Fluorescent microsphere based readout technology for multiplexed human single nucleotide polymorphism analysis and bacterial identification

In addition, the microsphere-based multiplex SNPs assay system was adapted for the identification of bacterial samples by both ASPE and single base chain extension SBCE assays.. KEY WORD

© 2001 WILEY-LISS, INC.

METHODS

Fluorescent Microsphere-Based Readout Technology for Multiplexed Human Single Nucleotide

Polymorphism Analysis and Bacterial Identification

Fei Ye, 1 * May-Sung Li, 1 J David Taylor, 1 Quan Nguyen, 2 Heidi M Colton, 3 Warren M Casey, 3 Michael Wagner, 2 Michael P Weiner, 1 and Jingwen Chen 1

1 Department of Genomic Sciences, Glaxo Wellcome Research and Development, Research Triangle Park, North Carolina

2 Department of Human Genetics, Glaxo Wellcome Research and Development, Research Triangle Park, North Carolina

3 Department of Analytical Sciences, Glaxo Wellcome Research and Development, Research Triangle Park, North Carolina For the SNP 2000 Special Issue

Large-scale human genotyping requires technologies with a minimal number of steps, high

accu-racy, and the ability to automate at a reasonable cost In this regard, we have developed a rapid,

cost-effective readout method for single nucleotide polymorphism (SNP) genotyping that

com-bines an easily automatable single-tube allele-specific primer extension (ASPE) with an efficient

high throughput flow cytometric analysis performed on a Luminex 100™ flow cytometer This

robust technique employs an ASPE reaction using PCR-derived target DNA containing the SNP

and a pair of synthetic complementary capture probes that differ at their 3 ¢ end-nucleotide

defin-ing the alleles Each capture probe has been synthesized to contain a unique 25-nucleotide

identi-fying sequence (ZipCode) at its 5 ¢ end An array of fluorescent microspheres, covalently coupled

with complementary ZipCode sequences (cZipCodes), was hybridized to biotin-labeled ASPE

re-action products, sequestering them for flow cytometric analysis ASPE offers both an advantage of

streamlining the SNP analysis protocol and an ability to perform multiplex SNP analysis on any

mixture of allelic variants All steps of the assay are simple additions of the solutions, incubations,

and washes This technique was used to assay 15 multiplexed SNPs on human chromosome 12

from 96 patients Comparison of the microsphere-based ASPE assay results to gel-based

oligo-nucleotide ligation assay (OLA) results showed 99.2% agreement in genotype assignments In

addition, the microsphere-based multiplex SNPs assay system was adapted for the identification of

bacterial samples by both ASPE and single base chain extension (SBCE) assays A series of probes

designed for different variable sites of bacterial 16S rDNA permitted multiplex analysis and

gener-ated species- or genus-specific patterns Seventeen bacterial species representing a broad range of

gram-negative and gram-positive bacteria were analyzed within 16 variable sites of 16S rDNA

sequence The results were consistent with the published sequences and confirmed by direct DNA

sequencing Hum Mutat 17:305–316, 2001 © 2001 Wiley-Liss, Inc.

KEY WORDS: SNP; allele-specific primer extension; ASPE; single base chain extension; SBCE;

micro-spheres; multiplex; flow cytometry; bacterial identification; mutation detection; ZipCode

Received 18 October 2000; accepted revised manuscript 8 January 2001.

*Correspondence to: Fei Ye, Department of Genomic Sciences, GlaxoWellcome Research and Development, 5 Moore Drive, Re-search Triangle, NC 27709-3398.

INTRODUCTION

As the DNA sequence of the human genome

is completely elucidated, much attention is

be-ing focused on sbe-ingle nucleotide polymorphisms

(SNPs), the most abundant form of genetic

varia-tion According to some estimates, the human

genome may contain >3 million SNPs [Cooper

et al., 1985] Due to their frequency and

distri-bution, SNPs are becoming superior genetic

markers for assembly of a high-resolution map,

aiding identification of disease-related loci [Lai

et al., 1998] In addition, SNPs can potentially

be used for medical diagnostics The powerful,

target-specific pharmaceuticals being developed

today can bring profound improvements to the

lives of many patients, but may have serious side

effects in certain sub-populations The genetic

variation behind these differing biological

re-sponses may correlate with a small set of SNPs

that could serve as a diagnostic tool to insure

prescription of the right medicine to the right

patient These facts increase the need for high

throughput genotyping technologies with simple

steps and the ability to automate Recently, a

number of methods for SNP detection have been

developed, including restriction fragment length

polymorphism (RFLP) analysis, single-strand

conformation polymorphism analysis (SSCP)

