Báo cáo khoa học: Design of expression vectors for RNA interference based on miRNAs and RNA splicing potx

We have designed new RNAi vectors, designated pSM155 and pSM30, that take into considera-tion miRNA processing and RNA splicing by placing the miRNA-based artificial miRNA expression cass

on miRNAs and RNA splicing

Guangwei Du, Joshua Yonekubo, Yue Zeng, Mary Osisami and Michael A Frohman

Department of Pharmacology and the Center for Developmental Genetics, Stony Brook University, NY, USA

Target genes can be silenced by transfection of

chemic-ally or enzymaticchemic-ally synthesized small interfering

RNAs (siRNA) or by DNA-based vector systems that

encode short hairpin RNAs (shRNAs) that are further

processed into siRNAs in the cytoplasm The initially

designed and most widely used vector-based RNA

interferences (RNAi) are driven by RNA polymerase

III promoters, e.g., H1 and U6 [1,2] Several recent

RNAi vectors driven by polymerase II promoters are

based on endogenous small RNAs ( 22 nucleotides)

known as microRNAs (miRNAs) that can also guide

cleavage of RNAs and⁄ or translational inhibition

Cul-len and colleagues first described this kind of RNAi

vector in which a synthetic siRNA⁄ miRNA is

expressed from a synthetic stem-loop precursor based

on the miR30 miRNA precursor [3] Subsequently,

other groups have developed additional miR30- or

miR155-based vectors for RNAi [4–6] The expression

of siRNAs from the artificial miRNA driven by an RNA polymerase II promoter offers several advan-tages over an RNA polymerase III promoter, including expression of several artificial miRNAs from a single transcript, and tissue-specific or regulated expression [4,6,7]

In animals, primary miRNAs (pri-miRNAs) are transcribed by RNA polymerase II, and contain 5¢ CAP structures and 3¢ poly(A) tails [8,9] The pri-miRNA is recognized and cleaved at a specific hairpin site by the nuclear microprocessor complex, which con-tains an RNase III family enzyme, Drosha, to produce

a miRNA precursor (pre-miRNA) of approximately 70–90 nucleotides with a 2 nucleotide 3¢ overhang [10– 14] This distinctive structure activates transport of the pre-miRNA to the cytoplasm by Exportin-5 [8,9,15]

Keywords

intron; miRNA; RNA interference; RNA

splicing; small-hairpin RNA

Correspondence

G Du, Department of Pharmacology and

the Center for Developmental Genetics,

Stony Brook University, Stony Brook,

NY 11794-5140, USA

Fax: +1 631 632 1692

Tel: +1 631 632 1477

E-mail: guangwei@pharm.stonybrook.edu

(Received 13 July 2006, revised 9

Septem-ber 2006, accepted 11 OctoSeptem-ber 2006)

doi:10.1111/j.1742-4658.2006.05534.x

RNA interference (RNAi) mediates sequence-specific post-transcriptional gene silencing in many eukaryotes and is used for reverse genetic studies and therapeutics RNAi is triggered by double-stranded small interfering RNAs (siRNAs), which can be processed from small hairpin RNAs gener-ated from an expression vector In some recently described vectors, the siRNAs are expressed from synthetic stem-loop precursors of microRNAs (miRNAs) driven by polymerase II promoters We have designed new RNAi vectors, designated pSM155 and pSM30, that take into considera-tion miRNA processing and RNA splicing by placing the miRNA-based artificial miRNA expression cassettes inside of synthetic introns Like the original miRNA vectors, we show that the pSM155 and pSM30 constructs efficiently down-regulate expression of firefly luciferase and an endogenous gene, phospholipase D2 Moreover, the expression of a coexpressed fluores-cent marker is substantially improved by this new design Another improvement of these new vectors is incorporation of two inverted BsmBI sites placed internal to the arms of the new miRNA-based vectors, so oligos used for cloning are shorter and the cost is reduced These RNAi vectors thus provide new tools for gene suppression

Abbreviations

EGFP, enhanced green fluorescent protein; miRNA, microRNA; pre-miRNA, miRNA precursor; PLD2, phospholipase D2; pri-miRNAs, primary miRNAs; RNAi, RNA interference; siRNAs, small interfering RNAs; shRNAs, small-hairpin RNAs.

