recombinant dna part h

l0 VECTORS FOR EXPRESSING CLONED GENES [1] TABLE I pPLEX-DIRECTED EXPRESSION OF HETEROLOGOUS SEQUENCES IN Escherichia coli Heterologous Detection method, expression product Host strain

Contributors to V o l u m e 217

Article numbers are in parentheses following the names of contributors

Affiliations listed are current

GIOVANNA F E R R O - L u z z 1 A M E S ( 3 2 ) , De-

partment of Molecular and Cell Biology,

Division of Biochemistry, University of

California, Berkeley, Berkeley, California

94720

SILV1A B~HRING (5), Institutfi~r Molekular-

hiologie, Abteilung Molekulare Zellge-

netik, D-Ill5 Berlin-Buch, Germany

VLADIMIR [ BARANOV (9), RiboGene, Inc.,

Hayward, California 94545

CARL A BATT (18), Department of Food

Science, Cornell University, Ithaca, New

York, 14853

JEAN-PAUL BEHR (41), Laboratoirede Chi

mie Gdndtique, Universitd Louis Pasteur,

CNRS URA 1386, F-67401 lllkirch, France

MARTIN W BERCHTOLD (8), lnstitut fiir

Pharmakologie und Biochemie, Universitiit

Ziirich-lrchel, Ch-8057 Zurich, Switzerland

MAX L BIRNSTIEL (42), Research Institute

of Molecular Pathology, A-I030 Vienna,

Austria

JOHN E BOYNTON (37), Department of Bot-

any, Duke University, Durham, North

Carolina 27706

|RENA BRONSTEIN (29), Tropix, Inc., Bed-

ford, Massachusetts 01730

LAKI BULUWELA (28), Department of BiD-

chemistry, Charing Cross and Westmin-

ster Medical School, London W6 8RF,

England

ZELING CAI (17), Department oflmmunol-

ogy, Mayo Clinic, Rochester, Minnesota

55905

CELESTE CANTRELL (31), Department of

Pharmacology, University of North Caro-

ix

lina, Chapel Hill, North Carolina 27599

RICHARD L CATE (29), Biogen, Inc., Cam- bridge, Massachusetts 02142

KARL X CHA1 (23), Department qf Bio- chemistry and Molecular Biology, Medi- cal University of South Carolina Charleston, South Carolina 29425

JULIE CHAO (23), Department of Biochemis- try and Molecular Biology, Medical Uni- versity of South Carolina, Charleston, South Carolina 29425

LEE CHAO (23), Department of Biochemis- try and Molecular Biology, Medical Uni- versity of South Carolina, Charleston South Carolina 29425

LIN CHEN (7), Department of Chemistry, Harvard University, Cambridge, Massa- chusetts 02138

YUNJE CHO (18), Field of Microbiology Cornell University, Ithaca, New York

14853

CHRISTOPHER COLECLOUGH (11), Depart- ment of Immunology, St Jude Children's Research Hospital, Memphis, Tennessee

38101

MATTHEW COTTEN (42), Research Institute

of Molecular Pathology, A-I030 Vienna Austria

RICHARD G H COTTON (19), Olive Miller Protein Laborato~, Murdoch Institute Royal Children's Hospital, Parkville Vic- toria 3052 Australia

HENRY DANIELL (38), Department of Bot- any and Microbiology, Auburn Univer- sit3", Auburn, Alabama 36849

BIMALENDU DASMAHAPATRA (10), Depart- ment of Antiviral Chemotherapy, Schering-Plough Research Corporation, Bloomfield, New Jersey 07003

X CONTRIBUTORS TO VOLUME 217

NORMAN DAVIDSON (33), Division of Biol-

ogy, California Institute o f Technology,

Pasadena, California 91125

ANTONIA DESTREE (39), Therion Biologics

Corporation, Cambridge, Massachusetts

02142

V J DWARK! (43), Vical Inc., San Diego,

California 92121

FRITZ ECKSTEIN (13), Abteilung Chemie,

Max-Planck-lnstitut fiir Experimentelle

Medizin, D-3400 GOttingen, Germany

CHRISTIAN W EHRENFELS (29), Biogen,

Inc., Cambridge, Massachusetts 02142

J VICTOR GARCIA (40), Department o f Vi-

rology and Molecular Biology, St Jude

Children's Research Hospital, Memphis,

Tennessee 38101

NICHOLAS W GILLHAM (37), Department

o f Zoology, Duke University, Durham,

North Carolina 27706

ALEXANDER N GLAZER (30), Department

o f Molecular and Cell Biology, Division of

Biochemistry and Molecular Biology,

University o f California, Berkeley, Berke-

ley, California 94720

MICHAEL M GOTTESMAN (4), Laboratory

o f Cell Biology, National Cancer Insti-

tute, National Institutes o f Health, Be-

thesda, Maryland 20892

RICHARD P HAUGLAND (30), Molecular

Probes, Inc., Eugene, Oregon 97402

STEFEAN N Ho (17), Department of Pa-

thology, Stanford University Medical

School, Stanford, California 94305

BERND HOFER (12), Abteilung Mikrobiolo-

gie, Gesellschaft far Biotechnologische

Forschung, D-3300 Braunschweig, Ger-

many

CHRISTA HORICKE-GRANDPIERRE (6), Ab-

teilung Genetische Grundlagen der Pflan-

zenziichtung, Max-Planck-lnstitut fiir

Ziichtungsforschung, D-5000 KOIn 30,

Germany

ROBERT M HORTON (17), Department o f

Biochemistry, Gortner Laboratories, Uni-

versity o f Minnesota, St Paul, Minnesota

55108

MICKEY C-T Hu (33), Department o f Ex- perimental Hematology, Amgen, Inc., Amgen Center, Thousand Oaks, Califor- nia 91320

TIM C HUFFArER (21), Section o f Bio- chemistry, Molecular and Cell Biology, Cornell University, Ithaca, New York

14853

HENRY D HUNT (17), Department o f Im- munology, Mayo Clinic, Rochester, Min- nesota 55905

ANDREW C JAMIESON (18), Melvin Calvin Laboratory, University o f California, Berkeley, California 94730

R JILK (22), Department of Biochemistry, College o f Agricultural and Life Sciences, University o f Wisconsin-Madison, Madi- son, Wisconsin 53706

SUSAN E KANE (4), City o f Hope National Medical Center, Duarte, California 91010

PETR KARLOVSKY (24), Institute of Plant Pathology, University o f GOttingen, D-3400 Gdttingen, Germany

DAVID C KASLOW (20), Molecular Vaccine Section, Laboratory o f Malaria Re- search, National Institute o f Allergy and Infectious Diseases, National Institutes

of Health, Bethesda, Maryland 20892

M P KREBS (22), Department o f Chemis- try, Massachusetts Institute o f Tech- nology, Cambridge, Massachusetts

02139

BIRGIT Kt)HLEIN (12), Max-Planck-lnstitut far Experimentelle Endocrinologie, D-3000 Hannover, Germany

ERIC LAI (31), Department o f Pharmacol- ogy, University o f North Carolina School

of Medicine, Chapel Hill, North Carolina

27599

ANDRE LIEBER (5), Abteilung Molekulare Zellgenetik, lnstitut fiir Moleku- larbiologie, D-1115 Berlin-Buch, Ger- many

JEAN-PHILIPPE LOEFFLER (41), lnstitut de Physiologie, CNRS URA 1446, F-67084 Strasbourg, France

CONTRIBUTORS TO VOLUME 217 Xi CARMEL M LYNCH (40), Targeted Genetics

Corporation, Seattle, Washington 98101

CHRISTOPH MAAS (6), Abteilung Genetische

Grundlagen der Pflanzenziichtung, Max-

Planck-lnstitut fiir Ziichtungsforschung,

D-5000 KOln 30, Germany

KURTIS D MACFERRIN (7), Department of

Chemistry, Harvard University, Cam-

bridge, Massachusetts 02138

KAYO MAEDA (1), European Molecular Bi-

ology Laboratory, Hamburg Outstation,

D-2000 Hamburg, Germany

ANNA MASR (39), Integrated Genetics,

Inc., Framingham, Massachusetts 01701

J C MAKRIS* (22), Lawrence Livermore

National Laboratory, Livermore, Cali-

fornia, 94551

ROBERT W MALONE (43), Department of

Pathology, University of California,

Davis Medical Center, Sacramento, Cal-

ifi~rnia, 95817

RICHARD A MATHIES (30), Department of

Chemistry, University of California,

Berkeley, Berkeley, California 94720

GAIL P MAZZARA (39), Therion Biologics

Corporation, Cambridge, Massachusetts

02142

A DUSTY MILLER (40), Program in Molecu-

lar Medicine, The Fred Hutchinson Can-

cer Research Center, Seattle, Washing-

ton 98104

DANIEL G MILLER (40), Program in Molec-

ular Medicine, The Fred Hutchinson Can-

cer Research Center, Seattle, Washing-

ton 98104

CESAR MILSTEIN (28), Medical Research

Council Laboratory of Molecular Biol-

ogy, Cambridge CB2 2QH, England

OWEN J MURPHY (29), Tropix, Inc., Bed-

ford, Massachusetts 01730

P L NORDMANN (22), Department of Mi-

crobiology, Biozentrum, University of Ba-

sel, CH-4056 Basel, Switzerland

DAVID B OLSEN (13), Merck Sharp and

Dohme, Research Laboratories, West

Point, Pennsylvania 19486

* Deceased

HENRig 0RUM (2), Department of Biochem- istry B, The Panum Institute, Research Center for Medical Biotechnology, Uni- versity of Copenhagen, DK-2200 Copen- hagen N, Denmark

GARY V PADDOCK (25), Department of Mi- crobiology and Immunology, Medical University of South Carolina, Charleston, South Carolina 29425

R PADMANABHAN (14), Department of Bio- chemistry and Molecular Biology, Uni- versity of Kansas Medical Center Kan- sas City, Kansas 66013

THOMAS L PAULS (8), lnstitutfiir Pharma- kologie und Biochemie, Universitdt Zt~- rich-lrchel, CH-8057 Zurich, Switzerland

LARRY R PEASE (17), Department of Immu- nology, Mayo Clinic', Rochester, Minne- sota 55905

HUNTINGTON POTTER (34), Department of Neurobiology, Harvard Medical School, Boston, Massachusetts 02115

LAgs K POULSEN (2), Department of Mi- crobiology, Denmark Technical Univer- sity, DK-2800 Lyngby, Denmark

ANNEMARIE POUSTKA (26, 27), lnstitut j'~r Virusforschung, Angewandte Tumorviro- logie, Deutsches Krebsforschungszen- (rum, D-6900 Heidelberg, Germany

JEFFREY K PULLEN (17), Department of Immunology, Mayo Clinic, Rochester Minnesota 55905

MARK A QUESADA (30), Department of Chemistry, University of California, Berkeley, Berkeley, California 94720

DAVID J RAWLINGS (20), Howard Hughes Medical Institute, University of Califor- nia, Los Angeles, Los Angeles, California

90024

W S REZNIKOFF (22), Department of Bio- chemistry, College of Agricultural and Life Sciences, University of Wisconsin- Madison, Madison, Wisconsin 53706

