and lactic acid bacteria (LAB) levels

were determined at the start of trial from 15 specimens from

the initial pool of fish At the end of the experiment, three fish

per tank were randomly sampled for microbiological studies

Samples were processed individually (i.e n = 9 per

treat-ment) Fish were starved for 24 h prior to microbiological

sampling The fish were killed by physical destruction of the

brain, and the skin was then washed with 0.1%

benzalkoni-um chloride before opening the ventral surface The entire

intestinal tract was removed aseptically, washed thoroughly

with sterile saline (0.85% NaCl) and homogenized (Potter–

Elvehjem Tissue Homogenizer, Cole-Parmer Instrument

Company, IL, USA) to isolate the autochthonous intestinal

microbiological communities The homogenate was serially

diluted to 10)7with sterile saline and 100 lL of the samples

was spread in triplicate onto plate count agar (PCA)

(Lio-filchem, Roseto degli Abruzzi, Italy) and de Man, Rogosa

and Sharpe (MRS) agar (Liofilchem) for the enumeration of

total viable aerobic heterotrophic bacteria and LAB,

respectively Plates were incubated at room temperature

(25C) for 5 days (Mahious et al 2006) and colony-forming

units (CFU) g)1 were calculated from statistically viable

plates (i.e plates containing 30–300 colonies) (Rawling et al

2009)

All statistical analyses were conducted using SPSSstatisticalpackage version 10.0 (SPSS Inc., Chicago, IL, USA) Afterchecking for normality and homogeneity of variance, datawere subjected to a one-way analysis of variance (ANOVA)

When significant differences were observed, DuncanÕs tiple range tests were performed (Zar 1994) Mean valueswere considered significantly different at P < 0.05 Data areexpressed as mean values ± SD

mul-Growth performance and feed utilization parameters ofbeluga juveniles fed different levels of dietary oligofructose(Raftilose, P95) are shown in Table 2 There were nosignificant differences between final weight, WG, SGR orFCR of juveniles fed the control, 10 and 20 g kg)1 oligo-fructose diets (P > 0.05) However, compared to the fish fed

20 g kg)1oligofructose, the final weight of fish fed 30 g kg)1oligofructose was significantly lower (P = 0.01) Survivalrate of the 20 g kg)1 dietary oligofructose fed fish wassignificantly elevated compared to the control group(P = 0.01) There were no significant differences of bodycomposition of beluga juveniles from the different dietarygroups (P > 0.05) (Table 3)

Compared to the control group, total heterotrophicautochthonous bacterial levels in fish fed 30 g kg)1 oligo-fructose (5.81 ± 0.88 versus 6.71 ± 0.37 CFU g)1 in thecontrol) were significantly lower (P = 0.01) (Table 4) Addi-tionally, autochthonous LAB levels in the 20 g kg)1dietary

Table 2 Growth performance and diet utilization of beluga juveniles fed diets containing varying levels of oligofruc- tose (g kg)1) (Raftilose, P95)

Feed conversion ratio (FCR) 2.80 ± 0.08 2.81 ± 0.12 2.65 ± 0.12 3.06 ± 0.29

Protein efficiency ratio (PER) 1.58 ± 0.30 1.49 ± 0.02 1.58 ± 0.04 1.36 ± 0.09

Survival (%) 87.17 ± 2.22b 89.10 ± 2.93ab 96.15 ± 3.84a 86.45 ± 6.97b

Hepatosomatic index (HSI) 3.66 ± 0.42 3.73 ± 0.38 3.75 ± 0.54 3.64 ± 0.50

Data assigned with different superscripts indicate significant differences (P < 0.05).

.

Aquaculture Nutrition 17; 498–504  2011 Blackwell Publishing Ltd

oligofructose group were significantly elevated (5.36 ± 0.49

versus 4.23 ± 0.81 CFU g)1in the control; P = 0.01) at the

end of trial (week 7) LAB levels in the 20 g kg)1oligofructose

(5.15 ± 0.47 CFU g)1) fed fish remained significantly

ele-vated 1 week after reverting to the control diet (week 8)

It has been reported that elevated resistance to pathogens,

improved growth performance, feed utilization, lipid

metabolism and immuno-stimulation may all be possible

through microbial manipulation of gastric populations using

prebiotics (Ringø et al 2010) Prebiotics are functional

die-tary supplements with documented positive applications in a

range of fish and crustacean species (Merrifield et al 2010;

Ringø et al 2010) To our knowledge, this study is the first

attempt to investigate the effects of oligofructose as a

prebiotic on growth performance, survival and intestinal

microbiota of beluga juveniles

Our results revealed that dietary supplementation with 10and 20 g kg)1 oligofructose had no significant effects onbeluga growth performance, feed utilization or carcasscomposition; furthermore, higher level of dietary oligofruc-tose (30 g kg)1) resulted in adverse effects compared to the