[Orita et al., 1989], allele-specific

oligonucle-otide hybridization (ASO) [Saiki et al., 1989],

oligonucleotide ligation assay (OLA) [Landegren

et al., 1988], primer extension assay [Syvanen,

1999; Pastinen et al., 1997], Taqman [Livak et

al., 1995], molecular beacons [Tyagi et al., 1998],

and structure-specific flp nuclease technology

[Mein et al., 2000] A variety of platforms have

been used to analyze reaction products

includ-ing gel electrophoresis, fluorescence polarization

[Chen et al., 1999], semiconductor chips [Gilles

et al., 1999], high-density oligonucleotide arrays

[Fan et al., 2000; Pastinen et al., 2000], and mass

spectrometry [Fu et al., 1998; Ross at al., 1998]

We have adapted the use of fluorescent

micro-spheres in flow cytometric analysis [McHugh,

1994; Fulton et al., 1997; McDade and Fulton,

1997; Kettman et al., 1998] for SNP

determina-tion Previously we demonstrated the

proof-of-concept for this SNP-detection platform using

FACS Calibur instrumentation for analysis of

OLA [Iannone et al., 2000] and single base chain

extension [Chen et al., 2000] assays A similar

approach has also been reported recently [Cai

et al., 2000] Here we describe a new SNPs

as-say that combines a DNA polymerase reaction

named allele-specific primer extension (ASPE)

with a microsphere-based detection using a less expensive flow cytometer with a 96-well plate reader The assay relies on the sequence-specific primer extension of two allele-specific capture oligonucleotide probes that differ at their 3′-end nucleotide defining the alleles A DNA sequence (termed ZipCode) at the 5′-end portion of the capture probe allows the resulting enzymatic reaction product to be captured by its comple-mentary sequence (cZipCode), which has been coupled to a specific fluorescent microsphere The ASPE assay permits multiplexed querying

of different nucleotides, thereby allowing multi-plexing of both alleles of a particular SNP In this study, we demonstrate that this new readout system is a simple and reliable method that can

be used for high throughput SNP genotyping

To explore the applications of our micro-sphere-based multiplexed SNP assay, we have also adapted this assay system for rapid bacterial identification using 16S rDNA sequence The assay uses primers that are placed 5′ upstream of variable bases in the 16S rDNA sequence These primers are coupled with uniquely identifying sequences termed ZipCodes that are comple-mentary to sequences (cZipCodes) covalently attached to fluorescent microspheres In our study, ASPE or single base chain extension (SBCE) was used to extend the primers with bi-otin-labeled dCTP or ddNTPs, respectively The reaction products were hybridized to the cZipCode-microsphere complex and analyzed by flow cytometry The flow cytometer identified the fluorescent microsphere and measured the presence of the biotin-labeled dCTP or ddNTP after tagging with streptavidin-phycoerythrin (SA-PE) The dCTP or ddNTP molecules added

to the specific primers form a pattern which was analyzed to determine the bacterial identifica-tion Using this multiplexed assay, seventeen species were divided into seventeen groups based

on their ASPE or SBCE reaction patterns

MATERIALS AND METHODS Reagents

Shrimp alkaline phosphatase (SAP) and E.

coli Exonuclease I (Exo I) were obtained from Amersham Pharmacia (Cleveland, OH) Biotin-labeled ddNTPs and biotin-Biotin-labeled dCTP were

obtained from NEN Life Science Products, Inc.

