1. Trang chủ
  2. » Luận Văn - Báo Cáo

Báo cáo khoa học: Factors involved in the assembly of a functional molybdopyranopterin center in recombinant Comamonas acidovorans xanthine dehydrogenase pot

11 593 0
Tài liệu đã được kiểm tra trùng lặp

Đang tải... (xem toàn văn)

Tài liệu hạn chế xem trước, để xem đầy đủ mời bạn chọn Tải xuống

THÔNG TIN TÀI LIỆU

Thông tin cơ bản

Định dạng
Số trang 11
Dung lượng 594,36 KB

Các công cụ chuyển đổi và chỉnh sửa cho tài liệu này

Nội dung

Therefore, this system was chosen to study the factors involved in the expression of functional recombinant enzyme in Escherichia coli to provide insights into the assembly of the functi

Trang 1

Factors involved in the assembly of a functional molybdopyranopterin

dehydrogenase

Nikolai V Ivanov1, Frantisek Huba´lek2, Manuela Trani1and Dale E Edmondson1,2

Departments of1Chemistry and2Biochemistry, Emory University, Atlanta, GA, USA

Previous work from this laboratory has shown that the

spectral and functional properties of a prokaryotic xanthine

dehydrogenase from Comamonas acidovorans show some

similarities to those of the well-characterized eukaryotic

enzymes isolated from bovine milk and from chicken liver

[Xiang, Q & Edmondson, D.E (1996) Biochemistry 35,

5441–5450] Therefore, this system was chosen to study the

factors involved in the expression of functional recombinant

enzyme in Escherichia coli to provide insights into the

assembly of the functional Mo-pyranopterin center Genes

xdhAand xdhB (encoding the two known subunits of the

native enzyme) and putative genes xprA and ssuABC were

sequenced Heterologous expression of the xdhAB genes

in E coli JM109(DE3) produced active enzyme The Mo

content was 0.11–0.16 mol per ab protomer, while the Fe

and FAD levels were at stoichiometries similar to that of the

native enzyme The XDH activity increased sixfold when the

culture was grown under conditions of low aeration (6 LÆmin)1) as compared with high aeration (12 LÆmin)1) Co-expression of the xdhAB genes with the Pseudo-monas aeruginosaPA1522 (xdhC) gene increased the level of

Mo incorporated into the expressed enzyme to a 1 : 1 stoi-chiometry Under these conditions, high levels of functional protein (2.284 UÆmg)1 and 8.039 mgÆL)1 of culture) were obtained independently of the level of culture aeration Therefore, the assembly of a functional Mo-pyranopterin center in XDH requires the presence of a functional xdhC gene product The purified, recombinant XDH shows spectral and kinetic properties identical to those of the native enzyme

Keywords: xanthine dehydrogenase; Comamonas acidovo-rans; prokaryote; molybdopyranopterin; FAD

Xanthine oxidoreductases have been extensively

investi-gated because of their physiological and medical importance

[1], serving as a prototype for the study of multiredox

centers in an enzyme system They belong to a group of molybdenum hydroxylases that catalyze the hydroxylation

of substrates using solvent water as the oxygen source Hydroxylation of hypoxanthine to xanthine and of xanthine

to uric acid is considered to be their major biological function in purine catabolism, with either NAD+[for the xanthine dehydrogenase (XDH) form] or O2 [for the xanthine oxidase (XO) form] acting as electron acceptors XDHs are found in both prokaryotes and eukaryotes, with the enzymes isolated from bovine milk, chicken liver and Rhodobacter capsulatus being functionally and struc-turally the best characterized [2,3] These enzymes contain one FAD, two [2Fe)2S] centers, and one molybdopyra-nopterin monophosphate (MPT; the site for substrate hydroxylation), per subunit A cyanolyzable terminal sulfur ligand on the Mo center [4] is absolutely required for catalytic activity

With the recent determinations of the crystal structures of both a eukaryotic (from Bos taurus [5]) and a prokaryotic (from R capsulatus [6]) XDH, detailed mechanistic probes

of the function of the Mo center in the hydroxylation reaction would benefit from site-directed mutagenesis studies of recombinant XO/XDH The detailed molecular mechanism of substrate hydroxylation and other questions have remained unanswered owing to a lack of progress in the expression of functional eukaryotic XDHs at high levels Heterologous expression of recombinant Rattus norvegicus XDH in a baculovirus system [7] resulted in a predominantly