20 g kg)1group These results are in agreement with thoseobtained by Akrami et al (2007) who used the same levels(10, 20 and 30 g kg)1) of dietary inulin as a prebiotic forbeluga juveniles Several studies have reported improvedgrowth performance and feed utilization of fish and shellfishfed dietary prebiotics (Mahious & Ollevier 2005; Mahious

et al.2006; Genc et al 2007b; Lv et al 2007; Staykov et al.2007; Torrecillas et al 2007; Zhou et al 2007; Samrongpan

et al 2008) On the contrary, several other studies haverevealed that growth parameters have remained unaffectedwith prebiotic applications in fish (Yoshida et al 1995; Pryor

et al 2003; Genc et al 2006, 2007a; Akrami et al 2007;Sheikholeslami et al 2007; Grisdale-Helland et al 2009;Dimitroglou et al 2010) It is clear that optimizing prebioticdosage levels requires further attention as there is often a fineline between achieving benefits and achieving negative effects.Such negative effects may be attributed to the inability ofintestinal microbiota to ferment excessive prebiotic levels andthe subsequent accumulation of indigestible material in theintestine which may cause irritation to the gut (Olsen et al.2001)

In the present study, increased survival was observed inbeluga juveniles fed oligofructose at 20 g kg)1compared tothe control and 30 g kg)1 treatment Similar improvements

in the survival of non-pathogen challenged cobia tron canadum larvae (Salze et al 2008), rainbow troutOncorhynchus mykiss(Staykov et al 2007) and Indian whiteshrimp post-larvae (Hosseinifar et al 2010a) have beenobserved with prebiotic applications On the contrary, die-tary inulin had no significant effect on survival of belugajuveniles (Akrami 2007) or rainbow trout (Akrami et al.2007) In the present study, increased survival rate in belugajuveniles fed 20 g kg)1is possibly a sign of improved generalhealth or immune status Indeed, it has recently beenreported that 20 g kg)1 dietary oligofructose can elevatecirculating leucocyte levels of beluga (Hosseinifar et al.2010b) but further research is needed to investigate the effects

Rachycen-of oligRachycen-ofructose on beluga health parameters and diseaseresistance

Lactic acid bacteria (LAB) have been considered as ficial components of the fish intestinal ecosystem byproducing bacteriocins, lactic acid and other antagonisticcompounds, which inhibit the growth of certain fish patho-gens (Ringø & Gatesoupe 1998; Ringø et al 2005; Balca´zar

bene-Table 3 Carcass proximate composition beluga juveniles fed diets

containing varying levels of oligofructose (g kg)1) (Raftilose, P95).

Data represent means from three replicates per treatment

Table 4 Total viable counts (TVC) and lactic acid bacteria (LAB)

levels [log colony forming units (CFU) g)1intestine] in the gut of

beluga juveniles fed diets containing different levels of oligofructose

(g kg)1) (week 7) and after 1 week of reverting to the control diet

(week 8)

TVC (log CFU g)1)

LAB (log CFU g)1) LAB (%) Initial fish 0 5.19 ± 0.34 3.30 ± 0.33 1.28 ± 0.31

* There were no significant differences between week 7 and week

8 values in the respective groups.

.