The pre-miRNA is then recognized by another RNase

III, Dicer, and cleaved to produce a mature miRNA

of  22 nucleotides miRNAs can be categorized into

three groups according to their genomic context:

exon-ic miRNA in noncoding transcripts, intronexon-ic miRNAs

in noncoding transcripts, and intronic miRNAs in

protein-coding transcripts [8,9]

Based on the accumulating knowledge on miRNA

biogenesis, we report here the development of vectors

in which the artificial miRNAs are expressed from

arti-ficial introns The artiarti-ficial miRNAs expressed from

both miR30- and miR155-based miRNA precusors

using this strategy efficiently knockdown expression of

the luciferase reporter and an endogenous gene

More-over, this vector also provides a robust marker for the

artificial miRNA-transfected cells

Results and Discussion

Generation of miRNA-based RNAi vectors based

on RNA splicing

Recent strategies have described coupling fluorescent

protein expression directly to artificial miRNA

expres-sion in order to provide a way to identify transfected

cells genuinely expressing the artificial miRNA [4,6,7]

An example of this design is shown in Fig 1A [4] As shown, the pri-miRNAs based on miR155 are proc-essed in the nucleus by Drosha to set up transport of pre-miRNAs to the cytoplasm, where they are further processed to siRNA However, this process simulta-neously blocks the translation of the enhanced green fluorescent protein (EGFP) marker, because the result-ing mRNA fragment lacks a 5¢ CAP structure and is rapidly degraded EGFP can be translated if the pri-miRNAs are exported to the cytoplasm before Drosha cleavage; but siRNAs are then not produced from these unprocessed pri-miRNAs Similar issues apply to the original miR30-based vectors (Fig 1B) [6,7]

We hypothesized that both functions could be accommodated if the pri-miRNAs were processed in nuclei without inactivating the EGFP component To achieve this, we inserted the miR155 and miR30 artifi-cial miRNA-expressing cassettes into a chimeric intron composed of the 5¢ donor site from the first intron of the human b-globin gene and the branch and 3¢ accep-tor site from the intron of an immunoglobulin gene heavy chain variable region (derived from pCI-neo from Promega) (Fig 1C,D) This design mimics the structure and processing of some natural miRNAs

D B

Fig 1 Strategy for improved RNAi knockdown and ⁄ or marker gene expression (A,B) In the original miRNA-based artificial miRNA expres-sion vectors, pmiR155 (A) and pmiR30 (B), the artificial miRNA and EGFP segments are coexpressed as a combined exonic transcript EGFP would not be expected to be efficiently translated because the processing of the miRNA leads to a cleaved mRNA product that is not stable and degrades quickly (C,D) Placing the miRNA-based artificial miRNA expression cassette in a synthetic intron in pSM155 (pSpliced miR155) and pSM30 (pSpliced miR30) might increase the production of siRNAs and the expression of EGFP, because the RNA precursors for both can be processed better or stabilized in the nuclei.

which consist of intronic miRNAs in protein-coding

transcripts [8,9] Separation by splicing of the miRNA

component from the 5¢ CAP-exon-EGFP-3¢ poly(A)

component should facilitate Drosha processing of

the pri-miRNA rather than cytoplasmic export, and

should favor cytoplasmic export and translation for

the EGFP component, rather than intranuclear

degra-dation We denoted these modified miRNA-based

RNAi vectors, pSM155 (Spliced miR155, Fig 1C) and

pSM30 (Spliced miR30, Fig 1D)

To simplify the cloning of artificial miRNAs

with-out substantially altering the miRNA arm sequences,

inverted BsmBI sites were placed internal to the arms

of pSM30 and pSM155, as well as to those of

pmiR30 and pmiR155 (Fig 2A,B) A pair of

oligo-nucleotide primers with appropriate 4 nucleotides

overhangs can be easily ligated to the cohesive sites

of the vector generated by BsmBI digestion The

sequences and predicted precursor structures from the

oligonucleotide primer pairs used in this study are

lis-ted in Fig 2C

The pSM155 and pSM30 vectors generate

efficient knockdown of target proteins

To examine the efficiency of generation of RNAi for

pSM155 and pSM30, we examined the knockdown of

expression of firefly Luciferase (Luc) HeLa cells were

transfected with the parental and modified vectors

con-taining control and Luc targeting sequences and the

efficiency of down-regulation assessed (Fig 3)