(Boston, MA) AmpliTaq, AmpliTaq Gold Taq,

and AmpliTaq FS DNA polymerases were

pur-chased from Applied Biosystems (Foster City,

CA) Taq FS DNA polymerase was obtained

from Applied Biosystems as a special order

Plati-num GenoTYPE Tsp DNA polymerase was

pur-chased from Gibco/BRL (Rockville, MD)

Streptavidin-phycoerythrin (SA-PE) was

ob-tained from Molecular Probes (Eugene, OR)

Oligonucleotides with 5′ amino groups were

ordered from Applied Biosystems

2-[N-Mor-pholino]ethanesulfonic acid (MES) and

1-Ethyl-3-(3-Dimethylaminopropyl)carbodiimide

Hy-drochloride (EDC) were purchased from Sigma

(St Louis, IL) and Pierce (Rockford, IL),

respec-tively Carboxylated fluorescent polystyrene

microspheres were purchased from Luminex

Corporation (Austin, TX)

PCR Amplification

PCR reactions were performed in a 96-well

microtiter-plate on a PTC-100 thermal cycler

(MJ Research, Waltham, MA) 15 µl of

reac-tion mixture contained 20 ng genomic DNA,

10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM

MgCl2, 100 µM dNTPs, 0.2 µM of each primer,

and 1.5 units of AmpliTaq Gold DNA

poly-merase The reactions included a 10 min

incuba-tion at 95°C, followed by 40 cycles at 94°C for 30

sec, 60°C for 30 sec, and 72°C for 30 sec After

cycling, the reactions were incubated at 72°C for

a final extension of 5 min To clean up the PCR

reaction for SBCE reaction, one unit of SAP and

two units of Exo I were added to each 10 µl of the

pooled PCR products The mixture was incubated

at 37°C for 30 min, followed by 15 min at 80°C

to inactivate the enzymes

Coupling of Oligonucleotides to Microspheres

Oligonucleotides used for coupling to

micro-spheres were designed according to our previous

publications [Chen et al., 2000; Iannone et al.,

2000] All of these oligonucleotides contain four

elements: i) a 5′ amino group for covalent

attach-ment to the carboxylated microsphere surface, ii)

an 18-atom spacer (CH3CH2O)6 to minimize

po-tential interaction between the oligonucleotide

sequence and the microsphere surface, iii) a

10-base LUCtag sequence (CAGGCCAAGT) to monitor the coupling efficiency of the oligonucle-otides to the microspheres, and iv) one of a set of 25-base complementary ZipCode sequences (cZipCodes) This set of cZipCodes was selected

from the Mycobacterium tuberculosis genome and

was checked empirically for absence of cross-hy-bridization between members of the set [Iannone

et al., 2000] For the coupling of oligonucleotides

to microspheres, 5 x 106 carboxylated micro-spheres in 50 µl of 0.1 M MES buffer were mixed with 2 nmoles (2 µl of a 1 mM solution) amino-modified oligonucleotide 10 µl of freshly made EDC (30 mg/ml in water) was added to the microsphere/oligo mixture and incubated at room temperature for 30 min One additional fresh 10 µl aliquot of EDC was added and incu-bated for 30 min with occasional sonication The microspheres were then washed with 1 ml of 0.1% sodium dodecylsulfate, followed by wash-ing with 1 ml of 0.02% Tween 20, and finally resuspended in 500 µl TE pH 8.0 [10 mM Tris[hydroxymethyl]aminomethane hydrochlo-ride / 1 mM Ethylenediamine-tetraacetic acid] and stored in the dark at 4°C Coupling efficiency was assessed by hybridizing coupled microspheres with a molar excess of biotinylated oligonucle-otide that is complementary to the LUCtag se-quence The standard procedure was the same

as that detailed below for hybridization of reac-tion products to the microspheres Effective cou-pling reactions produced microspheres with a mean fluorescent intensity (MFI) of 2000 to 4000 units Microspheres with MFI less than 1000 were replaced

Preparation of Bacterial 16S rDNA

Bacterial strains used in this study were ob-tained from the American Type Culture Collec-tion (ATCC) Prior to extracCollec-tion, each isolate was streaked on trypticase soy agar and examined for proper colony morphology The identities were verified using the VITEK identification system Bacterial DNA was isolated using the PrepMan™ system (PE Applied Biosystems, Foster City, CA) For 16S rDNA amplification, two separate sets of highly conserved primers were utilized for the amplification from different bacterial species as follows: 27f/1525r, 5′

-AGAGTTTGATCMTG-GCTCAG-3′/ 5′

-AAGGAGGTGWTCCAR-CC-3′ and 66f/1392r, 5′

-CAGGCCTAA-CACATGCAAGTC-3′/5′

-GGGCGG(t/a)-GTGTACAAGGC-3′ [Marchesi et al., 1998]