et al.2007; Ringø 2008) Although they have been frequently

isolated from the gut of fish, such as Atlantic cod, Atlantic

salmon, Arctic char, beluga, tilapia and Persian sturgeon

(Sugita et al 1985; Ringø & Gatesoupe 1998; Hagi et al

2004; Askarian et al 2009; Merrifield et al 2010), they are

not generally considered to be the dominant species From

the present investigation, we conclude that culturable

autochthonous LAB are only minor components of the

intestine of beluga, constituting <6% of the total viable

culturable autochthonous populations Although these levels

were low, the LAB levels were significantly elevated in

juveniles fed 20 g kg)1 dietary oligofructose Indeed, many

LAB species are known to be able to utilize oligosaccharides

including oligofructose (Blay et al 1999; Kaplan & Hutkins

2000; Buddington et al 2002; Orrhage et al 2004; Roller

et al 2004; Ignatova et al 2009) In the present study,

feeding beluga juveniles with 30 g kg)1dietary oligofructose

reduced both total viable bacterial load and LAB levels

Similarly, Akrami (2007) and Ringø et al (2006) showed that

administration of high levels of dietary prebiotics lowered

total viable counts in the intestinal tract of beluga juveniles

and Arctic charr, respectively The exact mechanism behind

these observations is not known and should be a topic of

further study

Total viable bacterial counts and LAB levels after

revert-ing to the control diet for 1 week remained similar to that at

the end of the experimental feeding phase with LAB levels in

the 20 g kg)1 oligofructose-fed fish remaining significantly

elevated This is suggestive that the effect of the dietary

prebiotic can persist temporarily in the absence of dietary

prebiotic administration Presumably endogenous LAB are

provided with a competitive advantage over other

endo-genous bacterial populations within the digestive tract (i.e a

fermentable energy source) and are able to thrive and sustain

an elevated level even in the absence of the prebiotic for some

time This is an interesting finding and to our knowledge is

the first study on the effect of prebiotics on the gut

micro-biota of fish in the weeks after reverting back to

unsupplemented diets has been assessed Because of the

heavy influence of the rearing water and feed on fish gut

microbiota (Denev et al 2009), it is likely that this gastric

microbial modulation will not persist indefinitely; however,

the duration of such changes has yet to be determined A

comprehensive investigation of the effects of prebiotics on

endogenous microbial populations and assessment of the

persistence of microbial modulation should be the topic of

further studies that should incorporate more sensitive

molecular methods such as DGGE, 16S rRNA sequencing

and FISH

This preliminary study encourages further research ondifferent aspects of prebiotic administration in sturgeonculture as well as immunological studies to determine theeffects of prebiotics on the immune system and diseaseresistance of beluga juveniles The changes in LAB levelswarrant further studies including culture-independentmolecular methods to provide a more comprehensiveassessment of the effect on the gut microbiota

Abdel-Tawwab, M., Abdel-Rahman, A.M & Ismael, N (2008) Evaluation of commercial live bakerÕs yeast, Saccharomyces cere- visiae as a growth and immunity promoter for fry Nile tilapia, Oreochromis niloticus (L.) challenged in situ with Aeromonas hydrophila Aquaculture, 280, 185–189.

Akrami, R (2007) The Effects of Inulin as Prebiotic on Growth, Survival and Intenstinal Microflora of Beluga (Huso huso) PhD thesis, Islamic Azad university-Sciences & Research branch, 100

pp (in Persian).

Akrami, R., Ghelichi, A & Ebrahimi, A (2007) The effects of inulin

as prebiotic on growth, survival and intestinal microflora of rainbow trout (Oncorhynchus mykiss) Proceeding of First National Conference on Fisheries Sciences, 21–24 January, Lahijan, Iran,

pp 42.

AOAC (1990) Official Methods of Analyses, 15th edn (Helrich, K.

ed.) Association of Analytical Chemists, Arlington, VA.

Askarian, F., Kousha, A & Ringø, E (2009) Isolation of lactic acid bacteria from the gastrointestinal tracts of beluga (Huso huso) and Persian sturgeon (Acipenser persicus) J Appl Ichthyol., 25, 91–94.

Bakke-McKellep, A.M., Penn, M.H., Salas, P.M., Refstie, S., Sperstad, S., Landsverk, T., Ringø, E & Krogdahl, A˚ (2007) Effects of dietary soybean meal, inulin and oxytetracycline on gastrointestinal histological characteristics, distal intestine cell proliferation and intestinal microbiota in Atlantic salmon (Salmo salar L.) Br J Nutr., 97, 699–713.

Balca´zar, J.L., de Blas, I., Ruiz-Zarzuela, I., Vendrell, D., Girone´s,

O & Muzquiz, J.L (2007) Enhancement of the immune response and protection induced by probiotic lactic acid bacteria against furunculosis in rainbow trout (Oncorhynchus mykiss) FEMS Immunol Med Microbiol., 51, 185–193.

Blay, G.L., Michel, C., Blottie`re, H.M & Cherbut, Ch (1999) longed intake of fructo-oligosaccharides induces a short-term ele- vation of lactic acid-producing bacteria and a persistent increase in cecal butyrate in rats J Nutr., 129, 2231–2235.

Pro-Brett, J.R & Groves, T.D.D (1979) Physiological energetics In: Fish Physiology, Vol VIII (Hoar, W.S., Randall, D.J & Brett, J.R.

eds), pp 279–352 Academic Press, New York.

Buddington, K.K., Donahoo, J.B & Buddington, R.K (2002) tary oligofructose and inulin protect mice from enteric and sys- temic pathogens and tumor inducers J Nutr., 132, 472–477.

Die-Carmona, R., Domezain, A., Garcia-Gallego, M., Antonio nando, J., Rodriguez, F & Ruiz-Rejon, M (2009) Biology, Con- servation and Sustainable Development of Sturgeons, Springer publication, Netherlands, 467 pp.