J A RUSSELL (36), Department of Horticul- tural Sciences, New York State Agricul-

xii CONTRIBUTORS TO VOLUME 217

tural Experiment Station, Cornell Univer-

sity, Geneva, New York 14456

HAYS S RYE (30), Department o f Molecular

and Cell Biology, Division o f Biochemis-

try and Molecular Biology, University of

California, Berkeley, Berkeley, California

94720

JENNIFER A SALEEBA (19), Department o f

Biological Science, Dartmouth College,

Hanover, New Hampshire 03755

VOLKER SANDIG (5), lnstitutfiir Molekular-

biologie, Abteilung Molekulare Zellge-

netik, D-1115 Berlin-Buch, Germany

J C SANFORD (36), Department of Horti-

cultural Sciences, New York State Agri-

cultural Experiment Station, Cornell Uni-

versity, Geneva, New York 14456

JON R SAYERS (13), School o f Biological

Science, University of North Wales, Ban-

gor, Gwynedd, Wales LL57 2DG

JEFF SCHELL (6), Abteilung Genetische

Grundlagen der Pflanzenziichtung, Max-

Planck-lnstitut fiir Ziichtungsforschung,

D-5000 KOln 30, Germany

STUART L SCr~REIRER (7), Department of

Chemistry, Harvard University, Cam-

bridge, Massachusetts 02138

JAMIE K SCOTT (15), Division o f Biological

Sciences, University o f Missouri, Colum-

bia, Missouri 65211

GEORG SCZAKIEL (1), Angewandte Tumor-

virologie, Deutsches Krebsforschungs-

zentrum, D-6900 Heidelberg, Germany

VENKATAKRISHNA SHYAMALA (32), Chiron

Corporation, Emeryville, California 94608

JOHN R SIMON (35), Department o f Biologi-

cal Chemistry and Laboratory of Bio-

medical & Environmental Sciences, Uni-

versity of California School o f Medicine,

Los Angeles, California 90024

F D SMITH (36), Department o f Horticul-

tural Sciences, New York State Agricul-

tural Experiment Station, Cornell Univer-

sity, Geneva, New York 14456

GEORGE P SMITH (15), Division of Biologi-

cal Sciences, University o f Missouri, Co-

lumbia, Missouri 65211

WOLFGANG SOMMER (5), lnstitut far Mole- kularbiologie, Abteilung Molekulare Zellgenetik, D-Ill5 Berlin-Buch, Ger- many

ALEXANDER S SPIRIN (9), Institute o f Pro- tein Research, Academy of Sciences,

142292 Pushchino, Moscow Region, Rus- sia

HANS-HENNING STEINBISS (6), Abteilung Genetische Grundlagen der Pflanzen- ziichtung, Max-Planck-lnstitut far Ziich- tungsforschung, D-5000 KOln 30, Ger- many

MICHAEL STRAUSS (5), Max-Planck Group

of the Humboldt University, Max- Delbriick Center for Molecular Medicine, D-I 115 Berlin-Buch, Germany

MICHAEL P TERRANOVA (7), Department of Chemistry, Harvard University, Cam- bridge, Massachusetts 02138

RICHARD TIZARD (29), Biogen, Inc., Cam- bridge, Massachusetts 02142

REINHARD TOPFER (6), Abteilung Genetis- che Grundlagen der Pflanzenziichtung, Max-Planck-lnstitut far Ziichtungsfors- chung, D-5000 KOln 30, Germany

SHIGEZO Ut)AKA (3), Department o f Food Science and Technology, Faculty o f Agri- culture, Nagoya University, Nagoya 464, Japan

GREGORY L VERDINE (7), Department of Chemistry, Harvard University, Cam- bridge, Massachusetts 02138

INDER M VERMA (43), Molecular Biology and Virology Laboratory, The Salk Insti- tute, San Diego, California 92186

JOHN C VOYTA (29), Tropix, Inc., Bedford, Massachusetts O1730

ERNST WAGNER (42), Research Institute of Molecular Pathology, A-I030 Vienna, Austria

MARY M Y WAYE (16), Department of Bio- chemistry, Chinese University o f Hong Kong, Hong Kong

M WEINREICH (22), Department o f Bio- chemistry, College of Agricultural and Life Sciences, University of Wisconsin- Madison, Madison, Wisconsin 53706

CONTRIBUTORS TO VOLUME 217 Xlll

T WIEGAND (22), Department of Biochem-

istry, College of Agricultural and Life Sci-

ences, University of Wisconsin-Madison,

Madison, Wisconsin 53706

LAI-CHu W c (28), Davis Medical Center,

Departments of Medical Biochemistry

and Internal Medicine, The Ohio State

University, Columbus, Ohio 43210

HIDEO YAMAGATA (3), Department of Food

Science and Technology, Faculty of Agri-

culture, Nagoya University, Nagoya 464,

Japan

C YUNG YU (28), Departments of Pediat-

rics and Medical Microbiology and lm-

munology, The Ohio State University and Children's Hospital Research Founda- tion, Columbus, Ohio 43205

STEPHEN YUE (30), Molecular Probes, Inc., Eugene, Oregon 97402

Q.-X ZHANG (14), Department of Biochem- istry and Molecular Biology, University of Kansas Medical Center, Kansas City, Kansas 66103

L.-J ZHAO (14), Department of Biochemis- try and Molecular Biology, University of Kansas Medical Center, Kansas City, Kansas 66103

[1] E coli EXPRESSION PLASMID pPLEX 3

E coli from nonspliceable mRNAs, the peptide sequence of expressed molecules is defined exactly, that is, they are monoclonal For many studies, monoclonal polypeptides are of great advantage in comparison with protein preparations from natural sources, which may consist of numerous closely related but not identical isoforms Escherichia coli is one of the best studied organisms and many well-established methodolo- gies used in molecular biology can be applied to modify and handle vectors and coding sequences 1,2

Polypeptides of interest can be expressed in E coli as fusion proteins, usually extended at the amino terminus with prokaryotic portions intended

to provide increased translational initiation, stability, solubility, alterna- tive purification protocols, and yield, or to allow secretion Fusion proteins can be used for immunological studies, such as the production of antisera,

or as antigens in enzyme-linked immunosorbent assay (ELISA) or Western analysis However, their use in other studies, for example, those concern- ing enzymatic activities and three-dimensional structures, is limited, espe- cially in the latter case, where the expression of nonfusion proteins is desirable

The necessary elements that an expression plasmid should supply are an origin of replication, a dominant selection marker for plasmid propagation and maintenance, and transcriptional (promoter) and transla-

L T Maniatis, E F Fritsch, and J Sambrook, "Molecular Cloning: A Laboratory Manual." Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1982

2 F M Ausubel, R Breut, R E Kingston, D, D Moore, J G Seidman, J A Smith, and

K Struhl, "Current Protocols in Molecular Biology." Wiley, New York, 1987

Copyright © 1993 by Academic Press, Inc

4 VECTORS FOR EXPRESSING CLONED GENES [1] tional initiation sites (Shine-Dalgarno sequence and start codon), as well

as termination signals for translation and transcription Transcription di- rected by strong promoters can down-regulate plasmid replication, which may result in the loss ofplasmid For this reason transcription from strong promoters usually needs to be terminated by efficient transcriptional termi- nators,

A number of other parameters for successful expression of heterolo- gous eukaryotic sequences in E coli must be considered and tested: (1)

DNA sequence and primary and secondary structure of the transcript in the vicinity of the start codon, 3 (2) codon usage, 4 (3) possible toxicity of expression products for E coli, (4) posttranslational modifications, (5)

RNA editing of eukaryotic sequences in the homologous system, 5'6 which does not occur in E coli, and (6) evaluation of the ability of expressed

portions of proteins to form defined structures The techniques for pro- karyotic gene expression have been described in detail 7

h ci857 repressor,10 which is active at the permissive temperature of 28 ° but

is inactive at 37 or 42 ° The gene coding for the ci857 repre s sor can be plasmid encoded or can be integrated into the host cell chromosome (e.g., E coli

strain N F 1) The translational control elements, that is, the ribosomal bind- ing site and stop codons in all three reading frames as well as unique cloning sites in between, are indicated in Fig 1

Materials and Methods

Escherichia coli Strains

(cro-F-A-J-b2 )

3 H A De Boer and A S Hui, this series, Vol 185, p 103

4 p M Sharp and W.-H Li, Nucleic Acids Res 15, 1281 (1987)

5 L Simpson and J Shaw, Cell 57, 355 (1989)

6 A M Weiner and N Maizels, Cell 61, 917 (1990)

7 D V Goeddel, this series, Vol 185, p 3

8 G Sczakiel, A Wittinghofer, and J Tucker, Nucleic" Acids Res 15, 1878 (1987)

9 E Remaut, P Stanssens, and W Fiers, Gene 15, 81 (1981)

l0 M Lieb, J Mol Biol 16, 149 (1966)

ii H.-U Bernard, E Remaut, M V Hershfield, H K Das, D R Helinski, C Yanowsky,

and N Franklin, Gene 5, 59 (1979)

[1] E coli EXPRESSION PLASMID p P L E X 5

(130)

I CCATr~GTC GAC AAG CTT AC;TTAACTOATCA

in a dam- E coli strain An additional AccI site located on the pBR322 sequence that is present in the original plasmid pPLEX but was filled in with Klenow fragment and nucleotide triphosphates, that is, it was destroyed in pPLEXAcc • (J Tucker, unpublished observations, 1986.)

6 VECTORS FOR EXPRESSING CLONED GENES [1]

W6 (origin not known): s u - , cI (wild type)

supE44 galK2 h- sulA27 hisG4 rpsL31 xyl-5 mtl-1 thi-1

Cloning

Methods of recombinant DNA technology are essentially performed

integrated into its chromosome The wild-type repressor is able to shut off the PL promoter efficiently, thus allowing stable replication and high copy numbers of recombinant pPLEX-derived constructs In principle an

E coli strain harboring the thermolabile ci857 repressor is also suitable at

the permissive temperature of 28°; however, the clearly decreased growth rate at this temperature seems to be a disadvantage

For induction of the PL promoter, E coli host strains N F I and unc1959,

both containing a cI857-carrying plasmid, are used Transformation of

E coli cells is performed following the CaCI2 method 13 for W6 and NF1

or the protocol developed by Hanahan 14 for DH2/6 The transformation yields for 1 /xg of p P L E X DNA with freshly prepared bacteria are in the range of 5 × 105 for W6 and 1 × 106 for NF1 The transformation frequency after storage of transformation-competent cells in 5% (v/v) glycerol at

- 7 0 ° is decreased by a factor of approximately 10

Induction o f hPL Promoter

The protocol for the induction of the hPL promoter of E coli strains

carrying p P L E X constructs is depicted schematically in Fig 2 As an alternative way of induction of the LMM expression plasmid pEXLMM74

a temperature shift to 42 ° may be performed for 15 min with subsequent incubation at 37 ° for 4 hr To raise the temperature quickly to 42 ° for large volumes (e.g., 10 liter), an appropriate amount of fresh medium preheated

to 60 ° is added On induction, suppression of the htR terminator results in

transcription of a bicistronic m R N A consisting of the heterologous open

reading frame and the coding sequence for galactokinase Thus, an in- crease in galactokinase activity monitors efficient hpL-directed tran- scription

