Báo cáo khoa học: Protection of chylomicron remnants from oxidation by incorporation of probucol into the particles enhances their uptake by human macrophages and increases lipid accumulation in the cells ppt

Botham1 1 Department of Veterinary Basic Sciences, The Royal Veterinary College, London, UK;2Istituto Superiore di Sanita, Department of Hematology, Oncology and Molecular Medicine, Vial

Protection of chylomicron remnants from oxidation by incorporation

of probucol into the particles enhances their uptake by human

macrophages and increases lipid accumulation in the cells

Elizabeth H Moore1, Mariarosaria Napolitano2, Michael Avella1, Fatos Bejta1, Keith E Suckling3,

Elena Bravo2and Kathleen M Botham1

1

Department of Veterinary Basic Sciences, The Royal Veterinary College, London, UK;2Istituto Superiore di Sanita,

Department of Hematology, Oncology and Molecular Medicine, Viale Regina Elena, Rome, Italy;3Glaxo SmithKline,

Medicines Research Centre, Stevenage, Herts., UK

The effects of protection of chylomicron remnants from

oxidation on their uptake and induction of lipid

accumula-tion in macrophages were investigated using chylomicron

remnant-like particles (CRLPs) containing the lipophilic

antioxidant drug, probucol, and macrophages derived from

the human monocyte cell line, THP-1 The total lipid content

of THP-1 macrophages was markedly higher (·2.2) after

48 h of incubation of THP-1 macrophages with CRLPs

containing probucol (pCRLPs) when compared to CRLPs

without probucol, and this was because of increases in

tri-acylglycerol (·2.3) and cholesterol (·1.8) levels, while

cho-lesteryl ester concentrations were not significantly changed

Determination of the uptake of CRLPs and pCRLPs by the

cells using particles labelled with the fluorescent probe

1,1¢-dioctadecyl-3,3,3¢3¢-tetramethylindo-carbocyanine

perchlo-rate showed that pCRLPs are taken up at a faster perchlo-rate than

CRLPs The synthesis of triacylglycerol, as measured by

the incorporation of [3H]oleate and [3H]glycerol, was also

increased in macrophages incubated with pCRLPs as

compared to CRLPs without probucol, but phospholipid and cholesteryl ester formation from [3H]oleate was unaf-fected In addition, no differences between the effects of CRLPs and pCRLPs on the expression of mRNA for a range of genes believed to be involved in lipoprotein uptake, intracellular lipid metabolism and the efflux of cholesterol from macrophages was detected These results suggest that antioxidants carried in chylomicron remnants enhance lipid accumulation in macrophages by increasing the rate of uptake of the particles and raising the intracellular synthesis

of triacylglycerol, but not cholesteryl ester, and that these effects are brought about by changes at the post-transcrip-tional level Antioxidants carried in chylomicron remnants therefore may promote the development of atherosclerosis, and this is likely to be particularly important in conditions where clearance of remnants from the circulation is delayed Keywords: chylomicron remnants; probucol; macrophages; lipid accumulation; antioxidants

Atherosclerotic lesions are intiated by the formation of fatty streaks in the artery, which form when macrophages in the vessel wall take up lipoproteins from the subendothelial space and eventually become so engorged with lipid that they take on a foamy appearance and are termed foam cells [1,2] Evidence from a large number of previous studies has indicated that low density lipoprotein (LDL) has a major role in the generation of foam cells, but it is also clear that oxidation of the lipoprotein particles, a process which can occur within the artery wall, is necessary before extensive lipid accumulation is induced [3], and this has led to the development of the hypothesis that antioxidants have a beneficial effect in the prevention of atherosclerosis and related cardiovascular disease

There is considerable epidemiological evidence to indicate that diets rich in fruits and vegetables (for example, the Mediterranean diet), which contain relatively high levels

of natural antioxidants such as vitamin E and carotenoids, reduce the risk of heart disease [4–6] A number of prospective studies have also suggested that consumption

of antioxidant vitamins, such as vitamin E and b-carotene, may be beneficial [7,8], and randomized clinical trials with vitamin E supplementation have supported this view [9,10]

Correspondence to K M Botham, Department of Veterinary Basic

Sciences, The Royal Veterinary College, Royal College St., London

NW1 0TU, UK Fax: + 44 20 7388 1027, Tel.: + 44 20 7468 5274,

E-mail: kbotham@rvc.ac.uk

Abbreviations: ABCA1, ATP-binding cassette transporter A1;

ACAT1, acyl coenzyme A : cholesterol acyltransferase 1; acLDL,

acetylated low-density lipoprotein; apoE, apolipoprotein E; CRLPs,

chylomicron remnant-like particles; DGAT1, acyl coenzyme A:

diacylglycerol acyl transferase 1; DiI,

1,1¢-dioctadecyl-3,3,3¢3¢-tetra-methylindo-carbocyanine perchlorate; HMDM, human

monocyte-derived macrophages; HNE, 4-hydroxy-2(E)-nonenal; LDL,

low-density lipoprotein; LDLr, low-low-density lipoprotein receptor; LRP,

low-density lipoprotein receptor-related protein; lycCRLPs,

chylo-micron remnant-like particles containing lycopene; MDA,

malondialdehyde; oxLDL, oxidized low-density lipoprotein; pCRLPs,

chylomicron remnant-like particles containing probucol; PMA,

4b-phorbol 12-myristate 13-acetate; SR-A, scavenger receptor A;

SR-B1, scavenger receptor B1; TBARS, thiobarbituric acid reactive

substances; VLDL, very-low-density lipoprotein.

Enzymes: acyl coenzyme A: cholesterol acyltransferase (EC 2.3.1.26);

acyl coenzyme A: diacylglycerol acyl transferase (EC 2.3.1.20).

(Received 27 February 2004, revised 7 April 2004,

accepted 16 April 2004)

Despite these strong indications of potential benefits,

however, a recent review of large-scale trials of dietary

supplementation with b-carotene or vitamin E in healthy

human populations has concluded that the results fail to

confirm any protective effects of these compounds against

cardiovascular disease [11]