DNA was amplified in 50 µL reaction mixtures

containing 10 µl of a 1:250 dilution of template

DNA extraction, and PCR buffer containing100

mM Tris-HCl (pH 8.3), 50 mM KCl, and 1.5

mM MgCl2 The reaction also contained 200 µM

dNTPs, two units of AmpliTaq Gold, and 0.4

µM of each primer The PCR reactions included

a 10-min incubation at 94°C, followed by 30

cycles of 94°C for 30 sec, 55°C for 45 sec, and

72°C for 90 sec After cycling, the reactions were

incubated at 72°C for a final extension of 5 min

The DNA fragments amplified using the 16S

rDNA universal primers were sequenced using

standard dideoxynucleotide termination

sequenc-ing The generated 16S rDNA sequences and

some other reference sequences obtained from

GenBank were analyzed with the CLUSTAL W

program

ASPE Reactions

For each SNP (or variable site of 16S rDNA

sequence for bacterial identification), a pair of

probes was designed such that the last of the 3′

-end base differed at the polymorphic site (see

Table 1 for bacterial ID) For the ASPE assay,

10 µl of pooled, untreated PCR products (10–

20 ng of each amplicon) were added to 10 µl of

2X ASPE reaction mix containing 40 mM

Tris-HCl (pH 8.4), 100 mM KCl, 2.5 mM MgCl2, 25

nM positive control capture oligonucleotide, 50

nM of each SNP capture oligonucleotide, 1.5

units of Tsp DNA polymerase, and 5 µM

biotin-dCTP An initial denaturing step of 2 min at 96°C

was used, followed by 30 cycles at 94°C for 30

sec, 55°C for 1 min and 74°C for 2 min

Reac-tions were held at 4°C prior to the addition of

microspheres

SBCE Reactions

For the SBCE assay, capture probes were

de-signed in such a way that their sequence

termi-nated one base upstream from the SNP site (for

bacterial identification, the probes were chosen

from conserved regions of the 16S rDNA

se-quence and ended one base 5′ from a variable

nucleotide, see Table 1) Two nearly identical reactions were set up, differing only in the choice

of labeled ddNTP (four reactions for bacterial identification) SAP/ExoI-treated PCR products (10–20 ng of each amplicon) were assayed in 20

µl of reaction volumes containing 80 mM of Tris-HCl (pH 9.0), 2 mM of MgCl2, 12.5 nM of posi-tive control target oligonucleotide, 12.5 nM of positive control capture oligonucleotide, 25 nM

of each SNP capture oligonucleotide, 2.4 units

of AmpliTaq FS, 1 µM of the allele-specific la-beled ddNTP, and 1 µM each of the other three ddNTPs The reactions were incubated at 96°C for 2 min and then cycled 30 times at 94°C,

55°C, and 72°C for 30 sec at each temperature Reactions were held at 4°C prior to the addi-tion of microspheres

Hybridization of Enzymatic Reaction Products

to the Microspheres

To capture each of the labeling reaction prod-ucts via the hybridization between the ZipCodes

at the 5′-ends of the probes and the complemen-tary ZipCodes (cZipCodes) coupled to the microspheres, 1,000 microspheres of each type were added to each reaction The concentrations

of NaCl and EDTA were adjusted to 500 mM and 13 mM, respectively The mixtures were

TABLE 1 Oligonucleotide Sequences of the 3 ′ End Portion of 16S rDNA Capture Probes for Bacterial Identification

name Probe sequencea siteb p1 CTCCTACGGGAGGCAGCAGT(a/g) 338-357 p2 ATGTTGGGTTAAGTCCCG(c/t) 1041-1058 p3 GGAATCGCTAGTAATCG(c/t) 1296-1312 p4 TGTCGTCAGCTCGTGT(c/t) 1019-1034 p5 GATGAGTGCTAAGTGTTAG(a/g) 817-835 p6 TCTCAGTTCGGATTGTAG(g/-) 1254-1271 p7 GGTCATTGGAAACTGG(g/a) 630-645 p8 ACTTTCAGCGGGGAGGAAGG(g/t) 434-453 p9 AGGGTTGCCAAGCCGCGAGG(g/t) 1211-1230 p10 ACTTATAGATGGATCCGCGC(c/t) 219-238 p11 ATTGGTGCCTTCGGGAACTC(a/-) 979-998 p12 GAACAAATGTGTAAGTAACT(a/g) 449-468 p13 TACCGGATAACATTTTGAAC(c/-) 172-191 p14 GAGTGCTCGAAAGAGAACCG(a/-) 981-1000 p15 GTAACAGGAAGAAGCTTGCT(g/-) 70-89 p16 GAAACTGGCTTGCTTGAGTCT(t/-) 638-658

a The variable bases at the 3 ′ end of the sequence are shown

in lower case.