12 Obtained from B Bachman, E coli Genetic Stock Centre, New Haven, Connecticut I3 M Mandel and A Higa, J Mol Biol 53~ 159 (1970)

14 D Hanahan, J Mol Biol 166, 557 (1983)

[1] E coli EXPRESSION PLASMID pPLEX 7

Grow 1 ml overnight culture of

E coli strain NF1 transformed with pPLEX construct in medium (standard I or L-broth supplemented with 100 p.g/ml ampiciUin) at 28 °

$ Inoculate 1 ml of fresh medium with 10/xl of dense overnight culture

Incubate for 1 hr at 28 °

$ Divide culture in two 0.5-ml aliquots

4 hr, 28 ° 4 hr, 28 ° (uninduced control) (induced control)

Protein analysis Protein analysis FIG 2 Protocol for the induction of the PL promoter-driven expression cassette of pPLEX In analysis of expression products by SDS-polyacrylamide gel electrophoresis induced cultures have higher cell densities, i.e., protein concentrations, than do control cultures grown at 28 °

Analysis o f Expression Products

Soluble Protein Fraction Escherichia coti cells are h a r v e s t e d b y cen- trifugation (30 sec, r o o m t e m p e r a t u r e , 7000 r p m , E p p e n d o r f centrifuge) and the cell pellet is r e s u s p e n d e d with 1 ml 50 m M T r i s - H C l ( p H 7.4) After centrifugation the pellet is r e s u s p e n d e d vigorously in 0.5 ml lysis buffer containing 50 m M T r i s - H C l ( p H 7.4), 0.5 m M dithioerythritol (DTE), 0 I m M p h e n y l m e t h y l s u l f o n y l fluoride (PMSF), and 1 m M ethyl-

Sodium Dodecyl Sulfate-Soluble Proteins Escherichia coli cells are spun d o w n b y centrifugation (30 sec, r o o m t e m p e r a t u r e , 7000 r p m ,

E p p e n d o r f centrifuge), the cell pellet is r e s u s p e n d e d o n c e with 1 ml o f 50

m M Tris-HC1 ( p H 7.4), and cells are centrifuged again (30 sec, r o o m

8 VECTORS FOR EXPRESSING CLONED GENES [1] temperature, 7000 rpm, Eppendorf centrifuge) The cell pellet is resus- pended in 1 × sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) sample buffer [3 x sample buffer: 62.5 mM Tris-HCl (pH 6.8), 15% (v/v) glycerol, 2.5% (w/v) SDS, 5% (v/v) 2-mercaptoethanol, and 0.001% (v/v) bromphenol blue] and boiled for 5 rain to lyse cells Hot samples are applied to polyacrylamide gels by using a Hamilton syringe

Proteins Soluble in 8 M Urea 8 M urea-soluble fraction contains

expression products that form so-called inclusion bodies: stable aggregates

of partially denatured and partially structured particles, held together mainly by hydrophobic interactions However, inclusion bodies do not necessarily have to be insoluble (For a review of solubilization of inclusion bodies and subsequent renaturation see Ref 15.)

Examples for Use o f pPLEX

Figure 3 describes the expression of a subfragment of rabbit fast skele- tal muscle myosin, that is, a 74-kDa portion of light meromyosin (LMM), which is a structural domain of the myosin heavy chain, a component of myosin The quaternary structure of LMM is assumed to be a coiled coil formed by two molecules.16 The structure of the recombinant LMM74 is similar to that of the native protein, as indicated by electron microscopy 17 Moreover, recombinant LMM74, like native LMM, can be enriched by high-salt solubilization with 0.5 M KC1 and precipitation by dialysis with low-salt buffers (for details, see the caption to Fig 3) This property of LMM74 makes it feasible to use this LMM fragment for the generation of fusion proteins with the possible advantages listed above and, in addition, these fusion proteins could be enriched or purified by the high/low-salt method described here [e.g., LMM/human immunodeficiency virus 1 (HIV-1) Tat fusion proteins18]

It should be mentioned that the smaller (-64-kDa) band in Fig 3 is a product of internal initiation and not a result ofprotease-mediated degrada- tion of LMM74.17 This phenomenon might be of general importance, be- cause it is reasonable to assume that there is no selection pressure against prokaryotic regulatory elements in sequences of higher eukaryotic cells (e.g., cDNA) Other examples for the use of pPLEX to express heterolo-

gous open reading frames in E coli are listed in Table I

15 R Rudolph, in " M o d e r n Methods in Protein- and Nucleic Acid Research" (H Tschesche, ed.), p 149 de Gruyter, Berlin, 1990

16 C Cohen and D A D Parry, Proteins 7, 1 (1990)

17 K Maeda, G Sczakiel, W Hofmann, J.-F Menetret, and A Wittinghofer, J Mol Biol

205, 269 (1989)

~8 V Wolber, K Maeda, R Schumann, B Brandmeier, L Wiesmiiller, and A Wittinghofer, Biotechnology 10, 900-904 (1992)

[1] E coli EXPRESSION PLASMID p P L E X 9

FIG 3 Expression of a portion of a rabbit fast skeletal muscle light meromyosin (LMM)

by use of p P L E X analyzed by SDS-polyacrylamide gel electrophoresis and immunoblotting Bacterial extracts were collected and enriched fractions of recombinant LMM were applied

to a 10% (w/v) polyacrylamide gel [U K Laemmli, Nature (London) 227, 680 (1970)] and

either stained with Coomassie Blue (A) or blotted onto nitrocellulose and reacted first with

a polyclonal rabbit anti-myosin antibody, then with horseradish peroxidase-conjugated goat anti-rabbit immunoglobulin G (Sigma, St Louis, MO) according to the method of Towbin,

T Staehlin, and J Gordon Proc Natl Acad Sci U.S.A 76, 4350 (1979) (B) Lanes numbered

from 1 to 7 contain the following samples: total lysate of E coli strain NF1 transformed with

pPLEX and grown at 28 ° (lane 1) and at 42 ° (lane 2); total lysate of NF1 transformed with

p E X L M M 74 (cDNA coding for a 74-kDa portion of the rabbit skeletal muscle LMM inserted into pPLEX) and grown at 28 ° (lane 3) and after induction for 1, 3, and 5 hr at 42 ° (lanes 4

to 6, respectively); LMM74 after two cycles of high-salt and low-salt buffer as described below (lane 7) Bacterial extracts, that is, soluble proteins, were prepared following the scheme outlined in Fig 2 For enrichment of expressed LMM (see lane 7) bacteria were harvested by centrifugation after a 5-hr induction at 42 ° and washed once with 50 mM Tris- HCI (pH 7.5) Subsequently the cell pellet was lysed After addition of sodium deoxycholate, KCI was added (final concentration, 0.6 M) The lysate was further incubated for 15 min at room temperature and was centrifuged The supernatant was dialyzed overnight against

10 mM potassium phosphate (pH 6.5) containing 0.1 M KCI After dialysis the precipitate was pelleted by centrifugation and dissolved in 10 mM potassium phosphate (pH 6.5) contain- ing 0.6 M KC1 Insoluble proteins were separated again by centrifugation and the cycle was repeated once w;th the supernatant

l0 VECTORS FOR EXPRESSING CLONED GENES [1]

TABLE I pPLEX-DIRECTED EXPRESSION OF HETEROLOGOUS SEQUENCES IN Escherichia coli

Heterologous Detection method,

expression product Host strain isolation Reference Wheat Rubisco (ribulose-bisphosphate N4830-1

carboxylase), small subunit and NF1

Spinach Rubisco activase, two UT421

isoforms (41 and 45 kDa)

Human papillomavirus type 16, E7 NF1 and

Portions of rabbit skeletal muscle light NFl

meromyosin (74 and 59 kDa)

Portion of human cardiac/3-myosin NFI

heavy chain (subfragment l, amino

acid residues 1-524)

Western analysis a Purified proteins b Western analysis c Western analysis c Western analysis d Purified protein e Western analysis f

M A Kaderbhai, M He, R B Beecbey, and N Kaderbhai, DNA Cell Biol 9, 11 (1990)

b j B Shen, E M Orozco, and W L Ogren, J Biol Chem 266, 8963 (1991)

c I Jochmus and L Gissmann, personal communication (1991)

d A Bartholomeusz and P J Wright, personal communication (1991)

e K Maeda, G Sczakiel, W Hofmann, J.-F Menetret, and A Wittinghofer, J Mol Biol 205, 269 (1989)

f M Pfordt, Ph.D thesis, University of Heidelberg, 1991

C o n c l u d i n g R e m a r k s a n d Discussion

F i g u r e 3 a n d T a b l e I list e x a m p l e s f o r the u s e o f the e x p r e s s i o n p l a s m i d

p P L E X C e r t a i n l y f o r p P L E X , a n d p r e s u m a b l y f o r o t h e r e x p r e s s i o n v e c - tors as well, t h e r e h a v e b e e n a fair n u m b e r o f u n s u c c e s s f u l a t t e m p t s to

e x p r e s s h e t e r o l o g o u s p r o t e i n - c o d i n g s e q u e n c e s in E coli T h e p a r a m e t e r s

g e n e r a l l y listed u n d e r T r o u b l e s h o o t i n g (below) are helpful; h o w e v e r , o f t e n the s e a r c h f 6 r i m p r o v e m e n t s r e m a i n s empirical

Critical p a r a m e t e r s f o r s u c c e s s f u l p r o d u c t i o n o f p P L E X - e n c o d e d p r o - teins i n c l u d e t h e c o n d i t i o n s o f i n d u c t i o n , that is, the time p e r i o d a n d

t e m p e r a t u r e o f h e a t s h o c k B e c a u s e the i n d u c t i o n o f the )kpL p r o m o t e r

u s u a l l y is m e d i a t e d b y a t e m p e r a t u r e shift to 42 °, the h e a t - s h o c k r e s p o n s e

o f E coli cells, w h i c h is a c c o m p a n i e d b y i n d u c e d e x p r e s s i o n o f E coli

p r o t e a s e s , 19 c a n a f f e c t the stability o f e x p r e s s e d p r o t e i n s In addition

19 D W Mount, Annu Rev Genet 14, 279 (1980)

[1] E coli EXPRESSION PLASMID pPLEX 11 the time period of induction determines the accumulation of expression products, which has a crucial effect on yields and the physical form of the expression products In some instances high intracellular concentrations

of expressed polypeptides lead to a high potential of formation of insoluble inclusion bodies, whereas low intracellular concentrations result in a higher probability of leaving the expression products in a soluble form Alternative expression systems for the production of eukaryotic poly- peptides (baculovirus and yeast systems, and eukaryotic tissue culture cells) can circumvent some of the fundamental critical points for expres-

sion in E coli as summarized above, particularly posttranslational modifi- cations (e.g., glycosylation) However, expression in E coli is still one of

the most reasonable ways to mass produce structural and enzymatically active polypeptides

One of the more recent improvements of pPLEX was the insertion of

additional restriction sites (XbaI, BamHI, SmaI, KpnI, and SstI) between the SalI and BclI sites, creating the modified vector pPLEXI9 2°

Troubleshooting

Troubleshooting should include codon usage; secondary structure around start codon (mutations); clonal variability, that is, testing a larger number of transformants; internal translational start sites; and different