Her-Denev, S., Staykov, Y., Moutafchieva, R & Beev, G (2009) Microbial ecology of the gastrointestinal tract of fish and the potential application of probiotics and prebiotics in finfish aqua- culture Int Aquat Res., 1, 1–29.

.

Aquaculture Nutrition 17; 498–504  2011 Blackwell Publishing Ltd

Dimitroglou, A., Merrifield, D.L., Spring, P., Sweetman, J., Moate,

R & Davies, S.J (2010) Effects of mannan oligosaccharide (MOS)

supplementation on growth performance, feed utilisation,

intesti-nal histology and gut microbiota of gilthead sea bream (Sparus

aurata) Aquaculture, 300, 182–188.

Genc, M., Yilmaz, E & Genc, E (2006) Effects of dietary

mannan-oligosaccharide on growth, intestine and liver histology of the

African catfish (Clarias gariepinus) Turk J Fish Aqu Sci., 23,

37–41.

Genc, M., Yilmaz, E & Genc, E (2007a) Effects of dietary mannan

oligosaccharides (MOS) on growth, body composition, and

intes-tine and liver histology of the hybrid tilapia (Oreochromis niloticus

· O aureus) Isr J Aquacult., 59, 10–16.

Genc, M.A., Aktas, M., Genc, E & Yilmaz, E (2007b) Effects of

dietary mannan oligosaccharide on growth, body composition and

hepatopancreas histology of Penaeus semisulcatus (de Haan 1844).

Aquacult Nutr., 13, 156–161.

Gibson, G.R (2004) Fiber and effects on probiotics (the prebiotic

concept) Clin Nutr., 1, 25–31.

Grisdale-Helland, B., Helland, S.J & Gatlin, D.M (2009) The effects

of dietary supplementation with mannanoligosaccharide,

fruc-tooligosaccharide or galacfruc-tooligosaccharide on the growth and

feed utilization of Atlantic salmon (Salmo salar) Aquaculture, 283,

163–167.

Hagi, T., Tanaka, D., Iwamura, Y & Hoshino, T (2004) Diversity

and seasonal change in lactic acid bacteria in the intestinal tract of

cultured freshwater fish Aquaculture, 234, 335–346.

Hosseinifar, S.H., Zare, P & Merrifield, D.L (2010a) The effects of

inulin on growth factors and survival of the Indian white shrimp

larvae and post-larvae (Fenneropenaeus indicus) Aquacult Res.,

early view, doi:10.1111/j.1365-2109.2010.02485.x.

Hosseinifar, S.H., Mirvaghefi, A., Merrifield, D.L., Mojazi Amiri,

B., Yelghi, S & Darvish Bastami, K (2010b) The study of some

haematological and serum biochemical parameters of juvenile

beluga (Huso huso) fed oligofructose Fish Physiol Biochem., DOI

10.1007/s10695-010-9420-9.

Hung, S.S.O & Deng, D.F (2002) Sturgeon, Acipenser spp In:

Nutrient Requirement and Feeding of Finfish for Aquaculture

(Webster, C.D & Lim, C ed.), pp 344–357 CABI Publishing,

Wallingford, Oxfordshire, UK.

Ignatova, T., Iliev, I., Kirilov, N., Vassileva, T., Dalgalarrondo, M.,

Haertl, T., Chobert, J & Ivanova, I (2009) Effect of

oligosaccha-rides on the growth of Lactobacillus delbrueckii subsp bulgaricus

strainsi from dairy products J Agric Food Chem., 57, 9496–9502.

Jalali, M.A., Ahmadifar, E., Sudagar, M & Azari Takami, G (2009)

Growth efficiency, body composition, survival and haematological

changes in great sturgeon (Huso huso Linnaeus, 1758) juveniles fed

diets supplemented with different levels of Ergosan Aquacult Res.,

40, 804–809.

Kaplan, H & Hutkins, R.W (2000) Fermentation of

fructooligo-saccharides by lactic acid bacteria and Bifidobacteria Appl

Envi-ron Microbiol., 66, 2682–2684.

Lv, H.Y., Zhou, Z.H., Florence, R & Fre´de´rique, R (2007) Effects

of dietary Short Chain Fructo-oligosaccharides on intestinal

microflora, mortality and growth performance of Oreochromis

aureus # · O niloticus $ Chin J Anim Nutr., 19, 1–6.

Mahious, A.S & Ollevier, F (2005) Probiotics and prebiotics in

aquaculture: a review The1st Regional Workshop on Techniques

for Enrichment of Live Food for Use in Larviculture, 7–11 March,

Urima, Iran, 17–26.

Mahious, A.S., Gatesoupe, F.J., Hervi, M., Metailler, R & Ollevier,

F (2006) Effect of dietary inulin and oligosaccharides as prebiotics

for weaning turbot, Psetta maxima Aquacult Int., 14, 219–229.