bThe positions of 16S rDNA sequences are based on the E coli sequence as a reference (GenBank accession #JZ83205).

incubated at 96°C for 2 min and 40°C for at

least 1 hr The microspheres were washed with

washing buffer (150 mM NaCl, 15 mM sodium

citrate, 0.02% Tween 20) and pelleted at 1,300

x g for 5 min A 96-well pipettor, such as the

Robbins Hydra96™, was used for the washing

process Biotin labels were developed in 8 µg/ml

SA-PE (in washing buffer) at room temperature

for 30 min in the dark

Flow Cytometric Analysis

Microsphere fluorescence was measured using

a Luminex 100 cytometer (Luminex Corp,

Aus-tin, TX) and associated software Each

micro-sphere type in the 100-micromicro-sphere set was

identified by its characteristic fluorescence of red

and infrared wavelengths The orange

fluores-cence associated with the SBCE or ASPE

bio-logical reaction on the surface of the microspheres

was collected and converted to the mean

fluo-rescence intensity (MFI) value Since each

micro-sphere type also emitted a small amount of

fluorescence in the orange wavelengths of the

reporter channel, the inherent,

analyte-indepen-dent orange fluorescence contributed by each

microsphere alone was subtracted from the MFI

value of each sample on the corresponding

microsphere using a Microsoft Excel spreadsheet

MFI values from two corresponding alleles were

merged, allowing display of the results on a

two-coordinate system in which allelic calls were

made using Spotfire software A minimum of 30

microspheres was analyzed per data point

RESULTS Microsphere-Based Multiplex SNPs Analysis

Using Allele-Specific Primer Extension

In order to explore the possibility of setting up

the multiplex primer extension in one reaction

well (tube), instead of G, A, T, and C reactions

separately as in the SBCE assay, we have used

the ASPE detection strategy in our

microsphere-based assay system (Fig 1) The key difference

between ASPE and SBCE is the capture probe

design For ASPE reactions, the last base of the

two allelic probes is coincident with the

polymor-phic site, while the single SBCE probe ends one

base upstream The advantage hereby gained is

that for each SNP genotype, only one ASPE

re-action is required if the two probes are designed with different ZipCode sequences, while the SBCE assay requires two reactions

In our study, the ASPE assay was validated

by genotyping 15 SNPs on human chromosome

12 using PCR-amplified target DNA from 96 DNA samples These DNA samples and SNPs had previously been genotyped by gel-based OLA assays A set of 30 unique cZipCode se-quences, validated empirically for non-cross-re-activity, was coupled to 30 different microspheres (of 100 possible) for capturing each of the 15 SNPs (one pair of capture probes for each SNP) PCR products were pooled together in one well for each DNA sample After the ASPE reactions were performed with the pooled PCR amplicons, the enzymatic reaction products were captured onto a set of microspheres for flow cytometric analysis as described in Material and Methods Representative ASPE assay results for four SNPs assayed across 96 samples are shown in Figure 2 The ASPE experiment generated signals vary-ing from a low of 400 MFI to a high of 1600 MFI Assay signal intensity was similar to SBCE-generated signal strength Fourteen of the 15 SNPs were successfully converted to this assay format The concordance rate of 1344 genotypes obtained

by ASPE and gel-based OLA was 99.2%

Bacterial Identification by Microsphere-Based Multiplex SBCE and ASPE Assays Using 16S rDNA

For the SBCE assay, 16 synthetic capture probes were designed The 5′ portion of each probe contained a unique ZipCode sequence and the 3′ portion was identical to the conserved re-gions of 16S rDNA sequence, ending one base upstream of the 16 variable sites (Table 1) Among them, probes 10–16 are more specific for a cer-tain genus or species For each reaction of the multiplex SBCE assay, a pooled mixture of 16 capture probes was added to the amplified 16S rDNA product The probes were extended and labeled by one base in the presence of the Taq DNA polymerase and biotin-labeled ddNTP, in four separate reactions (ddA, ddG, ddC, and ddT) The probes were then captured by hybrid-izing to the complementary sequences (cZip-Codes) attached to the florescent microspheres