E coli strains (e.g., protease-deficient ones, such as unc1857)

When heterologous expression products are known to be toxic for

E eoli expression, products can be obtained with expression vector sys-

tems that allow almost complete shut-off of the promoter In this regard the hPc promoter has an advantage over many other widely used promot-

ers, for example, tacp, trcp, or lacp However, expression systems offer- ing expression cascades (e.g., T7pol-T7 promoter zl) might be alternatives

Acknowledgments

We thank B Miiller for mapping pPLEX restriction sites

20 j B Shen, E M Orozco, and W L Ogren, J Biol Chem 266, 8963 (1991)

21 F W Studier and B A Moffatt, J Mol Biol 189, 113 (1986)

12 VECTORS FOR EXPRESSING CLONED GENES [2]

in vitro gene fusion several vector systems have been developed that carry

multiple cloning sites in any of the three reading frames 2 When the gene

of interest has been cloned and sequenced, the desired gene fusion can usually be made by choosing the appropriate vector and restriction site Alternatively, when there are some means of detecting the gene product, for example, by antibodies, the DNA can be randomly inserted into an expression vector and the clones expressing the desired product identified

by subsequent screening with the antibody Often, neither the sequence

of the gene nor an assay for its product is available In these cases gene fusions can be selected by using vectors known as ORF vectors (open reading frame vectors) 3

ORF vectors utilize the fact that the lacZ gene-encoded fl-galactosidase

enzyme is usually active when an additional polypeptide is inserted near its N terminus Thus, when an open reading frame DNA fragment is

inserted near the 5' end of the lacZ gene, the correct fusion (a tripartite

gene) will have a Lac ÷ phenotype whereas the incorrect fusions will be

L a c - To confer the Lac ÷ phenotype, the DNA insert must contain an

ORF and be in frame with the lacZ gene at both its 5' and 3' ends Thus,

to secure in-frame cloning of a DNA fragment of defined length (i.e., generated by restriction enzyme cleavage) nine different ORF vectors are required Clearly, handling nine different vectors to make an in- frame cloning is impractical Instead, a single ORF vector is used and in-frame cloning is facilitated by size randomizing the DNA insert prior to cloning

We discuss here a novel in-frame cloning principle that simplifies in- frame cloning of DNA fragments of defined length to involve a single vector

I T J Silhavy and J R Beckwith, Microbiol Rev 49, 398 (1985)

2 p H Pouwels, B E Enger-Valk, and W J B r a m m e r , "Cloning Vectors: A L a b o r a t o r y

M a n u a l " Elsevier, A m s t e r d a m , 1985

3 G M Weinstock, Genet Eng 6, 31 (1984)

Copyright © 1993 by Academic Press, Inc

[2] IN-FRAME GENE FUSION 13

l-"BssXl I-~

rBssHll I r-B,s,X~l -i ] GCGCGCGCGC CGCGCGCGCG

REARING F R A M E l REARING F R A M E 3 [,, REARING F R A M E 2 i

FIG 1 The digestion patterns of the BssHlI box The sequence GCGCGCGCGC [(GC)5] contains three overlapping BssHIl restriction sites, each corresponding to one of the three

reading frames Because cleavage at any one site destroys the two other sites, a particular (GC) 5 box can be cleaved only once

Materials

All chemicals and apparatus referred to in this chapter are commer-

and Stratagene (La Jolla, CA)] all enzymes were obtained from Boehringer Mannheim (Indianapolis, IN) T4 DNA ligase was purchased in two con- centrations [1 unit(U) and 8 U//zl] for use in sticky-end and blunt-end ligation reactions, respectively Escherichia coli strains DH5a and JM 109 were used as hosts

Principle of Method

The restriction enzyme BssHII recognizes and cleaves the alternating sequence GCGCGC and generates 4-b protruding 5' termini Conse- quently, the alternating sequence, GCGCGCGCGC [(GC)5], contains three

ing to one of the three different reading frames (see Fig I) When contained

in a vector, the (GC)5 motif is cleaved at an approximate ratio of 2 : 1 : 2, resulting in a mixture of vectors carrying cloning sites in all three reading frames 4 Thus, by using either one or two (GC)5 boxes, vectors can be

4 H 0 r u m and L K Poulsen, Nucleic Acids Res 17, 3107 (1989)

14 VECTORS FOR EXPRESSING CLONED GENES [2]

FIG 2 Schematic representation of the ORF vector plFF8 The sequence of the 5' part

of the lacZ-c~ gene including the lacZ initiation codon, the ORF multiple cloning site, the two (GC)s boxes, the NotI site, and the SPG and T7 promoters are shown Pt,c designates the lacZ promoter The vector carries the /~-lactamase gene (bla), conferring resistance to

[2] IN-FRAME GENE FUSION 15

promoter and the lacZ a fragment Inserted near the 5' end of the lacZ ct fragment are two (GC) 5 BssHII recognition boxes that allow cleavage

randomization at two cloning points In the previous vector, plFF5, a 1.2- kilobase (kb) fragment was inserted between the two (GC)5 boxes to avoid the possibility that close proximity of these boxes would prevent cleavage

at some of the BssHII sites In plFF8 this spacer fragment is replaced by

a multiple cloning site that has two features: (1) it does not contain stop

codons in any of the three reading frames; and (2) it restores the lacZ

reading frame, giving the plFF8 vector a Lac ÷ phenotype As discussed

in Procedure 1.2 (below), these new features facilitate in-frame cloning by

an indirect procedure To allow verification of selected clones, the plFF8

vector further carries a unique NotI site located upstream of the 5'-most

(GC)5 box (Section 4) Furthermore, the vector contains an SP6 and T7 promoter sequence that allows transcription through the multiple cloning site

Methods

1 Preparation of Vector for In-Frame Cloning

The pIFF8 vector can be used to select open reading frames in DNA/

cDNA fragments carrying BssHII-compatible sticky ends (fragments gen- erated by BssHII and/or MluI cleavage) or blunt ends To prepare the vector for either type of cloning, it is first cleaved with BssHII to produce

the nine possible cloning combinations It is important that the vector sample is totally cleaved at this step because residual uncleaved pIFF8 will give rise to false positives in subsequent transformation/plating (both the desired recombinant pIFF8 vector as well as the pIFF8 vector itself

have a Lac + phenotype) After cleavage with BssHII, the vector is treated

with calf intestinal phosphatase (CIP) to remove the terminal 5'-phosphate groups This treatment prevents the vector from recircularizing without insert and thus eliminates yet another source of false positives ( - 3 5 % of recircularized pIFF8 vectors will have a Lac + phenotype) If blunt-ended DNA fragments are to be cloned, the vector is further treated with Klenow

polymerase in the presence of all four dNTPs to fill in the BssHII sticky

Procedure 1.1: BssHII Cleavage Mix 10 tzg of vector (purified by CsCI

gradient centrifugation) and 50 U of BssHII enzyme in a 100-tzl reaction

16 VECTORS FOR EXPRESSING CLONED GENES 12]

containing 25 mM NaCI, 6 mM Tris-HCl, pH 7.4, 6 mM MgCI2, and 5 mM dithiothreitol (DTT) Overlay the reaction with a drop of paraffin oil and incubate 3 hr at 50 ° Place the reaction on ice; remove a 3-/zl aliquot ( - 0 3 /zg of vector) and analyze the extent of cleavage by electrophoresis through

a 1% TAE (tris-acetate-ethylenediaminetetraacetic acid) agarose gel using appropriate DNA size markers If more than one vector band is observed,

add more BssHII enzyme and continue the incubation When the cleavage

is complete, extract twice with phenol and chloroform and precipitate the DNA with 1/10 vol of 2.5 M sodium acetate, pH 5.2, and two vol of 96% ethanol for 30 min at - 2 0 ° Recover the DNA by centrifugation at 12,000 g for 30 min at 4 ° and redissolve in 20 ~1 of TE [I0 mM Tris CI,

pH 8.0 and I mM ethylenediaminetetraacetic acid (EDTA)]

Procedure 1.2: Phosphatase Treatment Mix the BssHII-cleaved

vector and 3 U of CIP enzyme in a 50-/xl reaction containing 50 mM Tris-HCl, pH 9.0, 1 mM MgCI 2, 1 mM ZnC12, and 1 mM spermidine Incubate at 37 ° for 30 min, add an additional 2 U of CIP enzyme, and continue the incubation for another 30 min Add 5 tzl of STE buffer (100 mM Tris C1, pH 8.0, 1 M NaCI, and I0 mM EDTA), 5/zl of 10% (w/v) sodium dodecyl sulfate (SDS), and 40 ~1 of distilled water Incubate 15 min at 70 °, extract with phenol and chloroform, and precipitate the D N A as above Redissolve the vector in TE buffer to a final concentration of 50 ng//zl (usually between 150 and 200/~1) Store

the vector at - 2 0 ° to prevent evaporation Note: It is advisable to test

the efficiency of the dephosphorylation step by trying to recircularize the vector in the absence of added insert To do this, set up a "vector alone" standard ligation (Section 2, procedure 2.1 without target DNA)

and transform and plate competent E coli cells as described in Section

3, procedure 3.1 Optimally, there should be no colonies on the plate Usually, however, even properly dephosphorylated vector preparations give rise to several colonies If there are many colonies on the plates and these are predominantly blue (Lac+), the problem relates to incomplete

cleavage with the BssHII enzyme (uncleaved plFF8 vector is Lac÷)

In contrast, if the main part of the colonies are white (Lac-), the problem relates to the dephosphorylation step (about 65% recircularized vectors are L a c - )

Procedure 1.3: Filling-In Reaction Mix I0/zg of BssHII-cleaved/de-

phosphorylated vector and 5 U of Klenow polymerase in a 100-/zl reaction containing 50 mM Tris-HC1, pH 8.0, 10 mM MgCI 2 , 100 mM NaCI, and 0.5 mM dATP, dCTP, dTTP, and dGTP Incubate at 23-25 ° for 30 min, heat to 70 ° for 10 min, extract with phenol and chloroform, and precipitate the vector as above Dry and redissolve the vector in TE buffer to a

[2] IN-FRAME GENE FUSION 17

final concentration of 100 ng//zl (-75-100/xl) Store at - 2 0 ° to prevent evaporation

2 Preparation and Cloning o f DNA Fragments

Any of several reliable methods can be used to prepare DNA/cDNA for cloning in pIFFS For direct in-frame cloning in pIFF8 (prepared as above) the foreign DNA fragment must carry either BssHII-compatible ends or blunt ends There are presently only two enzymes (BssHII and MluI) that will provide BssHII-compatible sticky ends and the recognition

quently, it may not be possible to locate the gene of interest to a BssHII

and/or MluI-generated DNA fragment of a size suitable for cloning In

contrast, there is a whole range of enzymes that will generate blunt ends and as such it will usually be possible to locate the gene of interest in a properly sized blunt-ended fragment

