Molecular Biotechnology-Lession 3: Basic techniques in DNA technology ppt

 Polymerase Chain Reaction is widely held as one of the most important inventions of the 20th century in molecular biology..  Primers short DNA fragments containing sequences complemen

Molecular Biotechnology

Tran Ngoc Duc, PhD

VIETNAM NATIONAL UNIVERSITY AT HO CHI MINH CITY

INTERNATIONAL UNIVERSITY

Basic techniques in DNA

technology

1 Polymerase chain reaction (PCR)

2 Gel electrophoresis

3 Primer Design

4 RT-PCR

5 Digestion

6 Southern blot/Northern blot

7 Detectable signal based techniques

8 Site-directed mutagenesis

 Polymerase chain reaction

1 PCR and Primer Design

 Developed in 1983 by Kary Mullis

 Polymerase Chain Reaction is widely held as one of the most important inventions of the 20th century in

molecular biology Small amounts of the genetic

material can now be amplified to be able to a identify , manipulate DNA, detect infectious organisms, including the viruses that cause AIDS, hepatitis, tuberculosis,

detect genetic variations, including mutations, in human genes and numerous other tasks.

 Step 1: Denature DNA, 95oC, 5min

 Step 2: Annealing:

- Denature DNA, 950C, 30s-1min

- Annealing, 55-60oC, 1minStep 3: Extension, 70-72oC, 30s-1min

Go to step 2, 32 cycles

 Step 4: Holding, 4oC, 0s

 Exponentially amplifying a single or some piece of DNA generating thousands of million copies of DNA

 Total copies = 2n where n is the number of cycles to copy DNA

 So basically it is the cycles of heating and

cooling (thermal cycling)

 Applications of PCR

 DNA cloning

 DNA based phylogeny

 Functional analysis of gene

 Hereditary diseases

 Forensic sciences

 Infectious diseases

2 Gel electrophoresis

 A method for separating mixture of charged molecules

such as DNA, RNA or proteins under an electric field when

an electric field is applied to them

 The gel acts like a sieve for separation of molecules according to their sizes and electric charges

 Gel is made of agarose for separating large molecules of DNA, and of acrylamide for protein separation or small DNA or RNA

 Proteins, unlike nucleic acids, can have varying charges and complex shapes, therefore they may not migrate into the polyacrylamide gel at similar rates, or at all, when

placing a negative to positive on the sample

 In the case of nucleic acids, the direction of migration, from negative to positive electrodes, is due to the

naturally-occurring negative charge carried by their phosphate backbone

sugar- After the electrophoresis is

complete, the molecules in the gel can be stained to make them visible

Ethidium bromide, silver, or

Coomassie Brilliant Blue dye may be used for this process

 If the molecules to be

separated contain radioactivity

added for visibility, an

autoradiogram can be recorded

of the gel

 Protein electrophoresis

3 Primer design

 Step 1: Denature DNA, 95oC, 5min

 Primers (short DNA fragments) containing sequences complementary to the target region along with a DNA

polymerase

 Pair of primers should have similar annealing Ta,

which is usually 4-50C below Tm

 One primer is complementary to one end strand of DNA

 Primer length usually 18-24bp, shouldn’t be over 30

 GC, 40-60%

 Ta = (2AT+ 4GC) - 4

 Primer shouldn’t form hairpin or loop by themselves

 Ta of the 2 primers shouldn’t be big different

ATGCCCTCCACTTCCGGTGC GTCGCCCTTCCTCCCAGCAGCGCCAGCACTTGCCAG GCGGTGCAGTCGCGGCCCCAACGGCAGCAGCAGGCGGTGCAGCAGGGCGGTGCCAG GGCCTGCGCTGGAGGGGCGGAGCGCTGGAGGCAGCGTACGAGCGGTGTGGCGCGGT GTGCAAGGAGTACGCCAAGACCTTCTACCTGGGCACGCAGCTCATGACCCCCGTCC AGGCACGCTGCATCTGGGCCATCTACGTGTGGTGCAGGCGCACGGATGAGCTGGTG GATGGCCCTAATGCCTCCAAGATCACACCACAGGCCCT GGACCGGTGGGAGGAGCG

one-single strand DNA

 The actual (Tm) is influenced by the concentration of Mg2+, K+, and co-solvents There are numerous computer programs to assist in primer design

4 RT-PCR

 Reverse transcription polymerase chain reaction

(RT-PCR) is a variant of polymerase chain reaction (PCR)

mRNA

DNA

cDNA

Reverse transcriptase Taq DNA polymerase

 In RT-PCR, an RNA strand is first reverse transcribed into

its DNA complement (complementary DNA, or cDNA) using

the enzyme reverse transcriptase

One step reaction

Two step reaction

 Oligo dT(18) or Random Decamer Primers are used for the reverse transcription

 Oligo (dT)-18 Primer is suitable for use as a primer for first strand cDNA synthesis with reverse transcriptase The primer hybridizes to the poly(A) tail of mRNA

 Oligo (dT): TTTTTTTTTTTTTTTTT

 Decamer:

 Gene cloing

HL+ NuHL

18SNu

0h 6h 12h 24h 48h

 PSY1 expression analysis by RT-PCR

5 Restriction Enzyme/Digestion

 A restriction digest is a procedure used in

molecular biology to prepare DNA for analysis or other

processing It is sometimes termed DNA fragmentation

 There are numerous types of restriction enzymes, each

of which will cut DNA differently There are some that cut

a three base pair sequence while others can cut four,

six, and even eight

 NEBcutter: http://www.neb.com/nebecomm/default.asp

 Application:

o Ligation in cloning/DNA recombinant technology

o Gene detection using Southern blotting technique

o RFLPs (restriction fragment length polymorphism) analysis in taxonomy

6 Southern blot/Northern blot

 A method routinely used in molecular biology for detection of a specific DNA sequence in DNA samples