Merrifield, D.L., Dimitroglou, A., Foey, A., Davies, S.J., Baker, R.T.M., Bøgwald, J., Castex, M & Ringø, E (2010) The current status and future focus of probiotic and prebiotic applications for salmonids Aquaculture, 302, 1–18.

Mohseni, M., Ozorio, R.O.A., Pourkazemi, M & Bai, S.C (2008) Effects of dietary L-carnitine supplements on growth and body in beluga sturgeon (Huso huso) juveniles J Appl Ichthyol., 24, 646– 649.

Niness, K.R (1999) Inulin and oligofructose: what are they? J Nutr.,

J Antimic Chem., 46, 603–612.

Pourkazemi, M (1997) The survey status of sturgeon fishes and their conservation in the Caspian Sea Ir J Fish Sci., 3, 13–22 Pryor, G.S., Royes, J.B., Chapman, F.A & Miles, D (2003) Mannanoligosaccharides inf nutrition: effects of dietary supple- mentation on growth and gastrointestinal villi structure in Gulf of Mexico sturgeon N Am J Aquacult., 65, 106–111.

Rawling, M., Merrifield, D.L & Davies, S.J (2009) Preliminary assessment of dietary supplementation of Sangroviton red tilapia (Oreochromis niloticus) growth performance and health Aquacul- ture, 294, 118–122.

Ringø, E (2008) The ability of Carnobacteria isolated from fish intestine to inhibit growth of fish pathogenic bacteria: a screening study Aquacult Res., 39, 171–180.

Ringø, E & Gatesoupe, F.J (1998) Lactic acid bacteria in fish: a review Aquaculture, 160, 177–203.

Ringø, E., Schillinger, U & Holzapfel, W (2005) Antibacterial abilities of lactic acid bacteria isolated from aquatic animals and the use of lactic acid bacteria in aquaculture In: Microbial Ecology

in Growing Animals (Holzapfel, W & Naughton, P eds), pp 418–

453 Elsevier, Edinburgh, UK.

Ringø, E., Sperstad, S., Myklebust, R., Mayhew, T.M & Olsen, R.E (2006) The effect of dietary inulin on bacteria associated with hindgut of Arctic charr (Salvelinus alpinus L.) Aquacult Res., 37, 891–897.

Ringø, E., Løvmo, L., Kristiansen, M., Bakken, Y., Salinas, I., Myklebust, R., Olsen, R.E & Mayhew, T (2010) Lactic acid bacteria vs pathogens in the gastrointestinal tract of fish: a review Aquacult Res., 41, 451–467.

Roller, M., Rechkemmer, G & Watz, B (2004) Prebiotic inulin enriched with oligofructose in combination with the probiotics Lactobacillus rhamnosus and Bifidobacterium lactis modulates intestinal immune functions in rats J Nutr., 134, 153–156 Salze, G., McLean, E., Schwarz, M.H & Craig, S.R (2008) Dietary mannan oligosaccharide enhances salinity tolerance and gut development of larval cobia Aquaculture, 274, 148–152 Samrongpan, C., Areechon, N., Yoonpundh, R & Srisapoome, P (2008) Effects of mannan-oligosaccharide on growth, survival and disease resistance of Nile tilapia (Oreochromis niloticus) fry Pro- ceeding of 8th International Symposium on Tilapia in Aquaculture

2008, pp 345–354 Cairo, Egypt.

Sheikholeslami, M., Yusefian, M., Yavari, V., Mohamadian, T., Abhari, H & Goran, H (2007) Modulation of rainbow trout immune system and enhance resistance against streptococosis using dietary Inulin Proceeding of The First National Conference

on Caspian Sea Fisheries, pp 68 Gorgan, Iran.

.

Staykov, Y., Spring, P., Denev, S & Sweetman, J (2007) Effect of

mannan oligosaccharide on the growth performance and immune

status of rainbow trout (Oncorhynchus mykiss) Aquacult Int., 15,

153–161.

Sudagar, M & Hosseinifar, S.H (2005) The use of Optimun in diet

of grand sturgeon Huso huso fry and its effects on growing factors

and survival rate Proceedings of The 5th International Symposium

on Sturgeons pp 93, Ramsar, Iran, 9–13 May.

Sugita, H., Tokuyama, K & Deguchi, Y (1985) The intestinal

microflora of carp Cyprinus carpio, grass carp Ctenopharyngodon

idella and tilapia Sarotherodon niloticus Bull Jap Soc Sci Fish.,

51, 1325–1329.