Alternatively, the DNA fragment of interest can be cloned in frame by

a simple, indirect procedure First, the DNA fragment is cloned into one

of the several unique restriction sites in the ORF multiple cloning site of

recombinant to be selected by its L a c - phenotype Second, purified vector from the selected L a c - clone is cleaved with BssHII, extracted with

phenol and chloroform, precipitated with ethanol, and religated using T4 DNA ligase (Section 2, procedure 2.3) This ligation shuffles the BssHII-

excised insert/vector fragments, with the result that a subset of inserts are brought in frame with the lacZ gene Clones containing these vectors can

then be selected by their Lac + phenotype When using the indirect in- frame cloning procedure as outlined above, self-circularization of vectors during the shuffling step will produce a background of false positives, that

is, Lac + vectors without insert As described in the following section, these vectors can often be distinguished from the desired recombinants

by the intensity of the blue color of the resulting colonies Alternatively, the BssHII-excised insert can be isolated by agarose gel electrophoresis

and cloned in a premade pIFF8 vector (Section l) to avoid the self- circularized vector background

The optimal conditions for ligating vector/DNA fragments carrying blunt ends or sticky ends are somewhat different We usually obtain a good result using the following conditions

Direct In-Frame Cloning

Procedure 2.1.: Ligation o f Vector and DNA Fragments with Sticky Ends Mix 100 ng of prepared vector (Section l) and target DNA in a molar

18 VECTORS FOR EXPRESSING CLONED GENES [2]

ratio of 1 : 3 with I U of T4 DNA ligase (1 U//A) in a 20-~1 reaction containing 50 mM Tris-HC1, pH 7.8, 5 mM MgCI2, 1 mM ATP, 20 mM DTT, and 50/.tg/ml of bovine serum albumin (BSA) Incubate for 4-16 hr

at 16 ° and store at - 2 0 ° until use

Procedure 2.2: Ligation o f Vector and DNA Fragments with Blunt Ends Mix 200 ng of prepared vector (Section 1) and target DNA in a molar

ratio of 1 : 3 with 12 U of T4 DNA ligase (8 U//A) (efficient blunt-end ligation requires a great deal ofT4 DNA ligase) in a 20-/xl reaction contain- ing 50 mM Tris-HCl, pH 7.8, 5 mM MgCI 2 , 1 mM ATP, 20 mM DTT, 5% (w/v) polyethylene glycol (PEG) 6000, and 50/xg/ml BSA Incubate for 4-16 hr at 23-25 ° and store at - 2 0 ° until use

Indirect In-Frame Cloning

Procedure 2.3: Shuffling of Vector and Insert Mix 100 ng of BssHII-

cleaved vector obtained from a L a c - clone with 1 U of T4 DNA ligase (1 U//xl) in a 20-/zl reaction containing 50 mM Tris-HCl, pH 7.8, 5 mM MgCI2, 1 mM ATP, 20 mM DTT, and 50/zg/ml of BSA Incubate for 4-16

hr at 16 ° and store at - 2 0 ° until use

3 Transformation and Selection of Recombinants

phenotype and therefore requires E coli strains carrying the lacZ AM15

gene as host; that is, E coli DH5a, XLl-blue, JM101-109, etc To prepare

the cells for transformation, we use the CaC1 method 5 or, where improved transformation efficiencies are required, the method of Hanahan 6

Procedure 3.1: Transformation Mix 100/xl of competent cells and

2/A of the ligation reaction in an Eppendorf tube and incubate on wet ice for 1 hr Place the tube in a water bath at 42 ° for 45 sec and return the tube

to the wet ice for 2 min Add 900/~1 of LB medium [1% (w/v) Bacto- tryptone, 0.5% (w/v) Bacto-yeast extract (Difco, Detroit, MI) 1% (w/v) NaCI, pH 7.5] and incubate the tube at 37 ° for 1 hr in a shaking incubator

To facilitate subsequent isolation of individual clones, plate 20- and 200- /A samples onto LB agar plates containing 0.5 mM isopropyl-~/-o-thioga- lactopyranoside (IPTG), 40/zg/ml 5-bromo-4-chloro-3-indolyl-fl-D-galac- topyranoside (X-Gal) and 50/zg/ml of ampicillin Incubate the plates (head up) overnight at 37 °

Following transformation and plating, one should in principle obtain

5 j Sambrook, E F Fritsch, and T Maniatis, "Molecular Cloning: A Laboratory Manual," 2nd Ed., pp 182-184 Cold Spring Harbor Laboratory, Cold Spring Harbor, New York,

1989

6 D Hanahan, in " D N A Cloning" (D M Glover, ed.), Vol 1, p 109 IRL Press, Washington, D.C., 1985

[2] IN-FRAME GENE FUSION 19 (1) white colonies (Lac-) containing vectors with either a DNA fragment that is not an ORF or an ORF DNA fragment inserted out of frame with

the lacZ gene and (2) blue colonies (Lac ÷) containing vectors with a

correctly fused ORF DNA Unfortunately, it is rarely as simple as that Thus, blue colonies may also contain (1) a vector with a DNA fragment

that is not in frame with the 5' end of the lacZ gene but contains a translation initiation site in frame with the 3' part of the lacZ ~ gene or (2) vectors without a DNA insert (caused by either insufficient BssHII cleav-

age or vector self-circularization) To show that an inserted DNA fragment contains an ORF, it must therefore subsequently be verified that Lac"

vectors contain the DNA insert and that translation initiates at the lacZ

translation start site In selecting a number of candidate clones for these analyses the color of the colonies may be of some help Thus, depending

on how the insert DNA affects transcription and/or translation of the tribrid gene/mRNA, affects folding and stability of the tribrid protein, and

so on, colonies containing the correct fusion will range in color from deep

to light blue (for a detailed discussion of factors affecting clonal color development, see Ref 3) Similarly, the blue color of colonies containing

a vector where translation initiates within the insert will depend on several factors, including how efficiently translation initiates within the insert In contrast, Lac ÷ colonies containing vectors without a DNA insert will always be deep blue Thus, when colonies exhibit different shades of blue one usually selects a number of clones from each group for further verification, with preference for those that are light blue

4 Verification of Selected Clones

To verify that the inserted DNA contains an ORF, the first step is to prepare a vector minipreparation from each of the selected clones For this we use the alkaline lysis method, which is both rapid and reliable 7 Next, purified vectors are digested with restriction enzymes followed by electrophoresis in agarose or polyacrylamide gels to determine which of

the vectors contain the correct insert Digestion with BssHII excises the

insert, thus allowing its size to be determined against coelectrophoresed

DNA size markers However, BssHII is an expensive enzyme and for this

reason the use of alternative restriction enzymes should be considered

For instance, combined digestion with EcoRI and NotI also excises the

insert Alternatively, when the size of the insert is such that vector plus insert can be distinguished from vector alone, any restriction enzyme that cleaves only once in the vector can be used (in this case several fragments

7 H C Birnboim and J Doly, Nucleic Acids Res 7, 1513 (1979)

20 VECTORS FOR EXPRESSING CLONED GENES [2]

E N D S - RELIGATE

TRIBRID GENE

mRNA TRRNSLATI ON STARTS WITHIN INSERT TRANSLATION STARTS RTlacZ 5" END

i l a c Z - ~ I TRIBRIO GENE

i

TRANSLATION STARTS : " ~ L a c ' l " WITHIN INSERT ~ - ~ " L a c - TRANSLATION STARTS

ATIacZ 5" ENn

F I 6 3 Schematic outline of the strategy to distinguish between translation initiation at the lacZ translation start site or from within the insert (A) The recombinant vector isolated from a Lac + clone; translation initiation at the lacZ translation start site or from within the insert both confers a Lac + phenotype on the host (B) Introduction of 4 bp between the lacZ

translation initiation site and the 5' end of the insert disrupts the lacZ reading frame read from the lacZ translation initiation site, but does not affect the reading frame initiated from translation start sites within the insert Thus the phenotype of vectors containing a correctly fused insert where translation initiates at the lacZ start site will change from Lac + to L a c - whereas incorrectly fused inserts will remain Lac +

may result from the digestion depending on whether target sequences for the enzymes are present in the insert or not)

Those vectors that contain the correct DNA insert are then analyzed

to distinguish between the possibility that translation initiates at the lacZ

translation start site or within the insert The rationale behind this analysis

is shown schematically in Fig 3 First, the selected vectors are digested with NotI Provided there are no NotI sites in the insert (NotI recognizes

an 8-bp DNA sequence and its target sequence is thus rare in DNA), this digestion linearizes the vector between the lacZ translation start site and

[2] IN-FRAME GENE FUSION 21

the 5' end of the D N A insert The NotI site is then filled in with Klenow

polymerase in the presence of all four dNTPs (Section 1, procedure 1.3) and the vector is recircularized using T4 D N A ligase (the ligation reaction

is similar to procedure 2.3 except that the reaction volume is increased to 100/xl to favor vector self-circularization) This treatment introduces 4 bp between the 5' end of the lacZ gene and the insert, thereby disrupting the lacZ reading frame read from the lacZ translation start site In contrast,

the lacZ reading frame read from any spurious translation start site within

the insert is not affected Thus, the phenotype of vectors containing the correctly fused insert will change from Lac + to Lac , whereas vectors that do not will remain Lac +

Examples

Selection of Open Reading Frames in DNA/cDNA

The pIFF series of vectors, and in particular pIFF8, are recent vector constructions and examples on experimental applications are therefore limited at present The pIFF5 vector has been used to select the ORF in

a 1.6-kb cDNA fragment encoding an internal part of the enzyme phenylal-

not contain an ORF, as evidenced by the lack of blue colonies, and this was later shown to be due to the presence of several small introns 8 The major difference between pIFF8 and pIFF5 is in the spacing of the two (GC)5 boxes In pIFF5, these boxes are separated by a 1.2-kb spacer fragment whereas in pIFF8 they are separated by a small ORF multiple cloning site To determine whether the decrease in spacing between the two (GC)5 boxes in pIFF8 would affect the pattern of BssHII cleavage,

pIFF8 was cleaved with BssHH and the small multiple cloning site frag-

ment purified from a 2% (w/v) agarose gel The purified fragment was then dephosphorylated with calf intestinal phosphatase, labeled with

labeled fragment into two unequal halves Finally, the labeled products were separated by electrophoresis in a polyacrylamide sequencing gel and autoradiographed Two sets of bands corresponding to cleavage at all

BssHII sites in the 3'-most (GC)5 box [31, 33, and 35 nucleotides (nt)] and

5'-most (GC)5 box (50, 52, and 54 nt) were detected on the film, showing that all BssHII sites in both (GC) 5 boxes were accessible to cleavage

Moreover, the bands corresponding to 33 and 52 nt were less intense than

8 j G Anson, H J Gilbert, J O Oram, and N P Minton, 58, 189 (1987)