Dietary lipids, including fats, cholesterol and lipid-soluble

antioxidants, are absorbed in the intestine and secreted into

lymph in chylomicrons, large triacylglycerol-rich

lipopro-teins which pass into the blood via the thoracic duct and are

then rapidly metabolized by lipoprotein lipase in

extra-hepatic capillary beds, removing some of the triacylglycerol

and leaving smaller remnant particles The chylomicron

remnants retain all the cholesterol and minor lipid

compo-nents, such as antioxidants, and deliver them to the liver for

processing [12] There is now a large and growing body of

evidence indicating that chylomicron remnants are strongly

atherogenic They have been shown to be taken up into the

artery wall [13–15] as efficiently as LDL [16], and

remnant-like particles containing apolipoprotein E (apoE) have been

isolated from human aortic intima and atherosclerotic

plaque [17,18] In addition, delayed clearance of remnants

from the circulation is correlated with the development of

atherosclerotic lesions [19,20] Previous work in our

labor-atory and by others has demonstrated that chylomicron

remnants are able to induce foam cell formation in human

monocyte-derived macrophages (HMDM) [21] and in

human and murine macrophage cell lines [22–24], and that,

in striking contrast to LDL, the remnant particles do not

require prior oxidation to bring about this effect

Information about the effects of antioxidants on

macro-phage foam cell formation has come mainly from studies

with vitamin E and the synthetic lipophilic antioxidant drug,

probucol, and the results have been inconsistent Vitamin E

has been reported to decrease lipid accumulation and/or

the uptake of oxidized LDL (oxLDL) or acetylated LDL

(acLDL) in HMDM and the murine macrophage cell line

J774, both when added to the medium [25,26], or

incorpor-ated into the LDL particles [27], but in other studies no

effects of pretreatment with the vitamin could be detected

in experiments with HMDM [28], or mouse macrophages

[29,30] Similarly, Yamamoto et al [31] found that

probu-col, either in the free form or bound to the lipoprotein,

suppressed lipid accumulation and the uptake of acLDL by

human macrophage cell lines, while other workers have

found either no effect [32,33] or increased lipid

accumula-tion [30,34] with probucol pretreatment in rabbit or mouse

peritoneal macrophages

Although it is clear that transport in the blood in

chylomicron remnants provides dietary lipid-soluble

anti-oxidants with the opportunity to interact directly with the

artery wall to influence atheroma development, little is

known about how the incorporation of antioxidants into

the remnant particles influences their effects on

macro-phages In the first study in this area, we have demonstrated

recently that chylomicron remnant-like particles (CRLPs)

containing lycopene cause markedly increased lipid

accu-mulation in macrophages derived from the human

mono-cyte cell line, THP-1, suggesting that, contrary to what

might be expected, protection of chylomicron remnants

from oxidation enhances, rather than inhibits, their

induc-tion of foam cell formainduc-tion [35] Our experiments, however,

could not rule out the possibility that the findings were a result of properties specific to the lycopene molecule, rather than its antioxidant effects In the present work therefore we investigated the effects of the incorporation of the phenolic lipophilic drug, probucol, which is structurally unrelated to lycopene [36], into CRLPs on lipid accumulation in THP-1 macrophages After confirming that the induction of lipid accumulation in the cells by the particles is enhanced when they are protected from oxidation, we investigated the mechanism of this effect by comparing the influence of CRLPs and CRLPs containing probucol (pCRLPs) on the uptake of the particles by the cells, intracellular lipid synthesis, and the expression of mRNA for genes believed

to play a part in foam cell formation, including those regulating lipoprotein uptake [such as the LDL receptor (LDLr), the low-density lipoprotein receptor-related protein (LRP), scavenger receptor A (SR-A), and CD36], intracel-lular lipid metabolism [acyl coenzyme A: cholesterol acyl-transferase 1 (ACAT1), acyl coenzyme A: diacylglycerol acyltransferase 1 (DGAT1)], the efflux of cholesterol from the cells [scavenger receptor B1 (SR-B1)], and the ATP-binding cassette transporter A1 (ABCA1)

Materials and methods

RPMI-1640, fetal bovine serum, L-alanyl-L-glutamine (glutamax), penicillin/streptomycin and 2-mercaptoethanol were obtained from Gibco Fetal bovine serum was heat inactivated by incubation at 56C for 30 min before use Trypan blue, fatty acid-free BSA, phospholipids, choles-terol, cholesteryl oleate, probucol, lycopene and 4b-phorbol 12-myristate 13-acetate (PMA) were supplied by Sigma The fluorescent probe 1,1¢-dioctadecyl-3,3,3¢3¢-tetramethylindo-carbocyanine perchlorate (DiI) was purchased from Cambridge Bioscience The radioisotopes L-3 phosphatidyl-choline 1-palmitoyl-2-[114C]linoleoyl and [1(3)-3H]glycerol were purchased NEN Life Science Products Inc., and [9,10(n)-3H]oleate was from Amersham International

Preparation of CRLPs CRLPs were prepared by sonication of a lipid mixture containing 70% trilinolein, 2% cholesterol, 5% cholesteryl ester and 25% phospholipids, in Tricine buffer (20 mM,

pH 7.4) containing 0.9% NaCl, followed by density-gradi-ent cdensity-gradi-entrifugation and binding to human apoE, as described previously [37] Sonication was performed at 22–24 lm for

20 min at 56C, and the resulting emulsion was adjusted to

a density of 1.21 gÆmL)1with KBr, layered under a stepwise density gradient, and centrifuged at 17 000 g for 20 min at

20C The upper layer of grossly emulsified lipids was then removed and replaced with an equal volume of 0.9% NaCl (d¼ 1.006 gÆmL)1) and the tubes were centrifuged at

70 000 g for 1 h (20C) Lipid particles harvested from the top layer were incubated with the dialysed (18 h, 4C),

d> 1.063 gÆmL)1, fraction of human plasma (obtained from the National Blood Service, North London Centre, London, UK) at 37C with shaking for 5 h [lipid particles/ plasma, 1 : 1, (v/v)] CRLPs were then isolated by ultra-centrifugation (120 000 g, 16 h, 12C), harvested from the top layer and stored at 4C under argon until required Analysis by SDS–PAGE showed that the particles

contained apoE and no other lipoproteins For the

prepar-ation of CRLPs containing antioxidants and/or the DiI

fluorescent label, probucol, lycopene and/or DiI was added

to the lipid mixture prior to sonication Taking into account

the amount of probucol or lycopene added to the lipid

mixture for sonication and the percentage recovery of the

starting lipids in the CRLPs, we estimate that the

concen-trations of probucol or lycopene used in our experiments

did not exceed 10 lM

Culture of THP-1 cells

THP-1 monocytes were maintained in suspension in

RPMI-1640 containing 10% fetal bovine serum, 2 mMglutamine,

100 UÆmL)1 penicillin, 100 mgÆmL)1 streptomycin and

50 mM 2-mercaptoethanol (culture medium), at a density

of 3–9· 105cells per mLat 37C in 5% air/95% CO2 The

cells were induced to differentiate into macrophages by

incubation for 72 h in the presence of PMA (200 ngÆmL)1)