Expres-sion of Luc artificial miRNA from the modified

vec-tors SM155 and SM30 yielded consistently better

knockdown than the parental vectors pmiR155 and

pmiR30, although the degree of improvement was

modest These findings imply that expression of

miRNA-based siRNAs from an intron may improve

RNAi to a small extent

We then examined the down-regulation of an

endo-genous gene, phospholipase D2 (PLD2) PLD2

hydro-lyzes phosphatidylcholine to generate choline and the

bioactive lipid phosphatidic acid, and has been

impli-cated in signal transduction, membrane trafficking,

transformation, and cytoskeletal reorganization [16,17]

HeLa cells were transfected with miRNA-based

con-structs expressing artificial miRNAs against PLD2

Artificial miRNAs expressed from both pmiR155 and

pSM155 significantly down-regulated the expression of

endogenous PLD2, although in this case a

signifi-cant improvement of PLD2 knockdown by

pSM155 construct over pmiR155 was not observed

(Fig 4)

Fig 2 Improved strategy for inserting specific artificial miRNA sequences into the targeting vectors The terminal regions of the arms of the miR155 (A) and miR30 (B) vectors are shaded, and their stems designed to be replaced by artificial miRNA sequences directed against genes of interest Two inverted BsmBI sites (underlined) were introduced as shown Because the cutting sites of BsmBI are outside of the recognition sites, BsmBI digestion leaves the miRNA arms unchanged and generates two different cohesive ends into which a synthetic DNA duplex can be inserted to replace the original miR155 or miR30 sequences The cloning of luc-C artificial miRNA sequences (shown as grey font)

is shown as an example The central black font indicates the loop region (C) Sequences and predicted precursor structures for miRNA-based artificial miRNA used in this study Artificial miRNA expression is driven by a cytomegalovirus (CMV) promoter The stems of miR30 or miR155 were replaced with sequences that were complementary to the firefly luciferase (luc) and phospho-lipase D2 (PLD2) (shown as grey fonts).

Labeling of artificial miRNA-transfected cells

by EGFP is significantly improved by the use

of pSM155 and pSM30

It is necessary to be able to identify artificial

miRNA-transfected cells in some RNAi experiments, especially

when the transfection efficiency is low In the RNA

polymerase III promoter-driven shRNA expression

vectors, fluorescent proteins (e.g., EGFP or dsRed, a

red fluorescent protein from Discosoma sp reef coral)

are typically used as the marker and are expressed

from a separate RNA polymerase II promoter

Expres-sion of the artificial miRNA and the marker from a

single RNA transcript in the miRNA-based expression

systems provides a more tightly linked marker that

directly indicates the level of expression of the artificial

miRNA However, as discussed above, directly linking

the marker ORF to a miRNA-based artificial miRNA

expression cassette as shown in Fig 1A may lead to inefficient translation of the marker protein [6,7] We thus tested if the new pSM155 and pSM30 vectors improve expression of the EGFP marker

HeLa cells were cotransfected with artificial miRNAs directed against firefly luciferase or PLD2 in the pmiR155 or pSM155 vectors described above, and pcDNA3.1-mCherry, which encodes a red fluorescent protein, to identify transfected cells EGFP expressed poorly in the pmiR155 plasmids carrying the luciferase and PLD2 artificial miRNAs However, the expression

of EGFP was dramatically improved in the cells trans-fected with the pSM155 constructs expressing the same artificial miRNAs (Fig 5A) To further confirm that the pSM155 indeed increases expression of the marker protein, expression of EGFP was also measured by western blotting HeLa cells were cotransfected with the artificial miRNAs against firefly luciferase or PLD2 in the pmiR155 or pSM155 vectors, and pRK-human IgG, as a transfection and loading control EGFP expressed poorly in the cells transfected with the pmiR155 constructs, but at very high levels in the cells transfected with pSM155 constructs (Fig 5B) We also compared the expression of EGFP when the EGFP ORF is directly linked to the miR30 artificial miRNA expression cassette (pmiR30) or to the same cassette located inside the synthetic intron (pSM30, Fig 1C,D) Again, the expression of EGFP was signifi-cantly improved for the pSM30 artificial miRNA tar-geting vectors, as measured by fluorescent microscopy (Fig 5C) and western blotting (Fig 5D) These results demonstrate that introducing the splicing sequences for the miRNA expression cassette is a successful general strategy for improving marker gene protein expression