22 VECTORS FOR EXPRESSING CLONED GENES [2]

the bands corresponding to 31, 35, 50, and 54 nt, supporting the previous observation that the center BssHII site in a (GC)5 box is cleaved less

close proximity of the two (GC)~ boxes in plFF8 does not have any

characteristics of previously described plFF vectors

Discussion

Applications and Limitations

This chapter has focused on the use of (GC)5 boxes in the construction

of gene-fusion vectors When applied to ORF vectors the system offers the major advantage that DNA fragments generated by restriction enzyme cleavage can be cloned in frame without the need for prior size randomiza- tion In addition to simplifying the use of ORF vectors in general, this feature potentially expands their uses For instance, information on possi- ble introns and a rough map of protein-coding domains in a cloned gene can be rapidly provided by subcloning specific restriction fragments in plFF8 and such information may be useful in setting up a sequencing strategy Likewise, provided a correctly fused ORF DNA insert is suffi- ciently large so that the ORF can be considered biologically significant, the reading frame can be established by sequencing through the vector/ insert junctions, and this knowledge is useful in subsequent interpretation

of sequencing data

As with other ORF vectors, the proper function of plFF8 requires that the lacZ-encoded part of the fusion protein retain enzymatic activity In plFF8, the foreign DNA is inserted into the small lacZ ~ gene, which

gene to produce the Lac ÷ phenotype Thus, compared to other ORF vectors that usually carry the entire lacZ gene, it may be expected that insertion of foreign ORF DNA fragments in plFF8 has a more pronounced effect on the Lac ÷ phenotype Consistent with this notion, insertion of a 1.6-kb pal cDNA fragment in plFF8 produced light blue colonies that,

entire lacZ gene This suggests that the functional limits of plFF8 can

be expanded by insertion of the entire lacZ gene On the other hand, when using the indirect in-frame cloning procedure, the present con- struction is probably advantageous in that a clear effect of the DNA insertions on the Lac ÷ phenotype allows an easier distinction between the desired recombinants and the false positives (i.e., vectors without insert)

advantage of B brevis over B subtilis, however, is a very low level of extracellular protease activity, so that secreted proteins are usually stable and not significantly degraded 1 For example, human a-amylase was secreted in quantities o f up to 60 mg/liter by B brevis, 2 whereas none was produced by B subtilis 3

Bacillus brevis 47 was isolated from soil as a protein-hyperproducing bacterium and was found to show little extracellular protease activity 1.4 The two main proteins secreted by B brevis 47 were indistinguishable from the two major proteins found in the outer two protein layers of the cell wall The major cell wall proteins (CWP) synthesized during the logarithmic phase of growth form hexagonal arrays on the cell surface During the early stationary phase of growth, the protein layers begin shedding concomitantly with a prominent increase in protein secretion 5 During the stationary growth phase, cells continue to synthesize and se- crete the cell wall proteins These proteins do not stay on the cell surface, but instead accumulate in the medium as extracellular proteins with con- centrations up to 20 g/liter of culture The amount of extracellular protein reaches more than twice that of intracellular proteins The genes coding for the major cell wall proteins (an outer wall protein and a middle wall

I H, Takagi, K Kadowaki, and S Udaka, Agric Biol Chem 53, 691 (1989)

2 H Konishi, T Sato, H Yamagata, and S Udaka, Appl Microbiol Biotechnol 34, 297

(1990)

3 T Himeno, T Imanaka, and S Aiba, F E M S Microbiol Lett 35, 17 (1986)

4 S Udaka, Agric Biol Chem 40, 523 (1976)

5 H Yamada, N Tsukagoshi, and S Udaka, J Bacteriol 148, 322 (1981)

Copyright © 1993 by Academic Press, Inc

24 VECTORS FOR EXPRESSING CLONED GENES [3l

protein) were cloned, and an operon (cwp) for cell wall protein genes was

f o u n d 6,7

Taking advantage of these characteristics of B brevis, we developed

a host-vector system for efficient production of heterologous proteins The 5' region of the cell wall protein gene containing the powerful promoter and the signal peptide-coding sequence is utilized to construct expres- sion-secretion vectors that are introduced into the protein-hyperproduc-

ing B brevis

Media and Reagents

T2U medium contains 10 g of polypeptone (Nihon Pharmaceutical, Tokyo, Japan; tryptone, Difco, Detroit, MI), 5 g of meat extract (Wako Pure Chemical Industries, Osaka, Japan), 2 g of yeast extract (Difco), 0.1

g of uracil, and 10 g of glucose per liter PM medium contains 20 g of polypeptone, 10 g of meat extract, 4 g of yeast extract, 0.1 g of uracil, and

10 g of glucose per liter and 2 mM CaC12 (pH is adjusted to 7 with NaOH) Solid medium contains 15 g of agar per liter Erythromycin (10/zg/ml) or neomycin (60/xg/ml) is added for the growth of plasmid-bearing bacteria MTP is prepared as follows: 20 ml of 0.1 M sodium maleate (pH 6.5), 10

ml of phosphate buffer [7% (w/v) K2HPO4 and 2.5% (w/v) KH2PO4)], and

18 ml of H20 are mixed and sterilized by autoclaving; after cooling the mixture, 2 ml of 1 M MgCI2 and 50 ml of T2U medium are added Polyethyl- ene glycol (PEG) solution is prepared by dissolving 40 g of PEG 6000 (average M r 7500) in 20 ml of 0.1 M sodium maleate (pH 6.5) and adjusting the volume to 100 ml with H20 TE contains 10 mM Tris-HCl (pH 8) and

1 mM disodium salt of ethylenediaminetetraacetic acid (EDTA) Steriliza- tion of all the solutions, except for antibiotics, is carried out by autoclaving

at 120 ° for 15 min

Host Bacterium

Bacillus brevis 47-5Q is derived from strain 47-5, which is a uracil-

requiring mutant of the wild-type 4 7 4 Strain 47-5Q generally shows one

or two orders of magnitude higher transformability and certain plasmids

are more stably maintained in this strain than in strain 47-5 Bacillus

brevis 47-5Q shows little protease activity in its culture supernatant This

bacterium hardly sporulates when cultured in ordinary media

6 H Yamagata, T Adachi, A Tsuboi, M Takao, T Sasaki, N Tsukagoshi, and S Udaka,

J Bacteriol 169, 1239 (1987)

7 S Tsuboi, R Uchihi, T Adachi, T Sasaki, S Hayakawa, H Yamagata, N Tsukagoshi, and S Udaka, J Bacteriol 170, 935 (1988)

[3] HETEROLOGOUS PROTEIN PRODUCTION BY B brevis 25 Preservation of Bacteria

Bacillus brevis cells, including those having plasmids, can be preserved

at or below - 80 ° in the presence of 20% (w/w) glycerol for several years Routinely, they may be maintained at room temperature on plates (T2 agar

is appropriate) by transferring every 2-3 weeks The bacteria will die at

4 ° It is advisable to keep cells harboring plasmids containing foreign genes

at or below - 80 °, becuase both plasmids and hosts tend to mutate so that they no longer produce the foreign proteins

Plasmids

pUB 1108 is a high-copy-number plasmid in B brevis, useful for over-

production of polypeptides from cloned genes The neomycin resistance gene on this plasmid can be used as a selective marker for transformation

However, B breois 47 spontaneously gives rise to mutants resistant to this

drug at a relatively high frequency, so that examination for the presence of the plasmid is necessary to distinguish transformants from the spontaneous mutants

pHWl 9 is a low-copy-nu.mber plasmid and is useful as a cloning vector, especially when products of the cloned gene are deleterious to the host cells Therefore, pHW 1 was used for cloning the genes encoding the middle

wall protein (MWP) and the outer wall protein (OWP) ofB brevis 47 The

erythromycin resistance gene (Em0 on this plasmid, originally found in

pE 194, is useful for selection of transformants because almost no spontane- ous erythromycin-resistant mutants appear under the standard transforma- tion conditions, pRU100 was constructed by inserting a multicloning site

derived from M13mpl9 between the EcoRI and PvulI sites of p H W l

Another series of vectors was constructed from a low-copy-number

cryptic plasmid, pWT481, found in B brevis 481 l° pHY481 was con-

structed by inserting the erythromycin resistance gene into pWT481 and

is stably maintained in B brevis 47 even in the absence of the selective

drug H Although pHY481 and its derivatives have not been used exten- sively to date, results suggest that these plasmids are useful for efficient protein production 6

8 T McKenzie, T Hoshino, T Tanaka, and N Sueoka, Plasmid 15, 93 (1986)

9 S Horinouchi and B Weisblum, J Bacteriol 150, 804 (1982)

10 H Yamagata, W Takahashi, K Yamaguchi, N Tsukagoshi, and S Udaka, Agric Biol Chem 48, 1069 (1984)

fl H Yamagata, K Nakagawa, N Tsukagoshi, and S Udaka, Appl Environ Microbiol 49,

1076 (1985)

VECTORS FOR EXPRESSING CLONED GENES [3]

CAATTTGTTTATACTAGAGGAG GAGAACACAAGGTTATGA AAAAGGTCGTTAACAGTGTA

GlnPheValTyrThrArgG-G-f~yGi'uIllsgysVa i Me t bys Lys V a l V a l A s n S e r Val

FIG 1 Structure of the expression-secretion vector pNU210 The closed bar indicates the 5' region of the mwp gene containing multiple promoters and the signal peptide-coding sequence The open bar indicates a multicloning site (MCS) The DNA and amino acid

[3] HETEROLOGOUS PROTEIN PRODUCTION BY B brevis 27 Preparation of Plasmid DNA from Bacillus brevis Cells

The method of Birnboim and Doly 12 can be used to obtain plasmid DNA This method can be scaled up to obtain large amounts of plasmid DNA and DNA can be purified by CsCl-ethidium bromide centrifugation 13

or adsorption to glass powder in a high-salt solution and elution with water (e.g., The GeneClean II kit; Bio 101, San Diego, CA)

Construction of Expression-Secretion Vector, pNU210

As described above, the cell wall proteins (OWP and MWP) are synthe- sized and secreted into the medium efficiently, even during the stationary phase of growth in B brevis 47 This suggested that the 5' region of

fragment containing the five tandem promoters, dual translation initiation sites, and the MWP signal peptide-coding region 6,14 was isolated and used

to construct expression-secretion vectors The structure of the one such expression-secretion vector thus far constructed, pNU210, is shown in Fig 1 pNU210 is a multicopy plasmid with the replication origin of pUB 110 and the Em r gene of pHWI The multicloning site on the plasmid

is convenient for the insertion of foreign genes to construct transcriptional fusion with the cwp operon or translational fusion with the 5' terminal

to the MWP signal peptide

An ApaLI or NcoI site located within the MWP signal peptide-coding region is useful for constructing transcriptional or translational fusions of the MWP gene with foreign genes (see Fig 1) By inserting the appropriate synthetic DNA fragment encoding the COOH-terminal portion of the

the foreign proteins directly fused with the MWP signal peptide can be

12 H C Birnboim and J Doly, Nucleic Acids Res 7, 1513 (1979)

~3 j Sambrook, E F Fritsch, and T Maniatis, "Molecular Cloning: A Laboratory Manual," 2nd Ed Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989

14 T Adachi, H Yamagata, N Tsukagoshi, and S Udaka, J Bacteriol 171, 1010 (1989)

sequences of these regions are shown in upper part of the figure Vertical arrows along the top of the DNA sequence indicate transcription start sites, 1 to 5 SD1 and SD2 are the ribosome-binding sites located upstream of the dual translation initiation sites (TTG at nucleotides 424 to 426 and ATG at nucleotides 517 to 519) The signal peptide-coding sequence

is underlined All restriction sites shown here, except HpaI, NcoI, MflI, and SacI, are unique

to pNU210

28 VECTORS FOR EXPRESSING CLONED GENES [3]

p B R 3 2 2 AGTGCACTCGCACTTACTGTTGCTCCCATGGCTTTCGCTGCAGGATCCGTCGAC

TCACGTGAGCGTGAATGACAACGAGGGTACCGAAAGCGACGTCCTAGGCAGCTG

AlaPheAla MWP Signal P e p t i d e ~ ~ ,MCS

FIG 2 Structure of pBR-AN3, used for making subconstructs in E coli The DNA having

the nucleotide sequence shown is inserted between the NruI and HindlII sites of pBR322