Torrecillas, S., Makol, A., Caballero, M.J., Montero, D., Robaina,

L., Real, F., Sweetman, J., Tort, L & Izquierdo, M.S (2007)

Immune stimulation and improved infection resistance in

Euro-pean sea bass (Dicentrarchus labrax) fed mannan oligosaccharides.

Fish & Shellfish Immunol., 23, 969–981.

Van Loo, J., Cummings, J., Delzenne, N., Franck, A., Hopkins, M.,

MacFarlane, G., Newton, D., Quigely, M., Roberfroid, M., Van

Vliet, T & Van den Heuvel, E (1999) Functional food properties

of non-digestible oligosaccharide: a consensus report from the ENDO project (DGXII AIRII-CT94–1095) Br J Nutr., 81, 121–

132.

Williot, P., Sabeau, L., Gessner, J., Arlati, G., Bronzi, P., Gulyas,

T & Berni, P (2001) Sturgeon farming in Western Europe:

recent developments and perspectives Aqua Liv Reso., 14, 367–

short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short- short-.

Aquaculture Nutrition 17; 498–504  2011 Blackwell Publishing Ltd

We assessed effects of feed restriction and inclusion of

200 g kg)1 extracted soybean meal in the diet on gene

expression in Atlantic salmon using a cDNA microarray

(SFA2.0) and real-time qPCR The trial lasted for 54 days

Restricted feeding and soybean inclusion reduced the thermal

growth coefficient by respectively 51% and 22% compared

with fish fed with the fishmeal-based control diet to satiation

Soybean decreased distal intestinal expression of lysosomal

(cathepsins C, D, L, Y and Z) and extracellular proteases

while genes involved in responses to cellular stress were

up-regulated Expression changes of immune genes suggested

both pro- and anti-inflammatory regulation The hepatic

responses to soybean and restricted feeding were highly

similar, which could be because of negative effects of soybean

meal on digestion and nutrient absorption We observed

up-regulation of ribosomal proteins and down-regulation of

genes involved in lipid and steroid metabolism Of note,

growth reduction in both study groups was associated with

coordinated down-regulation of genes involved in oxidative

and cellular stress responses, metabolism of xenobiotics and

protein degradation High expression of stress-related genes

in salmon fed with the control diet suggests that maximum

growth rates can be associated with health problems

restricted feeding, soybean meal

Received 30 April 2010, accepted 25 August 2010

Correspondence: S Skugor, Nofima, P.O Box 5003, A˚s, Norway 1432,

Norway E-mail: stanko.skugor@nofima.no

Success of commercial Atlantic salmon aquaculture presumesproduction of large size fish in relatively short time periods.Rapid growth of fish is essential; retardation of growthcauses heavy economical losses Growth rate is a highlycomplex trait, determined with a combination of geneticmerit, health and physiological status of fish, multiple envi-ronmental factors and nutrition Reduced growth rates offarmed fish are observed periodically and often remainunexplained (Pickering 1993) Aquaculture requires tools toassess possible reasons for decreases in growth rates, and thisneeds comparative studies of responses to different stressors

We report results of a pilot experiment that assessed geneexpression profiling in order to study the growth decreasecaused by nutritional interventions: restricted feeding andpartial replacement of fish meal by soybean meal

Growth rate is negatively affected by food deprivation atall levels of reduction In mammals and birds, restrictedfeeding rapidly initiates metabolic changes similar to thosecaused by fasting (Wang et al 2006) Ectotherms are char-acterized with much greater tolerance to nutrient deprivationthan mammals and birds, and even protracted periods ofcomplete food absence do not cause irreversible changes inteleost fish (Olivereau & Olivereau 1997) Compared withother vertebrates, the severity of nutrient deprivationrequired for the initiation of adaptive responses in fish issubstantially higher, but responses are similar (Meton et al.1999; Wang et al 2006) Soybean meal is extensively used as

a substitute for high-quality fish meal in feeds for aquaculturespecies The replacement of fish meal with soybean products,however, causes adverse impacts on growth and nutrientretention, which have not found complete explanation todate The extent of negative effects depends on the content ofthe soybean protein, level of inclusion and treatment applied

.