 The success of procedures is based on several facts:

 Nucleic acids can be readily isolated from organism

 Nucleic acids can be readily visualized and measured

 NA of an individual genome is so unique

 NA can be amplified to increase the amount of material available for analysis

1 Restriction digestion of genomic DNA.

2 Agarose gel electrophoresis

3 Denature DNA

4 Transfer ssDNA to membrane

5 Membrane baking

6 Hybridization

7 Wash and detection

 Procedure for a southern/northern blotting

 DNA denature

Denaturation is a process in

which proteins or nucleic acids lose their tertiary structure and secondary structure by

application of some external

stress or compound, such as a strong acid or base, a

concentrated inorganic salt, an organic solvent (e.g., alcohol or chloroform), or heat

 DNA transfer to membrane

 Upward

 Downward

 In a vacuum or regular oven at 80 °C for 2 hours (standard conditions; nitrocellulose

or nylon membrane) or exposed to

ultraviolet radiation (nylon membrane) to permanently attach the transferred DNA to the membrane

 Membrane baking

 Hybridization

 This is based on the property that complementary

nucleic acid strands will 'bind' to each other (hydrogen bond) and that these bonds can be broken by high

temperature (melting) and stabilised in solutions

containing salt (ionic strength) Therefore a small nucleic acid sequence (either a DNA or RNA molecule) can be

used as a probe to detect complementary sequences

within a mixture of different nucleic acid sequences

 A hybridization probe is a fragment of DNA or RNA of

variable length (usually 100-1000 bases long), which is used

in DNA or RNA samples to detect the presence of nucleotide sequences (the DNA target) that are complementary to the

sequence in the probe

 The labeled probe is first denatured (by heating or under

alkaline conditions such as exposure to sodium hydroxide) into single stranded DNA (ssDNA) and then hybridized to the

target ssDNA (Southern blotting) or RNA (northern blotting)

immobilized on a membrane or in situ

 To detect hybridization of the probe to its target sequence, the probe is tagged (or labelled) with a

molecular marker of either radioactive or (more recently) fluorescent molecules

 commonly used markers are 32 P (a radioactive

isotope of phosphorus incorporated into the

phosphodiester bond in the probe DNA) or

Digoxigenin , which is non-radioactive antibody based marker

-Typical applications include imaging of gels labeled with

radioactive isotopes, or with fluorescent or chemiluminescent probes The gel is attached to the film in a light-tight enclosure for the time period required to obtain the best results

The Interdepartmental Equipment Facility

Applications The system is designed for applications demanding high light

sensitivity such as documentation of ECL samples Enhanced chemiluminescence (ECL) is a blotting technique with detection limits in the picogram range The non- radioactive nature of ECL makes it more attractive than radioisotope techniques with similar sensitivity.

The Interdepartmental Equipment Facility

 Fluorescence is the emission of light by a substance that has

absorbed light or other electromagnetic radiation of a different

 A protein or other component can be "labelled" with a

extrinsic fluorophore, a fluorescent dye that can be a small

molecule, protein, or quantum dot, finding a large use in many biological applications

 A fluorophore, in analogy to a chromophore, is a

component of a molecule which causes a molecule to be

fluorescent It is a functional group in a molecule which will absorb energy of a specific wavelength and re-emit energy at

a different (but equally specific) wavelength The amount and wavelength of the emitted energy depend on both the

fluorophore and the chemical environment of the fluorophore

 Ethidium bromide and SYBR green are two fluorescence dye for staining DNA

 The green fluorescent protein (GFP) is a protein

composed of 238 amino acid residues (26.9kDa) that

exhibits bright green fluorescence when exposed to blue

 Fluorescence-based techniques are valuable tools for studying

cellular structure and function, and interactions of molecules in

biological systems Fluorescence is also important in the detection and quantitation of nucleic acids and proteins in gel electrophoresis, microarrays, and fluorescence spectroscopy

 With sophisticated microscopes and instruments, it is possible to detect, image, and measure the amount of fluorescence in samples

as small as individual cells, and with multiple fluorescent colors

http://www.invitrogen.com/site/us/en/home/support/Tutorials.html

 GFP

 Enzyme-linked immunosorbent assay (ELISA), also

known as an enzyme immunoassay (EIA), is a

biochemical technique used mainly in immunology to detect the presence of an antibody or an antigen in a sample

 Usually antigen is fixed to a surface Antibody is linked to

an enzyme which convert a substrate to a detectable signal either a color a fluorescence

 Common ELISA formats In the assay, the antigen of interest is

immobilized by direct adsorption to the assay plate or by first

attaching a capture antibody to the plate surface Detection of the antigen can then be performed using an enzyme-conjugated

primary antibody (direct detection) or a matched set of unlabeled primary and conjugated secondary antibodies (indirect detection)

8 Site directed mutagenesis

 Site-directed mutagenesis/ oligonucleotide directed

muatgenesis in which mutation is created at a desired site on DNA

 Simply done by designing a “mutated” primer, followed

by PCR

 Applications of site-directed muation:

o Changing amino acid

o Increasing/decreasing enzyme activity

o Modifying metal cofactor requirement

o Enzyme stability and specificity

(1) Cloning the DNA of interest into a plasmid vector.

(2) The plasmid DNA is denatured to produce single strands (3) A synthetic oligonucleotide with desired mutation (point

mutation, deletion, or insertion) is annealed to the target

region

(4) Extending the mutant oligonucleotide using a plasmid

DNA strand as the template

(5) The heteroduplex is propagated by transformation in E

coli.