Then, cells adhering to the culture plates, and the medium

containing the PMA and any remaining monocytes, were

removed Viability of THP-1 macrophages, as assessed by

Trypan blue exclusion, was > 95%

For studies on lipid accumulation, CRLPs or pCRLPs

(30 lgÆmL)1cholesterol), were added to the macrophages

and the incubation was continued for a further 48 h before

the cells were harvested and their lipid content determined

For uptake studies, DiI-labelled CRLPs or pCRLPs

(30 lgÆmL)1 cholesterol) were incubated with THP-1

macrophages for various time-periods and the cells were

then viewed with a Zeiss LMS 510 laser-scanning confocal

microscope

To determine the incorporation of [3H]oleate into cellular

lipids, THP-1 macrophages were incubated with CRLPs or

pCRLPs (30 lgÆmL)1 cholesterol) for 48 h The medium

was then removed and, after washing the cells three times

with 2 mLof warm phosphate-buffered saline (NaCl/Pi),

replaced with culture medium (1 mL) containing

[9,10-3H]oleic acid (37 KBqÆmL)1, 55 000 d.p.m.Ælmol)1)

and 2% fat-free BSA The incubation was continued for

1 h, the cells were washed three times with 2 mLof NaCl/Pi,

and the lipids were extracted with isopropanol/hexane

(3 : 2, v/v) (2 mL· 30 min, then 1 mL · 20 min repeated

four times), separated by TLC (hexane/diethyl ether/formic

acid, 80 : 20 : 2, v/v/v) and the bands corresponding

to triacylglycerol, diacylglycerol, phospholipid, cholesteryl

ester, and nonesterified fatty acids (visualized with iodine vapour) were scraped into vials for determination of the radioactivity by liquid scintillation counting using Lumagel-safe scintillant (Perkin Elmer Life Sciences) Preliminary experiments showed that [3H]oleate incorporation into lipids was linear over a period of 2 h under the conditions used Incorporation of [3H]glycerol into triacylglycerol was determined using a modification of the method described by Davis et al [38] Cells were incubated for 6 h at 37C in 95% air/5% CO2in serum-free medium containing CRLPs

or pCRLPs (20 lgÆmL)1 cholesterol) in the presence of [3H]glycerol (148 KBqÆmL)1, 20 lM) After incubation, the cells were washed twice with NaCl/Pi [14 C]Phosphatidyl-choline (900 d.p.m.) was added to each tube as an internal standard and the lipids were extracted and separated by TLC, as described previously [22] Proteins were harvested from the plates, after extraction of the lipids, by the addition

of 1 mLof NaOH (1M)

mRNA analysis The relative abundance of transcripts for the LDLr, LRP, SR-A, SR-B1, CD36, ACAT1, DGAT1, and ABCA1 was determined by RT-PCR Total mRNA was extracted from the cells using a kit from Promega UK, and first-strand synthesis was carried out using Avian myeloblastosis virus reverse transcriptase The primers used and the product sizes for the genes tested are shown in Table 1 Amplifica-tion condiAmplifica-tions were: initial denaturaAmplifica-tion at 95C for

15 min, followed by 30 cycles (LDLr, ACAT1, DGAT1), 33 cycles (SR-A, SR-B1, CD36, ABCA1) or 34 cycles (LRP) consisting of denaturation at 94C for 30 s, annealing at

58C for 1 min and extension at 72 C for 1 min, with the final extension at 72C for 10 min The products were analysed by electrophoresis on an agarose gel [1.2%, (w/v)] containing ethidium bromide (0.5 lgÆmL)1) and the bands were quantified by absorbance volume analysis using values for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) obtained simultaneously in the same system The linearity

of the assay for each gene was established in preliminary experiments

Analytical methods The total cholesterol (cholesterol + cholesteryl ester), cholesterol, triacylglycerol and phospholipid content of

Table 1 Primer sequences and product sizes for RT-PCR ABCA1, ATP-binding cassette transporter A1; ACAT1, acyl coenzyme A: cholesterol acyltransferase 1; DGAT1, acyl coenzyme A: diacylglycerol acyl transferase 1; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; LDLr, low-density lipoprotein receptor; LRP, low-low-density lipoprotein receptor-related protein; SR-A, scavenger receptor A; SR-B1, scavenger receptor B1 Gene Forward primer Reverse primer Product size (bp)

SR-B1 GAAACTGCAGCTGAGCCTCT ACCTACTTGGCTCCGGATTT 250

ACAT1 CTACAAGGCAGGCAGTATTGG TAAGCGTCCTGTTCATTTCGT 334

DGAT1 CCTGTGTTGAGGGAGTACCTG GGGCGAAACCAATGTATTTCT 328

ABCA1 AACAGTTTGTGGCCCTTTTG AGTTCCAGGCTGGGGTACTT 157

GAPDH AATGACCCCTTCATTGACCTC GTTCACACCCATGACGAACAT 309

CRLPs and cell samples was determined by enzymatic

analysis using kits supplied by Sigma Cholesteryl ester

levels were calculated by subtracting the values for

choles-terol from those for total cholescholes-terol The thiobarbituric

acid reactive substances (TBARS) content of the

prepara-tions was determined as described by Steinbrecher et al

[39] Tetraethoxypropane, which yields malondialdehyde

(MDA), was used as a standard The levels of MDA

and 4-hydroxy-2(E)-nonenal (4-HNE) were assayed using

Bioxytech LPO-586 (Oxis International Inc, Portland, OR,

USA) For the determination of conjugated diene formation,

CRLPs or pCRLPs (50 nmolÆmL)1 triacylglycerol) were

incubated at 30C in the presence or absence of CuSO4

(50 lM) and the change in absorbance at 234 nm was

measured

Fluorescence per cell in macrophages treated with

DiI-labelled CRLPs or pCRLPs was quantified by absorbance

volume analysis The fluorescence for the entire field was

assessed, the background deducted and the value divided by

the number of cells in the field Two or three fields with

approximately equivalent numbers of cells were analysed

in each experiment Values were normalized for variations

in the fluorescence of different preparations using the

fluorescence units per lmol of cholesterol, measured in a

fluorimeter

Significance limits were calculated using the Student’s

t-test, Student’s paired t-test orANOVA, as indicated

Results

Characteristics of CRLPs and pCRLPs

The lipid content of the CRLPs and pCRLPs used is shown

in Table 2 The total cholesterol, triacylglycerol and

phospholipid content, and the triacylglycerol/total

choles-terol ratio, were not significantly different in the two types of

particles TBARS values, however, were significantly lower

in pCRLPs than in CRLPs The lipid and TBARS content

of the CRLPs and pCRLPs was not affected by the

incorporation of the DiI fluorescent label After incubation

with CuSO4(10 lM, 18 h), the levels of the lipid

peroxida-tion products MDA and 4-HNE (pmolÆnmol)1

triacylglyc-erol) in pCRLPs (7.2 ± 1.7) were also markedly lower

(P < 0.05) than those in CRLPs (62.1 ± 15.4) Little conjugated diene formation, as measured by the increase

in absorbance at 234 nm, was observed when CRLPs or pCRLPs were incubated at 30C for periods of up to

420 min, but on incubation with CuSO4 (50 lM), CRLPs showed a marked rise in diene formation, which was not seen with pCRLPs (Fig 1)

Effect of CRLPs containing probucol on lipid accumulation in THP-1 macrophages Exposure of THP-1 macrophages to either CRLPs or pCRLPs caused a considerable increase in the total lipid accumulated in the cells after 48 h (Table 3) Comparison of the effects of the two types of particles, however, showed that pCRLPs had a markedly greater effect The total lipid content in pCRL treated cells was 221% that of CRL P-treated macrophages (Table 3), and this was a result of increases in both triacylglycerol (+132%) and total choles-terol (+73%) levels Cholesteryl ester levels, however, were not significantly changed; thus the increase in the total cholesterol fraction was entirely the result of higher cholesterol concentrations (+84%) (Table 3)