In this study, insertion of the miRNA-based artificial miRNA expression cassette into an intron

Fig 3 Efficient knockdown of luciferase expression by an intronic miRNA approach HeLa cells were transfected with artificial miRNAs directed against firefly luciferase in pmiR155 or pSM155 (A), or pmiR30 or pSM30 (B) Renilla luciferase plasmid served as the transfection control The luciferase activities were normalized to the value measured in lysates from cells transfected with control empty vectors The values presented are means with standard deviation (n ¼ 3).

Fig 4 Knockdown of endogenous PLD2 using pmiR155 and

pSM155 HeLa cells were transfected with artificial miRNAs against

luciferase (control) and PLD2 in pmiR155 and pSM155 Cell lysates

were collected for western blotting two days after transfection.

PLD2 and a-tubulin were detected by a polyclonal antibody and a

mouse monoclonal antibody, respectively, followed by goat

anti-rabbit secondary IgG conjugated to Alexa 680 and goat anti-mouse

conjugated to IRDye 800 Fluorescence was quantitated using an

Odyssey infrared imaging system from LI-COR

Bioscience-Biotech-nology (Lincoln, NE, USA).

significantly increased expression of the marker

pro-tein Insertion of a miRNA-based artificial miRNA

expression cassette into an intron was recently reported

by two other groups [4,18] In both cases, the miR155

and miR30 cassettes were placed into the first intron

of the human ubiquitin C gene [4,18] However, the

efficiencies of RNAi and marker gene expression were

not compared between the original and modified

vec-tors Our results demonstrate that the incorporation of

an intronic strategy offers a modest at best

improve-ment in the efficiency of RNAi, but generates a

dramatic improvement in marker gene expression

This result suggests that Drosha processing of the

pri-miRNA is relatively efficient even when the pri-miRNA

cassette is in an exon, but correspondingly that most

of the marker protein expression is lost through

degra-dation of the resulting unstable mRNA that lacks a 5¢

CAP structure (Fig 1A) The success of these vectors

using a synthetic intron also indicates that the

con-served sequences for mRNA splicing (5¢ donor,

branch, and 3¢ acceptor sites) suffice for the efficient

processing of pri-miRNAs

In previous studies, the ORFs for marker proteins

were placed at the 5¢ end of the miRNA expression

cassette and were reported to express at reasonable levels In the current study, in which we placed the ORF for marker proteins at the 3¢ end of the miRNA expression cassette in the ‘classical’ miRNA vectors (pmiR155 and pmiR30), the EGFP was expressed poorly, as judged by both fluorescent microscopy and western blotting Two possibilities may account for this discrepancy: First, placing the marker protein ORFs at the 5¢ end might have interfered with the miRNA processing, causing more unprocessed pri-miRNA to be transported into the cytoplasm If this is the case, then the production of miRNAs should have been less effective Second, placing the miRNA 5¢ to the marker protein ORF in the pmiR155 and pmiR30 vectors as we describe here may have resulted in the presence of RNA secondary structures that decreased translation efficiency for the downstream ORF in unprocessed pri-miRNAs However, expression of the marker (regardless of the placement location) could only occur at the expense of failure of cleavage of pri-miRNA by Drosha [8,9] In contrast and in summary, the RNAi expression vectors we describe here, pSM155 and pSM30, which are designed based on knowledge of miRNA and RNA splicing, provide a