2011 17; 505–517

. doi: 10.1111/j.1365-2095.2010.00832.x

Aquaculture Nutrition

for elimination of anti-nutritional factors (Francis et al 2001;

Barrows et al 2007) Soybean products may contain antigens

causing intestinal damage and compounds that interfere with

the digestive processes in fish, including phytic acid,

pro-teinase inhibitors, agglutinin lectins, oligosaccharides,

non-starch polysaccharides and isoflavones (Francis et al 2001)

Soybean causes moderate inflammation (enteritis) in the

distal intestine associated with infiltration of T cells, however

with no apparent effect on digestive enzymes

(Bakke-McKellep et al 2007a,b) High levels of soybean decrease

appetite and feed intake, which can be attributed to inferior

palatability or intestinal dysfunctions (Refstie et al 1998)

It remains unknown if negative effects of caloric restriction

and soybean products on salmon growth involve similar or

different molecular mechanisms

We report the gene expression changes in the liver and

distal intestine of Atlantic salmon The salmonid fish cDNA

microarray SFA2.0 (Krasnov et al 2005; Jorgensen et al

2008) has been used in a large number of experiments that

included various stressors Comparison of results produced

in this and previous studies searched for responses specific for

nutritional interventions The study also aimed at better

understanding of growth retardation caused with soybean

meal The distal intestine was included in analyses to assess

tissue lesions and their possible consequences Comparison

of the hepatic gene expression profiles addressed the question

if responses to soybean were similar or different from those

caused with restricted feeding The microarray results were

verified with real-time qPCR

Two iso-nitrogenous diets, a control diet based on fish meal

and a soybean meal diet containing 430 g kg)1 fish meal

and 200 g kg)1 extracted soybean meal, were manufactured

by Nofima Ingrediens (Fyllingsdalen, Bergen, Norway)

(Table 1) The diets were extruded (Wenger TX 52, Sabetha,

KS, USA), and the feed particle size was 3 mm The diets

were analysed for dry matter (DM) (105C, until constant

weight), crude protein (N· 6.25; Kjeltec Auto System,

Tecator, Ho¨gana¨s, Sweden), crude lipid after HCl hydrolysis

(Soxtec HT6; Tecator) and ash (550C, overnight)

Two months before the start of the trial, Atlantic salmon

(Salmo salar L.) were individually tagged (Passive Integrated

Transponder, Trovan Ltd., UK) At the start of the trial, the

fish were fasted for 2 days, individually weighed

(297 ± 28 g, mean ± SD), and then groups of 59 fish were

randomly distributed to each of three 1-m2tanks The tankswere supplied with seawater (11.7 ± 1.2C) and weredesigned to accommodate collection of waste feed from theeffluent water in wire mesh boxes The fish were held undercontinuous light and were fed using automatic band-feedersfor 54 days Two tanks of fish were fed with either the con-trol or soybean diet, in excess One additional tank was fedwith the control diet at a level approximating 40% of theintake of the full-fed group to achieve half as much weightgain The waste feed was collected daily, and approximatefeed intake for each tank was calculated by taking intoaccount the waste feed level and the percentage recovery ofdry matter from the diet in the system (Helland et al 1996)

The rations were adjusted every 3 days based on intake level

After the trial, the waste feed was analysed for DM contentand actual feed intake for each tank was recalculated Thetanks were checked daily for dead fish The oxygen satura-tion level for all tanks was maintained over 85% Watertemperature was measured daily At the end of the growthtrial, the fish were individually weighed After 12 further days

of feeding, individuals with growth rates similar to theaverage within their respective group were selected for geneexpression analyses The study groups were designated as CF(control diet, full ration), CR (control diet, reduced ration)and SF (soybean diet, full ration)

Relative feed intake, % body weight (BW) per day:

100· [dry feed intake (FI)] · [(BW0+ BW1)/2])1· (days

Table 1 Formulation and chemical composition of the experimental diets

3 Norsildmel, Bergen, Norway.

4 Felleskjøpet Øst-Vest, Vaksdal, Norway.

5 As described by (Mundheim et al 2004).

.

Aquaculture Nutrition 17; 505–517  2010 Blackwell Publishing Ltd

fed))1, where BW0 and BW1 are initial and final body

weights, respectively

Thermal growth coefficient (TGC): 1000· (BW1

1/3–

BW01/3)· (P

T))1, whereP

T is the sum day-degrees Celcius(Iwama & Tautz 1981)

The salmonid fish microarray (SFA2) includes 1800 unique

clones printed each in six spot replicates The complete

composition of the platform and sequences of genes are

provided in submission to NCBI GEO Omnibus (GPL6154)

Tissue samples were stored in RNALater (Ambion, Austin,

TX, USA) Total RNA from tissue was extracted with

TRIzol and purified with Pure Link (Invitrogen, Carlsbad,

CA, USA) Individual samples of distal intestine (SF, n = 5)

and liver (CR and SF, n = 5 each) were hybridized to CF

(pooled control; equal contribution from six fish); one

microarray was used per sample Test and control RNA

(20 lg in each sample) were labelled with Cy5-dUTP and

Cy3-dUTP (GE Healthcare, Uppsala, Sweden), respectively

The fluorescent dyes were incorporated in cDNA using the

SuperScript Indirect cDNA Labeling System (Invitrogen)