Uptake of CRLPs and pCRLPs by THP-1 macrophages THP-1 macrophages were incubated with DiI-labelled CRLPs or pCRLPs for periods between 1 and 24 h, and the cells were then viewed by confocal microscopy The amount of fluorescence associated with the cells increased markedly, with time, in experiments with both types of particles, but there was clearly more in pCRLP-treated macrophages, even at early time-points (Fig 2) Quantifi-cation of the cell-associated fluorescence (Fig 3) confirmed that the rate of uptake of pCRLPs was considerably higher than that of CRLPs

Table 2 Lipid and thiobarbituric acid reactive substances (TBARS)

content of chylomicron remnant-like particles (CRLPs) Standard

CRLPs, and CRLPs containing probucol (pCRLPs), were prepared as

described in the Materials and methods and the triacylglycerol (TG),

total cholesterol (TC), phospholipid (PL) and TBARS levels were

determined Data shown represent the mean ± SEM from eight

preparations MDA, malondialdehyde.

Parameter CRLPs pCRLPs

TC (lmolÆmL)1) 0.97 ± 0.23 0.93 ± 0.19

TG (lmolÆmL)1) 3.74 ± 0.88 3.93 ± 0.76

PL(lmolÆmL)1) 0.53 ± 0.12 0.61 ± 0.11

TG : TC 3.98 ± 0.23 4.33 ± 0.29

TBARS (nmol of MDA

per lmol of TG)

2.54 ± 1.1 0.65 ± 0.57a

a

P < 0.01 vs CRLPs (Student’s t-test).

Fig 1 Conjugated diene formation after incubation of CRLPs or pCRLPs in the presence or absence of CuSO 4 Chylomicron remnant-like particles (CRLPs) or CRLPs containing probucol (pCRLPs) (50 nmolÆmL21 triacylglycerol) were incubated in the presence or absence of CuSO 4 (50 m M ) at 30 C and the absorbance at 234 nm was measured, at the intervals indicated, for 420 min n, CRL Ps; m, CRLPs + CuSO 4 ; s, pCRL Ps; d, pCRL Ps + CuSO 4 Data are expressed as the change in absorbance with time Each point represents the mean of four experiments performed with separate CRLP prepa-rations, and error bars show the SEM.

Effect of pCRLPs on lipid synthesis in THP-1 macrophages

The effects of CRLPs and pCRLPs on lipid synthesis in

THP-1 macrophages were investigated by measuring the

incorporation of [3H]oleate into triacylglycerol,

diacylglyc-erol, phospholipid and cholesteryl ester after incubation of

the cells with the particles for 48 h (Table 4) The amount of

triacylglycerol formed from [3H]oleate was increased by

 50% in macrophages exposed to pCRLPs as compared to

CRLPs, while the radioactivity found in diacylglycerol

was decreased by 40% Incorporation of [3H]oleate into

phospholipid and cholesteryl ester, and the amount of

radioactivity found in nonesterified fatty acids, however,

was not significantly different in experiments with the two

types of particles

Similar experiments using [3H]glycerol (n¼ 4) also

showed that triacylglycerol formation was increased in

macrophages treated with pCRLPs (12.02 ± 1.95 pmol of

triacylglycerol formed per minute per mg of cell protein) as

compared to CRLPs (9.79 ± 0.94 pmol of triacylglycerol

formed per minute per mg of cell protein, P < 0.05)

Effect of CRLPs containing probucol or lycopene

on mRNA expression in THP-1 macrophages

THP-1 macrophages were incubated with CRLPs or

pCRLPs for 48 h and the levels of mRNA for nine genes

believed to play a role in foam cell formation was measured

by RT-PCR The results are shown in Table 5 The relative

abundance of transcripts for LDLr, CD36, ACAT1 and

ABCA1 was not significantly changed by either type of

particle There was a significant decrease, however, in

mRNA levels for the LRP ()71 to )78%), SR-A ()33%)

and SR-B1 ()20 to )34%) in experiments with both CRLPs

and pCRLPs In addition, DGAT1 mRNA concentrations

were increased by both types of lipoproteins, but because of

the large variation in individual samples, these changes did

not reach significance However, all six values from

CRLP-treated cells (three for CRLPs and three for pCRLPs) were

higher than those from control cells incubated without

lipoproteins, with the increases ranging from 35 to 350%

No differences were observed between the effects of CRLPs

and pCRLPs on any of the genes investigated

We have reported the influence of CRLPs containing

lycopene (lycCRLPs) on the expression of mRNA for

LDLr, LRP, ACAT1 and DGAT1 in THP-1 macrophages

in a previous study [35] In order to compare the effects of

pCRLPs and lycCRLPs on all the genes tested in the present

work, we therefore measured the effects of lycCRLPs on levels of mRNA for SR-A, CD36, SR-B1, adipophilin and ABCA1 The results were generally similar to those obtained with pCRLPs (Table 6), with mRNA levels for CD36 and ABCA1 levels not significantly changed, and decreases of a similar extent observed in those for SR-A ()39%) and SR-B1 ()21%), although, in this case, the change in SR-B1 mRNA did not reach significance

Discussion

The aim of this study was to investigate the effects of lipophilic antioxidants carried in chylomicron remnants on the induction of lipid accumulation in macrophages However, as it is difficult to obtain chylomicron remnants from human blood uncontaminated with lipoproteins of similar density, such as chylomicrons and very-low-density lipoprotein (VLDL), it was necessary to use model CRLPs

to mimic the action of the remnant lipoproteins The size, density and lipid composition of the CRLPs used was similar to that of physiological remnants [40,41], and they also contained human apoE Extensive previous studies in both humans and experimental animals have shown that model particles of this type are cleared from the blood and metabolized in a similar way to the corresponding physio-logical lipoproteins [42–45], and CRLPs containing apoE from the appropriate species have also been found to have effects which mimic those of physiological remnants in rat hepatocytes and pig endothelial cells [40,46–48] As lipo-philic antioxidants can easily be incorporated into the model particles, CRLPs provide a suitable and convenient model for our experiments

In previous work, we have demonstrated that CRLPs containing lycopene, a carotenoid with antioxidant proper-ties [6], markedly enhance lipid accumulation in THP-1 cells, suggesting that dietary antioxidants carried in chylo-micron remnants may promote, rather than inhibit, macrophage foam cell formation [35] In order to test the hypothesis that this effect was caused by the protection of the remnants from oxidation, rather than a specific effect of lycopene, and to further investigate the mechanisms involved, we used CRLPs containing probucol, a phenolic antioxidant lipophilic drug that is structurally unrelated to lycopene [36] Probucol has been used extensively to study the effects of antioxidants on atherosclerosis [49], and has been shown to bind to VLDL and LDL, and to provide the particles with greater antioxidant protection than vitamin E and many other antioxidants [50] The concentration of

Table 3 Effect of chylomicron remnant-like particles (CRLPs) and CRLPs containing probucol (pCRLPs) on the cholesterol (C), cholesteryl ester (CE) and triacylglycerol (TG) content of THP-1 macrophages THP-1 macrophages were incubated with CRLPs or pCRLPs (30 lgÆmL)1of total cholesterol) for 48 h and the TG, C, CE, and total cholesterol (TC) (C + CE) content of the cells was determined Data are expressed as nmolÆmg)1

of cell protein and represent the mean ± SEM from five separate experiments.