D C

Fig 5 The new pSM155 and pSM30 vectors improve the expression of marker proteins in artificial miRNA-expressing cells All miR155 and miR30 constructs contain an EGFP marker as illustrated in Fig 1 (A) HeLa cells were cotransfected with pmiR155-lucC, pmiR155-PLD2, pSM155-lucC, or pSM155-PLD2, and pcDNA3.1 ⁄ mCherry, which encodes a red fluorescent protein and is used to identify transfected cells Expression of the EGFP marker protein is significantly improved in pSM155 for both constructs tested: whereas EGFP is expressed in all cells expressing mCherry when the pSM155 vector is used, it is only expressed in a few of the cells when pmiR155 is used (B) HeLa cells were cotransfected with pmiR155-lucC (lane 1), pSM155-lucC (lane 2), pmiR155-PLD2 (lane 3), or pSM155-PLD2 (lane 4), and pRK-human IgG, which encodes a human IgG and was used as a transfection and loading control The expression of EGFP and IgG on the western blot was determined by the rabbit polyclonal GFP antibody ⁄ Alexa 680 goat anti-rabbit secondary IgG, and IRDye 800 goat anti-human IgG, respectively (C) HeLa cells were cotransfected with pmiR30-luc549, pmiR30-PLD2, pSM30-luc549, or pSM30-PLD2, and pcDNA3.1 ⁄ mCherry, and were analyzed as in (A) (D) HeLa cells were cotransfected with pmiR30-luc549 (lane 1), pSM30-luc549 (lane 2), pmiR30-PLD2 (lane 3), or pSM30-PLD2 (lane 4), and pRK-human IgG, and were analyzed as in (B).

better approach to achieve efficient expression of both

the RNAi cassette and the marker gene for transiently

transfected cell experiments

Experimental procedures

General reagents and antibodies

Cell culture media, Dulbecco’s Modified Eagle Medium

(DMEM), Opti-MEM-I, and LipofectAMINE Plus were

from Invitrogen (Carlsbad, CA, USA) All other reagents

were of analytical grade unless otherwise specified

The rabbit polyclonal anti-PLD2 was kindly provided by

Y Banno (Gifu University of Tokyo, Gifu, Japan) Rabbit

anti-green fluorescent protein (GFP) was from Abcam

(Cambridge, MA, USA) Monoclonal anti-(a-tubulin) was

from Sigma-Aldrich (St Louis, MO, USA) Goat

anti-mouse and anti-rabbit IgG conjugated to Alexa 680 were

from Invitrogen Goat anti-mouse and anti-human IgG

conjugated to IRDye 800 were from Rockland

Immuno-chemicals (Gilbertsville, PA, USA)

Plasmid construction

pcDNA3.1-mCherry was constructed by removing mCherry

from pRSET-B-mCherry [19] (provided by R Y Tsien) with

BamHI and HindIII, and ligating it into pcDNA3.1⁄ Zeo(–)

(Invitrogen) cut with these same enzymes

The pmiR30 vector without GFP was constructed by

clo-ning the miR30 arms from the pSM2 (cut by SalI and

MfeI) (provided by G Hannon) into the XhoI and EcoRI

sites of pcDNA3.1⁄ myc-His(–)A (all sites were destroyed),

and subsequently inserting a pair of oligos, 5¢-tcgagaa

ggtatattgctgttgacagtgagcgagagacggaagccacagacgtctcatgcctac

tgcctcgg-3¢ and 5¢-aattccgaggcagtaggcatgagacgtctgtggcttccgt

ctctcgctcactgtcaacagcaatataccttc-3¢ into the XhoI and EcoRI

sites of the resulting plasmid The pmiR30 used in this

study (containing an EGFP ORF) was generated by

sub-cloning the miR30 cassette into the NheI and Acc65I sites

of pEGFP-N1 pmiR155 was generated by insertion of a

pair of oligos, 5¢-tcgacttctagagctctggaggcttgctgaaggctgtatgc

tagagacgtacagatgcgtctcacaggacacaaggcctgttactagcactcacatgg

aacaaatggccg-3¢, and 5¢-aattcggccatttgttccatgtgagtgctagtaaca

ggccttgtgtcctgtgagacgcatctgtacgtctctagcatacagccttcagcaagcct

ccagagctctagaag-3¢, into the XhoI and EcoRI sites of

pEG-FP-N1 Two inverted BsmBI sites were introduced to

facili-tate subsequent insertion of artificial miRNAs

Two steps of cloning were used to construct vectors

expressing miR30- and miR155-based artificial miRNAs,

pSM30 and pSM155 Part of the cytomegalovirus (CMV)

