... homoserine kinase mevalonate kinase phosphomevalonate kinase (GHMP) kinase superfamily of enzymes that are known to have a left-handed b–a–b fold, which is found in other RNA ⁄ DNA binding proteins ... both ATP and mevalonate inhibit the binding of MVK to LHR mRNA, the present investigation examines whether the catalytic site of this multifunctional protein partic...
Ngày tải lên: 16/03/2014, 06:20
... contains 535 amino acids with a calculated average molecular mass of 57 752 Da and the a- subunit contains 808 amino acids with a calculated average molecular mass of 87 392 Da The total calculated ... (ggcaggaattgaatgcag) or the known 3¢ end of the xdhB gene (gcccagtacctacaagattc) Localization of xdhAB genes on the C acidovorans plasmid was established using the Al...
Ngày tải lên: 16/03/2014, 23:20
Báo cáo " THE HYPERSURFACE SECTIONS AND POINTS IN UNIFORM POSITION " potx
... Proposition 2.2] that Lα is uniquely determined up to isomorphisms The hypersurface sections and points in uniform position 27 Lemma 1.1 [4, Theorem 3.4] Let L be a finitely generated R-module Then ... (λ) The hypersurface sections and points in uniform position 29 By transformation xi = yi , i = 0, , n, and chose a = b01 , the form at(x) is what we (λ) want...
Ngày tải lên: 28/03/2014, 13:20
Báo cáo hóa học: " Research Article Joint Estimation of Mutual Coupling, Element Factor, and Phase Center in Antenna Arrays" pdf
... “Direction finding in the presence of mutual coupling, IEEE Transactions on Antennas and Propagation, vol 39, no 3, pp 273–284, 1991 [11] T Su, K Dandekar, and H Ling, “Simulation of mutual coupling effect ... y , and f (θ) are unknown One of the novel aspects of the proposed estimator is the inclusion of the element factor, f (θ), as a jointly unknown parameter durin...
Ngày tải lên: 22/06/2014, 19:20
Báo cáo khoa học: " Variation in the position of resin canals in the needles of Abies species and provenances" docx
... that the position of the resin canals is marginal in seedlings of A balsamea, A lasiocarpa, and A fraseri in the USA, whereas in the needles of the adult and mature trees of the same species, the ... that the marginal location of resin canals at re a juvenile stage is a common featu in the genus Abies Kormutäk (1985), comparing the pos...
Ngày tải lên: 08/08/2014, 23:22
Báo cáo y học: " Landmine injuries at the Emergency Management Center in Erbil, Iraq" potx
... al.: Landmine injuries at the Emergency Management Center in Erbil, Iraq Conflict and Health 2010 4:15 Abbreviations EMC: Emergency Management Center; UXO: Unexploded ordinance Acknowledgements The ... study period, 285 patients were admitted to EMC for landmine injuries These injuries have resulted from 255 incidents including 27 multi-causality incidents; 24 i...
Ngày tải lên: 13/08/2014, 14:20
Báo cáo y học: "Availability of a pediatric trauma center in a disaster surge decreases triage time of the pediatric surge population: a population kinetics model" ppsx
... Availability of a pediatric trauma center in a disaster surge decreases triage time of the pediatric surge population: a population kinetics model Erik R Barthel1; James R Pierce1; Catherine ... estimate the effect of the availability of a pediatric trauma center upon the rates of admission and discharge of a disaster surge...
Ngày tải lên: 13/08/2014, 16:20
Báo cáo y học: "Tipping the balance in autoimmune disease" doc
... the balance Another indication from these results is that immune stimuli are implicated in the initiation of autoimmune diseases, supporting the hypothesis that infectious diseases or other inflammatory ... function, in patients with the autoimmune disease IPEX (immunodysregulation, polyendocrinopathy and enteropathy) Deficiency in FoxP3 results in an autoimmune phenot...
Ngày tải lên: 14/08/2014, 08:20
A study on the use of communicative activities in teaching grammar at newstar international language center in Vinh city
... communicate meaning All of the above reasons have inspired me to choose A Study on the Use of Communicative Activities in Teaching Grammar at Newstar International Language Center in Vinh City 1.2 ... What is Grammar Teaching? Traditionally, grammar teaching is considered as the presentation and practice of discrete grammar patterns As illu...
Ngày tải lên: 19/07/2015, 18:38
Luận án TS y học: Patient’s satisfaction with health services at Kuta Blang health center in Bireuen district, Nanggroe Aceh Darussalam province, Indonesia
... Thesis/iv PATIENT’S SATISFACTION WITH HEALTH SERVICES AT KUTA BLANG HEALTH CENTER IN BIREUEN DISTRICT, NANGGROE ACEH DARUSSALAM PROVINCE, INDONESIA NAZIRAH 5037994 ADPM/M M.P.H.M (PRIMARY HEALTH ... as perceived by patients for all health centers in Bireuen district Therefore, this patient satisfaction study was conducted at Kuta Blang heal...
Ngày tải lên: 25/07/2015, 18:36
HYPERBOLICITY AND INTEGRAL POINTS OFF DIVISORS IN SUBGENERAL POSITION IN PROJECTIVE ALGEBRAIC VARIETIES
... {3 distinct points} has finitely many integral points In 1991, M Ru and P.-M Wong [12] estimated the dimensions of integral points in the case Pn -{2n + hyperplanes in general position} In 2008, ... (P )) defines an embedding of V − D into An HYPERBOLICITY AND INTEGRAL POINTS OFF DIVISORS Therefore we say P is an (S, D) -integral point if xi (P ) ∈ OS for all...
Ngày tải lên: 16/10/2015, 14:08
SECOND MAIN THEOREM AND UNICITY OF MEROMORPHIC MAPPINGS FOR HYPERSURFACES OF PROJECTIVE VARIETIES IN SUBGENERAL POSITION
... purpose in the present paper is to give a new second main theorem for meromorphic mappings into complex projective varieties, and a family of hypersurfaces in subgeneral position (in the sense of ... dimension k (k ≤ n) Let {Qi }qi=1 be hypersurfaces of Pn (C) in N -subgeneral SECOND MAIN THEOREM AND UNICITY OF MEROMORPHIC MAPPINGS posit...
Ngày tải lên: 16/10/2015, 14:14