Total lipid (TG + TC) 164.4 ± 38.3 556.7 ± 75.0 1291.5 ± 311.2a 221.1 ± 29.7

TG 90.6 ± 22.7 453.7 ± 60.6 1117.4 ± 308.5a 232.4 ± 42.5

TC 73.8 ± 15.9 103.0 ± 17.0 174.1 ± 33.3 a 172.9 ± 27.3

C 72.0 ± 16.4 83.6 ± 12.2 150.6 ± 25.3a 183.7 ± 24.6

CE 1.8 ± 1.0 19.4 ± 5.5 23.5 ± 10.7 111.1 ± 52.8

a P < 0.05 vs CRLPs (Student’s paired t-test).

Fig 2 THP-1 macrophages were incubated with 1,1¢-dioctadecyl-3,3,3¢3¢-tetramethylindo-carbocyanine perchlorate (DiI)-labelled chylomicron rem-nant-like particles (CRLPs) or pCRLPs (30 lgÆmL21cholesterol) for 1 h (A, CRLPs; B, pCRLPs), 6 h (C, CRLPs; D, pCRLPs) or 24 h (E, CRLPs;

F, pCRLPs), and viewed by confocal microscopy In each set of three panels, the top left shows the fluorescence, the top right the cells, and the bottom left the two merged Images shown are from a typical experiment of three performed.

probucol added to the macrophages (not exceeding 10 lM)

in our experiments was comparable to [32,34,51] or lower

than [31,33,52,53] the levels used in previous work to study

the effects of the drug on foam cell formation in vitro

Furthermore, the pCRLPs were significantly more resistant

to oxidation than CRLPs, as indicated by the lower

concentration of TBARS in the particles (Table 2), the

markedly lower levels of MDA and 4-HNE after their

exposure to CuSO4, and their resistance to copper-induced

conjugated diene formation (Fig 1)

In agreement with our previous work on physiological

chylomicron remnants and CRLPs [21–23], incubation of

macrophages with CRLPs caused a considerable increase in

intracellular total lipid accumulation without prior

oxida-tion of the particles (Table 3) When probucol was

incor-porated into the CRLPs, however, this effect was enhanced

by more than twofold, and this was caused by an increase in

triacylglycerol (·2.3) and cholesterol (·1.8) levels, while the

cholesteryl ester content was unaffected These results are

strikingly similar to those obtained in our previous work

with CRLPs containing lycopene [35], and thus strongly

suggest that the protection of chylomicron remnants from

oxidation enhances, rather than inhibits, their induction of

lipid accumulation in macrophages

The enhancement of lipid accumulation in macrophages

by CRLPs containing probucol and lycopene contrasts

sharply with the effects of antioxidants on the induction of

foam cell formation by acLDL or oxLDL Yamamoto et al

[31,52] have found that foam cell formation in response

to acLDL in the human cell lines UE-12 and THP-1 is suppressed by probucol, when added to the medium either

in its free form or in acLDL prepared from patients given the drug, and vitamin E has also been reported to decrease the induction of lipid accumulation by oxLDL or acLDL in HMDM and in J774 cells in both these conditions [25–27]

In other studies, however, no effect on the induction of foam cell formation by acLDL or oxLDL in the presence of probucol or vitamin E was detected [28,29,32], and two investigations have shown an increase in macrophage cholesteryl ester content after incubation with acLDL in the presence of probucol [30,34] Despite this inconsistency, there have been no reports of antioxidants causing massive increases in the induction of lipid accumulation in macro-phages by acLDL or oxLDL comparable to those found in the present study with CRLPs containing probucol or lycopene These findings suggest that the effects of dietary lipophilic antioxidants on macrophages differ markedly, depending on the lipoprotein in which they are carried, so that during their transport from the gut to the liver in chylomicron remnants they promote foam cell formation, and their beneficial effects are only apparent after their incorporation into LDL, as oxidation of these particles greatly enhances their atherogenic effects [3]

One possible explanation for the raised lipid content of macrophages treated with pCRLPs, as compared to CRLPs, is that protection of the particles from oxidation increases their uptake by the cells We investigated this hypothesis using CRLPs and pCRLPs labelled with the DiI fluorescent probe, and the results clearly demonstrate that the presence of probucol in CRLPs markedly increases their rate of uptake by THP-1 macrophages (Figs 2 and 3) These findings are again in contrast to those on the effects of antioxidants on the uptake of acLDL or oxLDL, which has been reported (in experiments using DiI fluorescence-labelled or radiofluorescence-labelled lipoproteins) to be decreased after incubation of macrophages pretreated with or in the presence of probucol [31,53], or vitamin E [25,26,53], although Ku et al [33] found no effect of probucol on acLDL uptake in rabbit peritoneal macrophages

The mechanisms mediating the uptake of chylomicron remnants in macrophages are not yet clearly defined The LDLr appears to play a role, but other receptors (such as the LRP) and various scavenger receptors (such as SR-A and CD36) may also be involved [54] The faster rate of uptake of pCRLPs suggests that probucol may promote interaction with the receptor protein, or possibly that different receptors mediate their uptake Investigation of the effects of CRLPs and pCRLPs on the expression of mRNA for the LDLr and the LRP in the present work showed that both types of particles suppressed mRNA levels for the LRP, but had no effect on those for the LDLr (Table 5), and this is generally consistent with the results obtained in our previous study with CRLPs containing lycopene [35] In addition, we found that the expression of mRNA for SR-A was decreased by both pCRL Ps and lycCRL Ps, while that for the class B scavenger receptor, CD36, was essentially unaffected (Table 5) There were no significant differences, however, in mRNA levels for any of the receptors tested in macrophages treated with CRLPs, with or without anti-oxidants We conclude therefore that the increased rate of uptake of pCRLPs, as compared to CRLPs, unequivocally

Fig 3 THP-1 macrophages were incubated with

1,1¢-dioctadecyl-3,3,3939-tetramethylindo-carbocyanine perchlorate (DiI)-labelled

chyl-omicron remnant-like particles (CRLPs) (m) or pCRLPs (d)

(30 lgÆmL21 cholesterol) for the times indicated The amount of

fluorescence associated with the cells was determined by optical

vol-ume density analysis and normalized for variations in the fluorescence

in different preparations using the fluorescence units per lmol of

cholesterol Each point shows the mean of three separate experiments,

and error bars show the SEM The difference between the two curves

was highly significant (P < 0.001; ANOVA repeated measures).