Figure 3 shows the results of the nine variable

sites in four bacterial strains The intensity of

each of four bases for each 16S rDNA sample is

labeled as G, A, T, and C sequentially In most

cases, the positive signal to background noise

ratio was greater than 10 Since each

fluores-cent microsphere becomes the address for a

single 16S rDNA variable site, combining these

16 probes for a multiplex assay creates a unique

pattern for each given bacteria species or genus

This pattern divides the positive and

gram-negative bacteria into smaller groups, and

fur-ther into genus and species (Fig 4)

For the ASPE assay, a pair of probes for each

of the sixteen 16S rDNA variable sites was

de-signed such that their last base differs from each

other In the presence of DNA polymerase,

dNTPs, and a small amount of biotin-labeled

dCTP, a labeled extension product of the 3′

por-tion of the probe was obtained This occurs if

the template included the target sequence For

each template sample, only a single two-probe

reaction was needed The subsequent

hybridiza-tion to microspheres and fluorescent dye devel-opment procedures were the same as in the SBCE assay The ASPE results agreed with re-sults from the SBCE assay (Fig 3), and were consistent with direct sequencing data in all cases Using these multiplexed assays, 17 bacte-rial species were divided into 17 groups based

on their ASPE or SBCE patterns (see Fig 4) Furthermore, we analyzed three strains of each

of five bacterial species: E coli, S aureus, P.

aeruginosa , B cereus, and L monocytogenes All

strains within a species yielded the same pattern, indicating that this microsphere-based SNPs assay system is reliable and accurate

DISCUSSION

A primary advantage of the fluorescent microsphere technology is the ability to multi-plex biological reactions simultaneously in a

single reaction vessel [Kettman et al., 1998].

Examining multiple variable sites in the same reaction reduces labor, time, and cost compared

to DNA sequencing or single reaction-based hybridization methods Another advantage of the microsphere-based readout technology plat-form is that the enzymatic reactions are con-ducted in solution, as opposed to methods based

on solid-surface reactions This allows us to ob-tain the benefit of true liquid-phase kinetics We have developed several assays to perform accu-rate genotyping, and these assays have been adapted to the Luminex 100 fluorimeter for high throughput SNPs analysis This flow cytometric platform offers several major advantages over conventional flow cytometers, including several-fold reduction in initial instrument cost, and an increase in sample throughput by using 96-well plates instead of single tubes We have demon-strated that OLA [Iannone et al., 2000] and SBCE [Chen et al., 2000] assays can be multi-plexed using fluorescent microspheres In an at-tempt to simplify the reaction step in the SBCE assay, in which G, A, T, and C are required to be set up separately for each given DNA template,

we have successfully developed an allele-specific primer extension (ASPE) reaction In this method, a pair of allele-specific primers, which differ from each other at the 3′ end (polymor-phic site) and encode different ZipCode

se-FIGURE 1 Schematic presentation of the

microsphere-based SNP assays DNA fragments containing the

poly-morphic site to be typed are amplified by PCR For the

SBCE assay, PCR products containing a SNP were pooled

and treated with SAP and exonuclease I After heat

inac-tivation of the enzymes, the PCR products were used in

the SBCE reaction as described in Materials and

Meth-ods For each SNP, one capture probe with a unique

ZipCode sequence was used to assay the two alleles in

each of two separate wells with a different labeled ddNTP

per well The probe was extended and labeled by one

nucleotide in the presence of Ampli Taq FS DNA

poly-merase In ASPE reactions, for each SNP, a pair of probes

was designed, differing from each other at their extreme

3 ′ nucleotide (the polymorphic site) In the presence of

DNA polymerase, dNTPs and a small portion of the

bi-otin-labeled dCTP, a labeled extension product of the 3 ′

portion of the primer is obtained, only if the template

in-cludes the target sequence For both SBCE and ASPE

assays, multiplexed SNP analysis could be achieved by

the employment of different ZipCode sequences for

dif-ferent SNPs in the presence of pooled PCR products.