The sequence from the 5' terminus to the Pst! site encodes the COOH-terminal portion of

the MWP signal peptide Downstream from the cleavage site of the signal peptide is a multicloning site (MCS), the same as that inserted in pNU210 (Fig 1) The ampicillin resistance gene on pBR322 was replaced by that of pUC18 Therefore, all restriction sites shown above the DNA sequence except ApaLI are unique to pBR-AN3

synthesized and processed efficiently This results in accumulation in the medium of the foreign proteins with no additional amino acid residues at

their NH2 termini A PstI site located at the cleavage site of the MWP

signal sequence can also be used for the production of foreign proteins with the correct N H 2 terminus

To express genes efficiently, transcription termination is presumed to

be important However, when certain terminator DNA fragments, such

as that of a bacterial a-amylase gene, were inserted downstream from the foreign gene, no marked difference in gene expression was observed

Construction of Plasmid pBR-AN3 for Insertion of Foreign Genes

To construct a plasmid for the production of the heterologous protein

in B brevis, an Escherichia coli vector, pBR-AN3, useful for linking the foreign gene with the cell wall protein (MWP) signal sequence ofB brevis

47, was prepared (Fig 2) Construction procedures are as follows

1 Insert the foreign gene between the NcoI or PstI site and one of the multicloning sites (e.g HindIII) in pBR-AN3 The direction of transcrip- tion for the inserted D N A must be from the NcoI site to the HindIII site

In the case of the NcoI site, a synthetic linker may be used to connect the

[3] HETEROLOGOUS PROTEIN PRODUCTION BY B brevis 29 MWP signal sequence and the DNA encoding foreign mature protein This connection must be done so that the fused gene encodes exactly the same amino acid sequence as the mature foreign protein directly following the MWP signal peptide

2 Introduce the plasmid DNA thus prepared into competent cells of

E coli HB 101 (or any other appropriate strain) according to the standard method 13 Transformants are selected on LB agar plates containing 50

~g/ml ampicillin following incubation at 37 ° for one day

3 Purify the plasmid DNA from the transformant and digest it with

A p a L I and any enzyme of the multicloning site on pBR-AN3 After electro- phoresis on agarose gel, elute the DNA fragment containing the m w p -

foreign gene fusion and purify it by means of a glass powder method (e.g., The Gene Clean II kit; Bio 101, San Diego, CA) or electrophoresis

4 Ligate the DNA thus obtained to the large fragment of pNU210 generated by digestion with A p a L I and the enzyme used to cut the 3' flanking region of the foreign gene Use the ligated DNA to transform

B brevis 47-5Q From among transformants, select clones that produce foreign proteins

Transformation of Bacillus brevis

Tris-Polyethylene Glycol Method

The original method 15 was modified as follows

1 Take onto a toothpick a small amount ofB brevis 47-5Q cells grown

on a T2U plate, and inoculate it into 5 ml of T2U medium and grow overnight with shaking at 37 °

2 Dilute the overnight culture 100-fold in 5 ml of the same medium and incubate at 37 ° with vigorous shaking for 4 to 5 hr Alternatively, suspend fresh cells grown overnight on a T2U plate in 5 ml T2U medium with an initial OD660 of approximately 0.05 and incubate as above

3 The following steps must be done at room temperature At the logarithmic phase of growth (from middle to late, i.e., when the OD660 is 1.0-1.7), collect cells in a 30- to 50-ml screw-capped plastic centrifuge tube by centrifugation at 4000 g for 5 rain at room temperature (never cool) Wash the pellet at room temperature with 5 ml of 50 mM Tris-HCl,

pH 7.5 Resuspend the pellet in 5 ml of 50 mM Tris-HCl, pH 8.5, and incubate the cells for 30 to 60 min at 37 ° with slow shaking

15 W Takahashi, H Yamagata, K Yamaguchi, N Tsukagoshi, and S Udaka, J Bacteriol

156, 1130 (1983)

30 VECTORS FOR EXPRESSING CLONED GENES [3]

4 Spin as above and wash the cell pellet with 1 ml of MTP Spin again and resuspend the pellet evenly in 0.5 ml of MTP

5 Add plasmid DNA dissolved in less than 50/xl of TE or MTP to the cell suspension and mix well Quickly, add 1.5 ml of the PEG solution and immediately mix well without vigorous agitation Keep the mixture at room temperature for about 2 min with occasional gentle mixing Add 5

ml of MTP and mix well Collect the cells by centrifugation at 4000 g for

10 min at room temperature Suspend them in 1 ml of T2U medium containing 20 mM MgC12 and incubate at 37 ° for 2.5 hr with moderate shaking When erythromycin is used as a selective drug, it must be added

to a final concentration of 0.1 /~g/ml after 30 min of incubation

6 Spread aliquots (0.1-0.2 ml) of the culture on T2U agar plates containing the selective drug (I0/xg/ml of erythromycin or 60/xg/ml of neomycin) and incubate the plates at 30 or 37 ° Colonies should appear after about 2 days at 37 ° or after about 3 days at 30 ° Transformation of

B brevis with plasmids harboring a heterologous gene is often more suc-

cessful at 30 ° Some 104 to 105 transformants can be obtained when 1/zg

of intact pNU210 is used

Electroporation

inoculate it into 5 ml of T2U medium, and grow overnight with shaking at

37 ° Dilute the overnight culture 100-fold in 100 ml of the same medium and incubate at 37 ° with vigorous shaking for approximately 4.5 hr

2 At the early stationary phase of growth (the OD660 is approximately 3.5), chill the culture in an ice/water bath, and then collect cells in a 500-ml screw-capped plastic centrifuge tube by centrifugation at 4000 g for 5 min at 4 ° Wash the pellet at 4 ° with 200 ml of cold solution A, which contains 93 g of sucrose and 150 g of glycerol in 1 liter of 0.1 mM sodium phosphate buffer, pH 7.4 Then wash the cells with 100 ml and then with

4 ml of cold solution A Resuspend the washed cells in 0.5 ml of cold solution A Transfer 45 /~1 each of the cell suspension to small plastic centrifuge tubes Cool the tubes to - 7 0 ° in a dry ice-ethanol bath and stock them in a - 8 0 ° freezer (competent cells)

3 Take out the tube containing frozen competent cells and keep it cold Add plasmid DNA dissolved in less than 2 /.d of TE to the cell suspension and mix Transfer the cell suspension to a 0 l-cm cuvette of the Gene pulser apparatus (Bio-Rad, Richmond, CA) Set the apparatus

at 0.9 kV, 25/xF, and 200 l) After delivering the pulse, quickly add 1 ml

of cold T2U medium containing 20 mM MgCI2, keep it at 4 ° for 10 min, and then incubate at 37 ° with shaking for 2.5 hr Spread aliquots of the

[3] HETEROLOGOUS PROTEIN PRODUCTION BY B brevis 31

culture on T2U agar plates containing the selective drug Other details are similar to the procedure described above in the previous section The frequency is about 105 transformants//xg of DNA Salts in the plasmid DNA solution reduce the transformation frequency

Production of Heterologous Proteins

Clones that produce heterologous proteins of bacterial origin are ob- tained rather easily by the procedure described above On the other hand, transformants that efficiently produce mammalian proteins are found often

at a low frequency (sometimes very low) Mammalian proteins are often toxic to B brevis cells so that cells producing such a protein grow slowly

or die rather easily Therefore it is necessary to screen a large number of transformants for particular clones that are producing large amounts of mammalian protein Unless a special procedure to detect the heterologous protein is available, immunoassays are convenient for measuring the pro- tein productivity of clones Plates with transformants are covered with a sterile membrane (e.g., pure nitrocellulose membrane; Bio-Rad) for 1-3

hr After removal, the membrane is treated with antibody against the heterologous protein and processed for a color reaction using a standard protocol, t6 The area of the membrane corresponding to protein-producing colonies is stained The size of the stained halo varies depending on the extent of protein production and the type of protein Identified transfor- mants that produce the protein are immediately picked up from plates and grown on fresh plates After 1 day of growth at 37 ° (or 30°), cells are removed from the plates, resuspended in T2 medium plus 20% (w/w) glycerol, and stored at or below - 8 0 °

Several clones thus selected are examined by culturing in liquid me- dium to measure the amount of protein secreted The production efficiency for each protein varies greatly with the culture conditions, which include the medium composition and growth temperature Optimal conditions are unique for each protein and must be determined for efficient production

We found that varying the amounts of MgC12 and CaC12 in PM medium often allowed efficient protein production Also, the addition of glucose

to a final concentration of 3% (w/v) after 2 days of growth often improved the efficiency of protein production

Examples of Secretory Protein Production

system Most of the bacterial enzymes tested could be produced at a yield

32 VECTORS FOR EXPRESSING CLONED GENES [3]

of more than 1 g/liter For example, about 3 g/liter thermophilic a-amylase

of Bacillus stearothermophilus was secreted 17 On the other hand, produc-

tion of mammalian proteins was often much less efficient than that of bacterial proteins, although it was much more efficient than production by

other hosts such as B subtilis, E coli, and Saccharomyces cerevisiae So

far, among mammalian proteins, human epidermal growth factor (EGF) was the one most efficiently produced [0.24 g/liter ~8 and 1 g/liter (unpub- lished observations) Active human salivary a-amylase 2 and swine pepsin- ogen 19 were secreted up to 60 and 11 mg/liter, respectively High-level production of E G F and human a-amylase 2 was achieved only after exten- sive improvements were made mainly for the vector (use of a derivative

of pHY481) and host (mutant isolation), respectively

Certain animal proteins such as human interleukin 2 were secreted in large amounts (more than 50 rag/liter) only when the signal peptide was altered to become more hydrophobic (e.g., leucine tripeptide was inserted into the hydrophobic region of the MWP signal peptide)

Discussion of Problems

As described above, transformants that produce mammalian proteins are often found at a low frequency, probably because efficient production

of the proteins is toxic for bacterial cells One way to circumvent this

problem is to use B subtilis as an initial host In B subtilis, cwp promoters

direct only weak expression and hence the plasmid with the desired con-

struct tends to be stably maintained All B brevis vectors described here can replicate in B subtilis and the drug-resistance genes on the plasmids

can be used as selective markers A large amount of plasmid DNA can be

prepared from B subtilis transformants This DNA can be used to trans- form B brevis to obtain a large number of transformants

Even when positive transformants of B brevis are found, these cells

sometimes cannot maintain the correct plasmid Deletions of the foreign

gene or cwp promoter are frequently found Serial single-colony isolation

of positive clones is helpful Mutagenesis ofB brevis with N-methyl-N'-

nitro-N-nitrosoguanidine (NTG) prior to transformation is also helpful to obtain clones that can maintain the plasmid with the correct structure When clones maintaining the plasmid can be obtained but the amount

of foreign proteins produced is not large, mutants producing the protein

17 H Takagi, A Miyauchi, K Kadowaki, and S Udaka, Agric Biol Chem 53, 2279 (1989)

~8 H Yamagata, K Nakahama, Y Suzuki, A Kakinuma, N Tsukagoshi, and S Udaka,

Proc Natl Acad Sci U.S.A 86, 3589 (1989)