demonstrated in the experiments with fluorescent-labelled

particles, is not caused by regulation of these proteins at the

transcriptional level

Another mechanism by which antioxidants may influence

lipid accumulation in macrophages is by altering

intracel-lular lipid metabolism Pretreatment of J774 macrophages

with vitamin E, as well as incorporation of vitamin E into LDL, has been found to decrease cholesteryl ester synthesis from radiolabelled oleate in the presence of oxLDL or acLDL [25,27], although Asmis et al [29] did not detect any effect of the vitamin on cholesteryl ester formation in the murine macrophage cell line, PD388D1 Takemura et al

Table 4 Effect of chylomicron remnant-like particles (CRLPs) and CRLPs containing probucol (pCRLPs) on the incorporation of [3H]oleate into lipids in THP-1 macrophages THP-1 macrophages were incubated with CRLPs or pCRLPs (30 lgÆmL)1of cholesterol) for 48 h The medium containing lipoproteins was then removed, the cells were incubated with [ 3 H]oleate (37 KBqÆmL)1) for 1 h and the incorporation of radioactivity into triacylglycerol (TG), diacylglycerol (DG), cholesteryl ester (CE) and phospholipid (PL) during a 1 h incubation was determined Data are expressed as pmol lipid formed min)1Æmg)1of cell protein and represent the mean ± SEM from three separate experiments NEFA, nonesterified fatty acids.

TG 8.73 ± 0.55 12.99 ± 0.61 b 149.1 ± 4.6

a

P < 0.05,bP < 0.01 vs CRLPs (Student’s paired t-test).

Table 5 Effects of chylomicron remnant-like particles (CRLPs) and CRLPs containing probucol (pCRLPs) on mRNA levels for genes involved in foam cell formation THP-1 macrophages were incubated with or without CRLPs or pCRLPs (30 lgÆmL)1of cholesterol) for 48 h, and the levels of mRNA for the genes indicated were determined by RT-PCR The bands were quantified by absorbance (OD) analysis and the values were normalized using those obtained for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) in the same system Data are expressed as OD units and as the percentage of the values found with untreated (control) macrophages, and represent the mean ± SEM from three experiments ABCA1, ATP-binding cassette transporter A1; ACAT1, acyl coenzyme A : cholesterol acyltransferase 1; DGAT1, acyl coenzyme A : diacylglycerol acyl transferase 1; LDLr, low-density lipoprotein receptor; LRP, low-density lipoprotein receptor-related protein; SR-A, scavenger receptor A; SR-B1, scavenger receptor B1.

Gene

OD units OD units % Control OD units % Control LDLr 0.41 ± 0.19 0.47 ± 0.16 168.1 ± 63.5 0.48 ± 0.25 86.3 ± 48.7 LRP 1.06 ± 0.19 0.33 ± 0.11 28.9 ± 6.1 a 0.25 ± 0.14 21.8 ± 10.2 b

SR-A 1.59 ± 0.44 1.12 ± 0.37 67.9 ± 5.9 a 1.17 ± 0.49 67.2 ± 11.9 a

CD36 1.75 ± 0.67 1.69 ± 0.54 101.3 ± 7.5 1.89 ± 0.45 122.6 ± 27.8 SR-B1 2.45 ± 0.23 1.55 ± 0.14 63.6 ± 2.2b 1.94 ± 0.19 80.2 ± 7.3a ACAT1 0.43 ± 0.15 0.41 ± 0.06 126.2 ± 49.1 0.55 ± 0.08 151.3 ± 34.5 DGAT1 0.34 ± 0.11 0.86 ± 0.06 305.9 ± 87.1 0.90 ± 0.21 290.3 ± 85.1 ABCA1 1.31 ± 0.46 1.35 ± 0.35 108.5 ± 10.7 1.39 ± 0.60 101.5 ± 15.3

a P < 0.05, b P < 0.01 vs control macrophages ( ANOVA ).

Table 6 Effects of chylomicron remnant-like particles (CRLPs) and CRLPs containing lycopene (lycCRLPs) on mRNA levels of genes involved in foam cell formation THP-1 macrophages were incubated with or without CRLPs or lycCRLPs (30 lgÆmL)1cholesterol) for 48 h, and mRNA levels

of the genes indicated were determined by RT-PCR The bands were quantified by absorbance (OD) analysis and the values were normalized using those obtained for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) in the same system Data are expressed as OD units and as the percentage

of the values found with untreated (control) macrophages, and represent the mean ± SEM from three experiments ABCA1, ATP-binding cassette transporter A1; SR-A, scavenger receptor A, SR-B1, scavenger receptor B1.

Gene

OD units OD units % Control OD units % Control SR-A 1.61 ± 0.18 1.03 ± 0.27 61.6 ± 9.4a 1.01 ± 0.25 61.3 ± 11.5a CD36 2.19 ± 0.13 1.35 ± 0.19 61.6 ± 8.6 2.13 ± 0.53 96.5 ± 23.4 SR-B1 2.78 ± 0.23 2.05 ± 0.24 73.2 ± 3.0 2.15 ± 0.58 79.4 ± 25.8 ABCA1 1.74 ± 0.20 1.01 ± 0.19 59.1 ± 11.6 1.32 ± 0.33 80.6 ± 27.6

a

P < 0.05, vs control macrophages ( ANOVA ).

[34], on the other hand, have reported increased cholesteryl

ester production and the activity of ACAT, the enzyme

responsible for cholesterol esterification, in mouse

perito-neal macrophages exposed to probucol in the presence and

absence of acLDL In our experiments, the presence of

probucol in CRLPs did not change the rate of formation

of cholesteryl ester in THP-1 macrophages (Table 4) In

addition, there was no significant effect on the expression of

mRNA for ACAT1, the isoform of the enzyme found in

macrophages (Table 5), and this is consistent with our

previous findings with CRLPs containing lycopene [35]

In contrast to the lack of any effect of pCRLPs, as

compared to CRLPs, on cholesteryl ester synthesis in

macrophages, triacylglycerol synthesis was increased

signi-ficantly, as demonstrated in experiments with both [3

H]ole-ate (Table 5) and [3H]glycerol The accompanying decrease

in the amount of radioactivity from [3H]oleate found in

diacylglycerol suggests that the activity of DGAT1, the

enzyme which controls the final and only committed step in

triacylglycerol synthesis in macrophages, using

diacylglyc-erol as the substrate [55], may be increased The expression

of DGAT1 mRNA, however, was raised by both pCRLPs

and CRLPs, suggesting that any effect of probucol occurs at

a post-transcriptional level The increase in DGAT1 mRNA

levels found here differs from our previous study, where we

found that CRLPs containing lycopene caused a significant

decrease, which was not observed with control CRLPs [35]