Microspheres covalently attached with an oligonucleotide

encoding the complement to the ZipCode sequence and

a luciferase sequence (SeqLUC) are added to the

com-pleted reactions and hybridization reactions are carried

out at 40 ° C in the presence of NaCl The microspheres

are then subjected to flow cytometric analysis A

mini-mum of 30 microspheres of each type were read and the

mean fluorescence intensity (MFI) value was used for

de-termining the genotypes The fluorescence signal

contrib-uted by the microsphere alone was subtracted from all

data points [Color figure can be viewed in the online

issue, which is available at www.interscience.wiley.com.]

quences at the 5′ end, is used in the same

reac-tion The DNA polymerase will extend only one

primer if the template DNA sequence is

homozy-gous, and both primers will be extended in the

case of heterozygotes An advantage over the

SBCE reaction is the ability to read alleles from

a given SNP in one tube With SBCE, each

nucleotide requires analysis in a separate tube

when using ddNTP terminators labeled with one

fluorochrome This ASPE advantage is possible

because the “query” nucleotide is part of the

ASPE capture probe while the

signal-generat-ing “labeled” nucleotide is the free biotin-dCTP

In the SBCE assay, the biotin-ddNTP serves as

both “query” and “labeled” nucleotide The

ne-cessity of post-PCR cleanup and the addition of

unlabeled nucleotides in the ASPE reaction is

eliminated The residual dNTPs from the

tar-get-generating PCR reaction are further used for the primer extension Although for each SNP assay two types of microspheres are needed for a pair of capture probes, with the set of 100

FIGURE 2 Multiplexed SNPs analysis using allele-specific primer extension 1344 genotypes from 96 separate patient samples were analyzed for multiplexed A/G SNPs Representative results for one plate of 96 patient samples across four

of 15 SNPs are displayed in cluster plot format Normalized MFI values for the G-allele are plotted on the Y-axis, while A-allele values appear on the X-axis [Color figure can be viewed in the online issue, which is available at www.interscience.wiley.com.]

FIGURE 3. Multiplex ASPE (A) and SBCE (B) assays

us-ing nine variable sites of 16S rDNA PCR products were

amplified individually from S aureus, P aeruginosa, B cepacia, and E coli using universal primer pair 27f/1525r.

10 ng of PCR products were used as template for single-tube ASPE, or for A, C, G, or T (shaded columns) SBCE reactions as described in Materials and Methods Cap-ture probes used in this experiment are listed in Table 1 For capturing the reaction products, 1000 microspheres for each SNP were added to the reactions After hybrid-ization at 40 ° C for more than 60 min, the samples were analyzed by a Luminex 100 flow cytometer The fluores-cence intensity on the microspheres is displayed on the Y-axis as the mean fluorescence intensity (MFI) [Color figure can be viewed in the online issue, which is avail-able at www.interscience.wiley.com.]

microspheres available from Luminex Corp

(Austin, TX), 50 SNPs per well and up to 96

as-says could be analyzed on the much less

expen-sive LX 100 instrument equipped with an XY-plate

reader The reading time of the XY-plate reader

for one microtiter plate is approximately one hour

Over 30,000 genotypes could be generated in an

eight-hour day per instrument An even more

dramatic increase in throughput could be

achieved through multiplexed PCR amplification

of the targets and use of automation to allow

ex-tended operation We estimate our average cost

is less than $0.20 per SNP, excluding the cost of

generating the PCR target SBCE and ASPE

re-actions are comparable in cost To minimize

sub-jectivity of genotypic calls, various data-cluster-ing algorithms are currently under development that will allow automatic assignment of genotypes

to the different clusters

Bacterial identification has become an essen-tial tool in areas such as healthcare and food and water quality testing Traditional methods such as microscopy and culturing techniques are time consuming and have severe limitations Molecular methods have recently been devel-oped for bacterial identification These ap-proaches rely on hybridization to specific DNA fragments or sequence determination of con-served regions from a bacterial genome, usually after amplification of the DNA by PCR The

FIGURE 4. Design of the capture probes for multiplex ASPE or SBCE assays using 16S rDNA A: Physical locations of the

16S rDNA probes Based on the multi-alignment of different bacterial 16S rDNA sequences, 16 conserved regions were chosen for SBCE and ASPE assays For SBCE reactions, probes are designed such that the 3 ′ end of the primers termi-nates one base 5 ′ to the variable site For the ASPE assay, a pair of probes was designed such that the 3 ′ end differs from

each other at the variable site The locations of the probes are listed in Table 1 B: Polymorphic patterns in multiplexed

SBCE and ASPE assays Bacterial species can be divided into 17 groups based on their unique readout patterns.