The cDNA synthesis was performed at 46C for 3 h in a

20-lL reaction volume, followed by RNA degradation with

0.2 M NaOH at 37C for 15 min and alkaline neutralization

with 0.6 M Hepes Labelled cDNA was purified with

Mi-crocon YM30 (Millipore, Bedford, MA, USA) The slides

were pretreated with 10 g kg)1 BSA fraction V, 5· SSC,

1 g kg)1 SDS (30 min at 50C), washed with 2 · SSC

(3 min) and 0.2· SSC (3 min) and hybridized overnight at

60C in a cocktail containing 1.3 · DenhardtÕs, 3 · SSC,

3 g kg)1SDS, 0.67 lg lL)1 polyadenylate and 1.4 lg lL)1

yeast tRNA After hybridization, slides were washed at room

temperature in 0.5· SSC and 1 g kg)1 SDS (15 min),

0.5· SSC and 0.1 g kg)1 SDS (15 min), and twice in

0.06· SSC (2 and 1 min, respectively) Scanning was

per-formed with GenePix4100A, and images were processed with

GenePix 6.0 (Molecular Devices, Sunnyvale, CA, USA) The

spots were filtered by criterion (I-B)/(SI + SB)‡ 0.6, where

I and B are the mean signal and background intensities and

SI and SB are the standard deviations Low-quality spots

were excluded from analysis and genes presented with less

than three high-quality spots on a slide were discarded After

subtraction of median background from median signal

intensities, the log2-expression ratios (ER) were calculated

Lowess normalization was performed first for the whole slide

and next for twelve rows and four columns per slide

Sta-tistical analyses included two stages, assessing both technical

errors and biological variation First, differential expressionwas evaluated in each sample by difference from zero of themean log2-ER (six spot replicates per gene, StudentÕs t-test,

P <0.05) Genes with a technically significant differencefrom reference and ER > |1.4| in more than half of analysedindividuals were selected Next, biological variation wasanalysed in averaged spot replicates Differential expressionwas assessed with one-sample t-test or comparison of themean scores to a known value (log2-ER = 0 in control – CF,

P <0.05) and two-sample t-test was used for comparisonbetween SF and CR groups (P < 0.05) The mean log2-ERvalues were calculated for groups of functionally relatedgenes with similar expression profiles To find genes withpreferential responses to feeding stress, we compared pro-portions of samples with differential expression in this studywith results from 185 experiments in our gene expressiondatabase Differences were assessed with FisherÕs exactprobability (P < 0.05) Genes from several functional groupsshowed highly coordinated expression changes; these dataare reported as mean log2-ER The complete microarray dataare provided in the supplementary file

The cDNA synthesis was performed on 0.5 lg treated total RNA (Turbo DNA-free; Ambion, Austin, TX,USA) using TaqManGold Reverse Transcription kit (Ap-plied Biosystems, Foster City, CA, USA) and oligo dTprimers PCR primers (Table 2) were designed using VectorNTI (Invitrogen) and synthesized by Invitrogen The ampli-con lengths set to be between 50 and 200 bases were checked

DNAse-on 15 g kg)1agarose gel PCR efficiency was calculated fromtenfold serial dilutions of cDNA for each primer pair intriplicates Real-time PCR assays were conducted using 2·SYBRGreen Master Mix (Roche Diagnostics, Mannheim,Germany) in an optimized 12-lL reaction volume, using

1 : 10 diluted cDNA, with primer concentrations of 0.4–0.6 lM PCR was performed in duplicate in 96-well opticalplates on Light Cycler 480 (Roche Diagnostics, Mannheim,Germany) under the following conditions: 95C for 5 min(pre-incubation), 95C for 5 s, 60 C for 15 s, 72 C for 15 s(amplification), 95C for 5 s, and 65 C for 1 min (meltingcurve) 45 cycles were performed Relative expression ofmRNA was evaluated byDDCT Geometric average of eightreference genes selected by results of microarray analyses(18S rRNA, RNA polymerase II, eukaryotic translationinitiation factor 3 subunit 6, NADH dehydrogenase 1 alphasubcomplex subunit 8, 70 kDa peroxisomal membrane pro-tein, prostaglandine D synthase and NADH dehydrogenase

.

Table 2 Primers used for qPCR analyses

CAGTCCCACAAGCCCTGGTAGT

TTTGGATGTGGTAGCCGTTTCTC

ATGAGGGACCTTGTAGCCAGCAA Eukaryotic translation initiation factor 3 subunit 6, eIF3S6, CX040383 GTCGCCGTACCAGCAGGTGATT

CGTGGGCCATCTTCTTCTCGA NADH dehydrogenase 1 alpha subcomplex subunit 8, NDUA8, NM_001160582 TCTGTCGCTGGGAGGAGAAGGA