This is the only major difference we have found, to date,

between the effects of CRLPs containing probucol or

lycopene, and thus may be related to specific effects of the

molecules, rather than their antioxidant properties In

general, our findings on intracellular lipid synthesis show

that increased triacylglycerol synthesis, but not cholesteryl

ester formation, contributes to the enhancement of lipid

accumulation by antioxidants carried in chylomicron

remnants

Cholesterol efflux from macrophages is mediated by the

ABCA1 [56], and the scavenger receptor SR-B1, which

binds the high-density lipoprotein cholesterol acceptor [57]

The expression of mRNA for ABCA1 was not changed by

CRLPs or CRLPs containing probucol or lycopene, while

that for the SR-B1 was decreased by all three types of

particles to a similar extent (Tables 5 and 6) We found no

evidence therefore that antioxidants carried in chylomicron

remnants influence the transcription of genes involved in the

efflux of cholesterol from macrophages

Probucol has been used extensively to investigate the

effects of antioxidants on atherosclerosis development, and

the results generally have provided strong support for the

beneficial effects of such compounds A number of studies,

however, have shown consistently that probucol promotes

atherogenesis in apoE- or LDLr-deficient mice [49] Our

findings, that lipid accumulation in macrophages is

enhanced by probucol carried in chylomicron remnants,

provide a possible explanation for this apparently

para-doxical effect, as both apoE and the LDLr have an

important role in the removal of chylomicron remnants

from the blood, and studies have demonstrated that

remnant levels in plasma are raised and clearance is delayed

in mice deficient in either of these two proteins [58–60]

In conclusion, the experiments reported here demonstrate

that antioxidants carried in chylomicron remnants enhance

lipid accumulation in macrophages, and that this is caused

by a markedly increased rate of uptake of the particles and

by a raised intracellular synthesis of triacylglycerol, but not

of cholesteryl ester Furthermore, the effect does not appear

to be caused by changes in the transcription of genes involved in the regulation of the uptake of the lipoprotein particles, cholesteryl ester or triacylglycerol synthesis, or the efflux of cholesterol from the cells These findings suggest that the type of lipoprotein carrier of dietary antioxidants is crucial for their effects on macrophages Thus, when they are carried in LDL, oxidation and the subsequent detri-mental effects of the particles are inhibited, but lipid accumulation is promoted during their transport postpran-dially in chylomicron remnants This may be particularly important in conditions where the clearance of remnants from the circulation is delayed, and may also provide part of the explanation for the failure to demonstrate beneficial effects of dietary lipophilic antioxidants in large-scale intervention studies [11]

Acknowledgements

This work was supported by grants from the Istituto Superiore di Sanita` (ISS Art.524; fasc 2147/RI and C3BP) E H M and F B were supported by BBSRC CASE studentships sponsored by Glaxo SmithKline.

References

1 Ross, R (1993) The pathogenesis of atherosclerosis: a perspective for the 1990s Nature 362, 801–809.

2 Libby, P., Geng, Y.J., Aikawa, M., Schoenbeck, U., Mach, F., Clinton, S.K., Sukhova, G.K & Lee, R.T (1996) Macrophages and atherosclerotic plaque stability Curr Opin Lipidol 7, 330–335.

3 Steinberg, D (1997) Low density lipoprotein oxidation and its pathobiological significance J Biol Chem 272, 20963–20966.

4 Trichopoulou, A & Vasilopoulou, E (2000) Mediterranean diet and longevity Br J Nutr 84, 205–209.

5 de Lorgeril, M (1998) Mediterranean diet in the prevention of coronary heart disease Nutrition 14, 55–57.

6 Rao, A.V (2002) Lycopene, tomatoes and the prevention of coronary heart disease Exp Biol Med 227, 908–913.

7 Kohlmeier, L., Kark, J.D., Gomez-Garcia, E., Matin, B.C., Steck, S.E., Kardinaal, A.F.M., Ringstad, J., Thamm, M., Masaev, V., Riemersma, R., Martin-Moreno, J.M., Huttunen, J.K & Kok, F (1997) Lycopene and myocardial infarction risk in the EURAMIC study Am J Epidemiol 146, 618–626.

8 Agarwal, S & Rao, A.V (2000) Carotenoids and chronic diseases Drug Metab Drug Interact 17, 189–209.

9 Virtamo, J., Rapola, J.M., Ripatti, S., Heinonen, O.P., Taylor, P.R., Albanes, D & Huttenen, O.P (1998) Effect of vitamin E and beta-carotene on the incidence of primary nonfatal myocardial infarction and fatal coronary heart disease Arch Intern Med 158, 668–675.

10 Stephens, N.G., Parsons, A., Schodiel, P.M., Kelly, F., Cheese-man, K & Mitchison, M.J (1996) Radomised controlled trial of vitamin E in patients with coronary disease: Cambridge heart antioxidant study (CHAOS) Lancet 347, 781–786.

11 Clarke, R & Armitage, J (2002) Antioxidant vitamins and risk of cardiovascular disease Review of large scale randomised trials Cardiovasc Drugs Ther 16, 411–415.

12 Redgrave, T.G (1983) Formation and metabolism of chylo-microns Int Rev Physiol 28, 103–130.

13 Mamo, J.C., Proctor, S.D & Smith, D (1998) Retention of

chy-lomicron remnants by arterial tissue; importance of an efficient

clearance mechanism from plasma Atherosclerosis 141, S63–

S69.

14 Proctor, S.D & Mamo, J.C.L (1998) Retention of

fluorescent-labelled chylomicron remnants within the intima of the artery wall

– evidence that plaque cholesterol may be derived from

post-prandial lipoproteins Eur J Clin Invest 28, 497–503.

15 Grieve, D.J., Avella, M.A., Elliott, J & Botham, K.M (1998)

Influence of chylomicron remnants on endothelial cell function in

the isolated perfused rat aorta Atherosclerosis 139, 273–281.

16 Mamo, J.C.L & Wheeler, J.R (1994) Chylomicrons or their

remnants penetrate rabbit thoracic aorta as efficiently as do

smaller macromolecules, including low density lipoprotein, high

density lipoprotein and albumin Coronary Artery Dis 5, 695–705.

17 Yla-Herttuala, S., Jaakkola, O., Enholm, C., Tikkanen, M.J.,

Solakivi, T., Sarkioja, T & Nikkari, T (1988) Characterisation of

two lipoproteins containing apolipoproteins B and E from

lesion-free human aortic intima J Lipid Res 29, 563–572.

18 Rapp, J.H., Lespine, A., Hamilton, R.L., Colyvas, N.,

Chaume-ton, A.H., Tweedie-Harman, J., Kotite, L., Kunitake, S.T., Havel,

R.J & Kane, J.P (1994) Triglyceride-rich lipoproteins isolated

by selective affinity anti-apolipoprotein B immunosorption

from human atherosclerotic plaque Arterioscler Thromb 14,

1767–1774.

19 Benlian, P., De Gennes, P.L., Foubert, L., Zhang, H., Gagne, S.E.

& Hayden, M (1996) Premature atherosclerosis in patients with

familial chylomicronemia caused by mutations in the lipoprotein

lipase gene N Engl J Med 335, 848–854.