promoter and a synthetic exon and intron were amplified

from pCI-Neo (Promega, Madison, WI, USA) by PCR

using primers 5¢-gtacatcaagtgtatcatatgcc-3¢ and 5¢-gtctgaatt

catcgtccgtcgaccgaaacgcaagagtcttctctgtc-3¢, and then cut by

NdeI and EcoRI The digested PCR product was then ligated to a pair of oligos containing several restriction sites, 5¢-aattcggcgctagctgctgatatcgcatacgcgtggaccagataggcacct attggtcttactgacatccactttgcctttctctccacaggtgtcg-3¢ and 5¢-gtac cgacacctgtggagagaaaggcaaagtggatgtcagtaagaccaataggtgcctat ctggtccacgcgtatgcgatatcagcagctagcgccg-3¢, and pEGFP-N1 cut by NdeI and Acc65I, to generate pEGFP-N1-Intron pSM30 and pSM155 were then generated by subcloning the miR30 expression cassette from pmiR30, and the pair

of oligos used to generate pmiR155, into the XhoI and EcoRI sites of pEGFP-N1-Intron, respectively A pair of oligos including cohesive ends and a specific sequence for each artificial miRNA (64 nucleotides for the miR155-based system and 67 nucleotides for the miR30-miR155-based sys-tem) were annealed, and cloned into the corresponding ends created by BsmBI digestion in the vectors (Fig 2A,B) The selection of target sequences and design of artificial miRNA stem-loops were based on the algorithms accessible at http://www.invitrogen.com/rnai (for miR155 system), http:// codex.cshl.edu (for miR30 system), and the published guide-lines for selecting highly effective siRNA sequences [20] The oilgos for candidate sequences also contained cohesive ends for our simplified cloning strategy The artificial miRNA sequences and predicted precursor structures used in this study are summarized in Fig 2C

Cell culture and transfection HeLa cells were maintained in DMEM supplemented with 10% (v⁄ v) calf serum, 100 UÆmL)1 penicillin, and

100 lgÆmL)1 streptomycin For transfections, cells were grown in 6-well or 12-well plates and then switched into Opti-MEM I media before being transfected with 1 lg or 0.5 lg of DNA per well using LipofectAMINE Plus Four hours post transfection, the media was replaced with fresh growth medium and the cells incubated for an additional 24–48 h

Luciferase assay HeLa cells were plated in 12-well plates one day prior to transfection The cells were transfected with a plasmid encoding firefly luciferase driven by a CMV promoter (0.4 lg), pRL-TK DNA (0.1 lg), which encodes Renilla luciferase, and artificial miRNAs or vector control Cells were harvested 48 h after transfection and luciferase activity measured using the Dual-Luciferase Reporter Assay System from Promega (Madison, WI, USA) Luciferase activity was defined as the ratio of firefly luciferase activity to Renilla luciferase activity The relative luciferase activity was then normalized to the relative activity observed with transfection of control empty vectors expressing the miRNA arms but not artificial miRNAs

Western blotting

Twenty micrograms of total cell lysates were separated

using 8% (w⁄ v) SDS ⁄ PAGE, transferred to nitrocellulose

membrane, probed overnight with primary antibodies,

washed, and incubated with secondary antibody conjugated

to Alexa 680 or IRDye 800 Fluorescent signals were

detec-ted with an Odyssey infrared imaging system from LI-COR

Biosciences – Biotechnology (Lincoln, NE, USA)

Acknowledgements

The authors thank Dr Yoshiko Banno for the PLD2

antibody, Dr Greg Hannon for the pSM2 vector, Dr

Roger Y Tsien for the pRSET-B-mCherry, and Dr

Jen-Chih Hsieh for the pRK-human IgG construct

We also thank Dr Jian Cao for allowing us to use his

fluorescent microscope This work was supported by a

Scientist Development Grant from the American Heart

Association to GD (0430096 N) and research grants

from National Institutes of Health to GD

(GM071475) and MAF (DK64166 and GM71520)