19 M Takao, T Morioka, H Yamagata, N Tsukagoshi, and S Udaka, Appl MicrobioL Biotechnol 30, 75 (1989)

[3] HETEROLOGOUS PROTEIN PRODUCTION BY B brevis 33

with improved yields can be isolated by mutagenesis of the clones with NTG

The procedures to mutagenize B brevis with NTG are as follows

1 Grow B brevis freshly in 5 ml of T2 medium at 30 ° with shaking until the OD660 is 0.6

2 Collect the cells by centrifugation for 5 min at 4000 g at room temperature and wash the cells with 5 ml of 200 mM phosphate buffer (KHzPO4-NaEHPO 4 , pH 6.4) and centrifuge again as above

3 Resuspend the cells in 0.5 ml of phosphate buffer containing 200 t~g/ml of NTG and incubate the cell suspension at 30 ° for 30 min

4 Wash the cells with 5 ml of phosphate buffer as above and resuspend the cells in 5 ml of T2 medium supplemented with 20 mM MgC12

5 Grow the cells for more than 3 hr at 30 ° with shaking After a 102-

to 104-fold dilution with T2 medium, spread 0.1 ml of the cell suspension

on an appropriate plate

Conclusion

Taking advantage of the unique characteristics of B brevis, which secretes large amounts of proteins into the medium but hardly any prote- ases, we have developed a novel host-vector system for efficient synthesis and secretion of foreign proteins The multiple promoters and the signal peptide-coding region of the gene for one of the major cell wall proteins

of B brevis 47 were used to construct expression-secretion vectors With this system, many bacterial proteins and human epidermal growth factor were efficiently secreted at yields of more than 1 g/liter The yield

of other mammalian proteins was less, but still l0 to 100 times higher than has been reported with other systems

In addition to the direct use of the produced proteins, this system should be useful for engineering proteins by random or localized mutagene- sis Because the active proteins are secreted efficiently into the medium, clones producing proteins of altered properties can be easily screened by direct assay of the culture medium

34 VECTORS FOR EXPRESSING C L O N E D GENES [4]

"foreign" and "heterologous" genes will be used interchangeably in this chapter to refer to cloned DNAs of interest that are to be expressed in tissue culture cells or in animals These DNAs generally do not have a selectable phenotype and must either be expressed transiently or cotrans- ferred into cells with a selectable marker For general reviews of gene expression and expression vectors, see Refs 1 and 2

Virus-based vector systems, such as retroviruses, vaccinia virus, and bovine papiUomavirus, have proved useful for both stable and transient gene expression Gene transfer can be efficient and reproducible with such viruses and infection of a variety of cell types is often possible Many plasmid vectors make use of strong promoter elements for high-level gene expression in transfected cells, and tissue-specific or inducible promoters allow expression under more controlled conditions

Amplifiable selection systems have been developed for stable overex- pression of foreign sequences, the most common of these being based on dihydrofolate reductase, which confers resistance to folate analogs This chapter will discuss the theory and applications of another such amplifiable selection system, based on the human multidrug resistance gene (MDR1),

and resistance to a variety of clinically relevant drugs, such as colchicine, adriamycin (doxorubicin) and vinblastine

Multidrug Resistance as Dominant Selectable Marker

The discovery that cultured cells could develop cross-resistance to multiple cytotoxic drugs led to the cloning of the mouse 3 and human 4 mdr

[4] M D R 1 GENE IN MAMMALIAN EXPRESSION VECTORS 35

cDNAs These cDNAs encode a 170,000-Da transmembrane glycoprotein that is an energy-dependent drug efflux pump known variously as P170, P-glycoprotein, or the multidrug transporter Increased expression of the multidrug transporter leads to resistance to a variety of cytotoxic drugs, including the anticancer drugs doxorubicin, daunorubicin, vinblastine, vincristine, VP-16, VM-26, actinomycin D, and taxol, and other cytotoxic agents such as colchicine, puromycin, emetine, ethidium bromide, and mithramycin Selections of increasing stringency (i.e., stepwise increases

in drug concentration) in any of these drugs results in cross-resistant cells

of amplification of this gene (for a review, see Ref 5)

The cloning of the cDNA for the multidrug transporter made it possible

to create retroviral expression vectors for the mouse 6 and human 7 cDNAs When introduced into drug-sensitive cells, these vectors confer the com- plete phenotype of multidrug resistance on these cells Virtually all cells, except those that are drug resistant to begin with, are susceptible to

selectable marker

An MDR1 cDNA was introduced into the germline of transgenic mice.S

In one line of MDRl-transgenic mice, P-glycoprotein is expressed on the surface of bone marrow cells, rendering these mice resistant to the mar- row-toxic effects of a variety of natural product anticancer drugs 9 Thus, the MDR1 cDNA is a good dominant selectable marker in vivo as well as

in vitro

of tissue culture cells, in retroviral transfer of foreign sequences, and in

by growth with a variety of cytotoxic drugs (see above) or by cell-sorting technology (see [14] this volume) Coexpression of heterologous coding sequences as well as antisense or catalytic RNA sequences can be achieved in a variety of cell types

5 S E Kane, I Pastan, and M M Gottesman, J Bioenerg Biomembr 22, 593 (1990)

6 p Gros, Y B Neriah, J M Croop, and D E Housman, Nature (London) 323, 728 (1986)

7 K Ueda, C Cardarelli, M M Gottesman, and I Pastan, Proc Natl Acad Sci U.S.A

84, 3004 (1987)

8 H Galski, M Sullivan, M C Willingham, K.-V Chin, M M Gottesman, I Pastan, and

G T Merlino, Mol Cell Biol 9, 4357 (1989)

9 G Mickisch, G T Merlino, H Galski, M M Gottesman, and I Pastan, Proc Natl Acad Sci U.S.A 88, 547 (1991)

36 VECTORS FOR EXPRESSING CLONED GENES [4]

Cotransfection and Coamplification

The most common application of MDR1 selection is in tissue culture transfection experiments MDR1 as a selectable marker was originally used in cotransfections, with MDR1 and foreign cDNAs carried on sepa- rate plasmids 1°'11 The MDR1 plasmid, called pHaMDR, has the human

MDR1 cDNA under the control of Harvey murine sarcoma virus long terminal repeats (LTRs) Foreign sequences on a separate plasmid can

be regulated by any transcription control elements Using transfection methods that lead to tandem integration of cotransfected sequences, selec-

tion for uptake and expression of MDR1 results in cell lines that also

express the foreign sequences with good efficiency Subsequent selection

for amplified expression of MDR1 allows coamplification of foreign gene

expression as well

A modification to pHaMDR places MDR1 and heterologous sequences

on the same plasmid molecule.12 The modified vector, termed pSK 1.MDR,

maintains MDR1 under control of retroviral LTRs and includes a simian

virus 40 (SV40) promoter and polyadenylation signal plus a unique cloning site for insertion of heterologous sequences This vector is efficient for

coexpression of MDR1 and foreign sequences and should be useful with

transfection methods that yield single-copy or multiple, unlinked integra- tions of the transferred sequences

The most commonly used selecting agent in transfection experiments

is colchicine because it is effective and inexpensive Colchicine disrupts microtubules and thus inhibits cell division Cells that are not multidrug resistant become multinucleated and eventually die in the presence of

colchicine, while those that take up and express MDR1 are resistant to

the drug By increasing the selective pressure (colchicine concentration)

on these cells, they must express progressively more MDR1 gene product

to remain drug resistant This is accomplished either by bona fide gene

amplification ~° or by enrichment for cells in a population that already

express high levels of MDR1 lz By either mechanism, the end result is a

cell line that is resistant to high concentrations of colchicine and that also expresses high levels of cotransferred foreign sequences

11 R Konig, G Ashwell, and J A Hanover, Proc Natl Acad Sci U.S.A 86, 9188 (1989)

12 S E Kane, D H Reinhard, C M Fordis, I Pastan, and M M Gottesman, Gene 84, 439

(1989)

[4] M D R 1 GENE IN MAMMALIAN EXPRESSION VECTORS 37 polyadenylation signal) is flanked by retroviral LTRs and the primary

M D R 1 transcript contains viral packaging signals near the 5' end The pHaMDR/A plasmid is transfected into retrovirus packaging cell lines, T M transfected cells are selected for resistance to colchicine, and virus con-

taining the M D R 1 coding sequences is isolated from the culture superna- tant This approach has been used to isolate virus with the human M D R 1 gene ~5 and, in a separate construction, with a mouse mdr gene ~6 These

viruses can infect and confer multidrug resistance on rodent, dog, and human cell lines in culture In addition, primary mouse bone marrow cells

have been infected in vitro with M D R I virus and multidrug resistant

granulocyte-macrophage progenitor colonies were subsequently isolated

by colchicine selection Bone marrow infected with the M D R 1 virus can reconstitute mice and form spleen foci containing M D R ! cDNA sequences

with a moderate efficiency 17

These results suggest that M D R ! can be used as a selectable marker

in a retroviral vector system To demonstrate that M D R 1 virus can also

be useful in cotransfer experiments, Germann et al constructed a fusion gene, with M D R 1 and human adenosine deaminase (ADA) coding se-

quences linked to encode a fusion protein of the two gene products 18,~9 When virus carrying the fusion gene is used to infect mouse fibroblasts, a bifunctional fusion protein is produced Thus, infected cells selected for

resistance to colchicine express M D R 1 and also express functional ADA ~9

The fusion protein is membrane associated in the drug-resistant cells,

consistent with the membrane localization of the M D R 1 gene product

acting as a multidrug transporter When transformed mouse cells are infected with the fusion gene virus, resulting drug-resistant cells can be

used to form tumors in nude mice Such tumors grow in vivo in the absence

of drug and maintain expression of the bifunctional fusion protein even when removed from the mouse and grown in culture without colchicine ~9 This work with MDR fusion proteins and retroviral gene transfer indi-

cates that the M D R 1 expression system has potential for use in mammalian

gene therapy and bone marrow transplantation studies It should also be possible to improve the retroviral vector either by encoding two distinct

~3 R Mann, R C Mulligan, and D Baltimore, Cell 33, 153 (1983)

14 A D Miller, M.-F Law, and I M, Verma, Mol Cell Biol $, 431 (1984)

15 I Pastan, M M Gottesman, K Ueda, E Lovelace, A V Rutherford, and M C Willing-

ham, Proc Natl Acad Sci U.S.A 85, 4486 (1988)

16 B C Guild, R C Mulligan, P Gros, and D E Housman, Proc Natl Acad Sci U.S.A

85, 1595 (1985)

~7 j R McLachlin, M A Eglitis, K Ueda, P W Kantoff, I H Pastan, W F Anderson,

and M M Gottesman, J Natl Cancer Inst 82, 1260 (1990)

~8 U A Germann, M M Gottesman, and I Pastan, J Biol Chem 2,64, 7418 (1989)

19 U A Germann, K.-V Chin, I Pastan, and M M Gottesman, FASEB J 4, 1501 (1990)