20 Groot, P.H.E., van Stiphout, W.A.H., Krauss, X.H., Jansen, H.,

van Tol, A., van Ramshorst, E., Chin-On, S., Hofmann, A.,

Cresswell, S.R & Havekes, L (1991) Postprandial lipoprotein

metabolism in normolipidemic men with and without coronary

heart disease Arterioscler Thromb 11, 653–662.

21 YUK, C & Mamo, J.C (2000) Chylomicron remnant-induced

foam cell formation and cytotoxicity: a possible mechanism of cell

death in atherosclerosis Clin Sci (London) 98, 183–192.

22 Napolitano, M., Rivabene, R., Avella, M., Botham, K.M &

Bravo, E (2001) The internal redox balance of cells influences the

metabolism of lipids of dietary origin by J774 macrophages:

implications for foam cell formation J Vasc Res 38, 350–360.

23 Batt, K.V., Botham, K.M., Jackson, B & Suckling, K.E (2001)

Comparison of the effects of low density lipoprotein and

chylo-micron remnants on foam cell formation in the human monocytic

cell line THP-1 Atherosclerosis Suppl 2, 109.

24 Napolitano, M., Avella, M., Botham K.M & Bravo, E (2003)

Chylomicron remnant induction of lipid accumulation in J774

macrophages is associated with up-regulation of triacylglycerol

synthesis which is not dependent on oxidation of the particles.

Biochim Biophys Acta 1631, 255–264.

25 Shige, H., Ishikawa, T., Suzukawa, M., Nishiwaki, M.,

Yamash-ita, T., Nakajima, K., Ito, T., Higashi, K., Ayaori, M., Yonemura,

A., Nestel, P & Nakamura, H (1998) Vitamin E reduces

cho-lesterol esterification and uptake of acetylated low density

lipo-protein in macrophages Lipids 33, 1169–1175.

26 Devaraj, S., Hugou, I & Jialal, I (2001) Alpha tocopherol

decreases CD36 expression in human monocyte-derived

macro-phages J Lipid Res 42, 521–527.

27 Suzukawa, M., Abbey, M., Clifton, P & Nestel, P.J (1994) Effects

of supplementing with vitamin E on the uptake of low density

lipoprotein and the stimulation of cholesteryl ester formation in

macrophages Atherosclerosis 110, 77–86.

28 Asmis, R & Jelk, J (2000) Vitamin E supplementation of human

macrophages prevents neither foam cell formation nor increased

susceptibility of foam cells to lysis by oxidized LDL Arterioscler.

Thromb Vasc Biol 20, 2078–2086.

29 Asmis, R., Llorente, V.C & Gey, K.F (1995) Prevention of cholesteryl ester accumulation in P388D1 macrophage-like cells by increased cellular vitamin E depends on species of extracellular cholesterol Conventional heterologous non-human cell cultures are poor models of human atherosclerotic foam cell formation Eur J Biochem 233, 171–178.

30 Trach C.C., Wulfroth P.M., Severs, N.J & Robenek, H (1996) Influence of native and modified lipoproteins on migration of mouse peritoneal macrophages and the effect of the antioxidants vitamin E and probucol Eur J Cell Biol 71, 199–205.

31 Yamamoto, A., Hara, H., Takaichi, S., Wakasugi, S & Tomi-kawa, M (1988) Effect of probucol on macrophages, leading to regression of xanthomas and atheromatous vascular lesions.

Am J Cardiol 62, 31B–36B.

32 Nagano, Y., Kita, T., Yokode, M., Ishii, K., Kume, N., Otani, H., Arai, H & Kawai, C (1989) Probucol does not affect lipoprotein metabolism in macrophages of Watanabe heritable hyperlipidemic rabbits Arteriosclerosis 9, 453–461.

33 Ku, G., Schroeder, K., Schmidt, L.F., Jackson, R.L & Doherty, N.S (1990) Probucol does not alter acetylated low density lipo-protein uptake by murine peritoneal macrophages Atherosclerosis

80, 191–197.

34 Takemura, T., Sakai, M., Matsuda, H., Matsumura, T., Biwa, T., Anami, Y., Nishikawa, T., Sasahara, T & Shichiri, M (2000) Effects of probucol on cholesterol metabolism in mouse peritoneal macrophages: inhibition of HDLmediated cholesterol efflux Atherosclerosis 152, 347–357.

35 Moore, E.H., Napolitano, M., Prosperi, A., Avella, M., Suckling, K.E., Bravo, E & Botham, K.M (2003) Incorporation of lyco-pene into chylomicron remnant-like particles enhances their induction of lipid accumulation in macrophages Biochem Biophys Res Commun 312, 1216–1219.

36 Niguchi, N & Niki, E (2000) Phenolic antioxidants: a rationale for design and evaluation of novel antioxidant drugs for athero-sclerosis Free Rad Biol Med 28, 1538–1546.

37 Napolitano, M., Batt, K.V., Avella, M., Bravo, E & Botham, K.M (2001) Lipid synthesis in macrophages derived from the human cell line THP-1: modulation of the effects of native and oxidised chylomicron remnant-like particles by estrogen Clin Sci (London) 101, 403–413.

38 Davis, R.A., Engelhorn, S.C., Pangburn, S.H., Weinstein, D.B & Steinberg, D (1979) Very low density lipoprotein synthesis and secretion by cultured rat hepatocytes J Biol Chem 254, 2010– 2016.

39 Steinbrecher, U.P., Parthasarathy, S., Leake, D.S., Witzum, J.L.

& Steinberg, D (1984) Modification of low density lipoprotein by endothelial cells involves lipid peroxidation and degradation of low density lipoprotein phospholipids Proc Natl Acad Sci USA

81, 3883–3722.

40 Diard, P., Malewiak, M.-I., Lagrange, D & Griglio, S (1994) Hepatic lipase may act as a ligand in the uptake of artificial chylomicron remnant-like particles by isolated rat hepatocytes Biochem J 299, 889–894.

41 Redgrave, T.G., Fidge, N.H & Yin, J (1982) Specific, saturable binding and uptake of rat chylomicron remnants by rat skin fibroblasts J Lipid Res 23, 638–644.

42 Redgrave, T.G., Ly, H.L., Quintao, C.R., Ramberg, C.F & Boston, R (1993) Clearance from plasma of triacylglycerol and cholesteryl ester after intravenous injection of chylomicron-like lipid emulsions in rats and man Biochem J 290, 843–847.

43 Maranhao, R.C., Fers, M.C., Martins, M.T., Mesquita, C.H., Toffoletto, O., Vinagre, C.G.C., Gianinni, S.D & Pileggi, F (1996) Plasma kinetics of a chylomicron-like emulsion in patients with coronary artery disease Atherosclerosis 126, 15–25.

44 Oliveira, H.C., Hirata, M.H., Redgrave, T.G & Maranhao, R.C (1988) Competition between chylomicrons and their remnants for