References

1 Brummelkamp TR, Bernards R & Agami R (2002) A

system for stable expression of short interfering RNAs

in mammalian cells Science 296, 550–553

2 Paddison PJ, Caudy AA, Bernstein E, Hannon GJ &

Conklin DS (2002) Short hairpin RNAs (shRNAs)

induce sequence-specific silencing in mammalian cells

Genes Dev 16, 948–958

3 Zeng Y, Wagner EJ & Cullen BR (2002) Both natural

and designed micro RNAs can inhibit the expression of

cognate mRNAs when expressed in human cells Mol

Cell 9, 1327–1333

4 Chung KH, Hart CC, Al-Bassam S, Avery A, Taylor J,

Patel PD, Vojtek AB & Turner DL (2006) Polycistronic

RNA polymerase II expression vectors for RNA

inter-ference based on BIC⁄ miR-155 Nucleic Acids Res 34,

doi: 10.1093/nar/gkl143

5 Silva JM, Li MZ, Chang K, Ge W, Golding MC,

Rickles RJ, Siolas D, Hu G, Paddison PJ, Schlabach

MR et al (2005) Second-generation shRNA libraries

covering the mouse and human genomes Nat Genet 37,

1281–1288

6 Stegmeier F, Hu G, Rickles RJ, Hannon GJ & Elledge

SJ (2005) A lentiviral microRNA-based system for

single-copy polymerase II-regulated RNA interference

in mammalian cells Proc Natl Acad Sci USA 102,

13212–13217

7 Dickins RA, Hemann MT, Zilfou JT, Simpson DR, Ibarra I, Hannon GJ & Lowe SW (2005) Probing tumor phenotypes using stable and regulated synthetic micro-RNA precursors Nat Genet 37, 1289–1295

8 Cullen BR (2004) Transcription and processing of human microRNA precursors Mol Cell 16, 861–865

9 Kim VN (2005) MicroRNA biogenesis: coordinated cropping and dicing Nat Rev Mol Cell Biol 6, 376– 385

10 Denli AM, Tops BB, Plasterk RH, Ketting RF & Hannon GJ (2004) Processing of primary microRNAs

by the Microprocessor complex Nature 432, 231–235

11 Han J, Lee Y, Yeom KH, Kim YK, Jin H & Kim VN (2004) The Drosha-DGCR8 complex in primary micro-RNA processing Genes Dev 18, 3016–3027

12 Lee Y, Ahn C, Han J, Choi H, Kim J, Yim J, Lee J, Provost P, Radmark O, Kim S et al (2003) The nuclear RNase III Drosha initiates microRNA processing Nature 425, 415–419

13 Zeng Y, Yi R & Cullen BR (2005) Recognition and cleavage of primary microRNA precursors by the nuclear processing enzyme Drosha Embo J 24, 138–148

14 Gregory RI, Yan KP, Amuthan G, Chendrimada T, Doratotaj B, Cooch N & Shiekhattar R (2004) The Microprocessor complex mediates the genesis of micro-RNAs Nature 432, 235–240

15 Lund E, Guttinger S, Calado A, Dahlberg JE & Kutay

U (2004) Nuclear export of microRNA precursors Science 303, 95–98

16 Du G, Huang P, Liang BT & Frohman MA (2004) Phospholipase D2 localizes to the plasma membrane and regulates angiotensin II receptor endocytosis Mol Biol Cell 15, 1024–1030

17 Frohman MA, Sung T-C & Morris AJ (1999) Phospho-lipase D Structure and Regulation Biochem Biophys Acta 1439, 175–186

18 Zhou H, Xia XG & Xu Z (2005) An RNA polymerase

II construct synthesizes short-hairpin RNA with a quan-titative indicator and mediates highly efficient RNAi Nucleic Acids Res 33, doi: 10.1093/nar/gni061

19 Shaner NC, Campbell RE, Steinbach PA, Giepmans BN, Palmer AE & Tsien RY (2004) Improved monomeric red, orange and yellow fluorescent proteins derived from Discosomasp red fluorescent protein Nat Biotechnol 22, 1567–1572

20 Ui-Tei K, Naito Y, Takahashi F, Haraguchi T, Ohki-Hamazaki H, Juni A, Ueda R & Saigo K (2004) Guide-lines for the selection of highly effective siRNA sequences for mammalian and chick RNA interference Nucleic Acids Res 32, 936–948