Correspondence to D E Edmondson, Department of Biochemistry,

Emory University School of Medicine, Rollins Research Center,

1510 Clifton Road., Atlanta, GA 30322, USA.

Fax: + 1 404 727 3452, Tel.: + 1 404 727 5972,

E-mail: dedmond@bimcore.emory.edu

Abbreviations: IPTG, isopropyl thio-b- D -galactoside; MPT,

molyb-dopyranopterin monophosphate; XDH, xanthine dehydrogenase;

XDH AB , recombinant XDH expressed in Escherichia coli NI453

(without xdhC); XDH ABC , recombinant XDH expressed in

Escherichia coli NI850 (with xdhC); XO, xanthine oxidase.

Enzymes: xanthine dehydrogenase (E.C 1.1.1.204) and xanthine

oxidase (E.C 1.1.3.22); Comamonas acidovorans XdhA (Q8RLC1)

and XdhB (Q8RLC0); Bos taurus XDH (P80457); Rhodobacter

capsulatus XdhA (O54050) and XdhB (O54051); Rhodobacter

capsul-atus molybdopterin cofactor insertase XdhC (Q9 · 7K2);

Pseudo-monas aeruginosa XdhA (Q9I3I9), XdhB (Q9I3J0) and XdhC

(E83456); Escherichia coli putative molybdenum cofactor sulfurase

ycbX (P75863); Escherichia coli putative molybdenum cofactor

inser-tase yqeB (Q46808); Escherichia coli Elongation Factor EF-Tu

(P02990).

Note: nucleotide sequence data are available in the GenBank database

under the accession number AY082333 Version: 11 August, 2003.

(Received 11 August 2003, accepted 9 October 2003)

Trang 2

nonfunctional demolybdo form Attempts to express the

recombinant rat enzyme in the baculovirus system [8,9] were

reported to produce  10% functional enzyme at low

expression levels Expression of Drosphila melanogaster

XDH in Emericella nidulans [10] produced similar results,

yielding unstable recombinant enzyme with low activity

Homologous expression of D melanogaster XDH mutants

in D melanogaster produced minimal levels of the enzyme

(< 10% of native) [11,12] Given the complexity of the

MPT center in XDH, it is not surprising that expression of a

fully functional enzyme has remained a formidable

chal-lenge Successes have been achieved in the expression of the

molybdopyranopterin enzymes sulfite oxidase and

dimethyl-sulfoxide reductase in Escherichia coli [13,14] These Mo

containing enzymes do not have the complication of the

terminal sulfur ligand on the Mo center as a requirement

for activity However, the successful expression of these

enzymes in E coli suggests the potential for success in

expressing a recombinant XDH in this organism

Expression of XDH requires the incorporation of the

MPT center, placement of the terminal sulfur ligand on the

Mo, and the incorporation of two [2Fe)2S] centers and an

FAD into the recombinant enzyme Therefore, the host

organism has to be able to provide these cofactors and the

means for their incorporation into the expressed protein in

order to form an active enzyme

Proteins functioning in the sulfuration of the

molybdo-pyranopterin cofactor have been identified in D

melano-gaster [15,16], Homo sapiens [17], B taurus [18],

Arabidopsis thaliana [19], and E nidulans [16], and are

homologous to prokaryotic NifS-like proteins, which are

involved in Fe–S cluster biogenesis [20] A similar protein,

ycbX, also exists in E coli [16], suggesting that this

bacterium has the machinery to sulfurate the MPT in a

recombinant XDH Genes similar to the recently identified

R capsulatus xdhC(which encodes a 33 kDa protein with

proposed function of either a MPT chaperon or a MPT

insertase) [21] have also been identified in a number of other

prokaryotes (Fig 1), including a weakly homologous gene,

yqeB, in the E coli genome However, no apparent

homologues in eukaryotes have been observed

Previous work from this laboratory has shown that the XDH isolated from Comamonas acidovorans exhibits the same cofactor content and many spectral and kinetic properties similar to those of the eukaryotic enzymes [22] Rather than an a2homodimer of 300 kDa, as observed in eukaryotes, the bacterial enzyme is an a2b2heterotetramer

of subunits exhibiting molecular mass values of 60 kDa (b-subunit) and 90 kDa (a-subunit) As a good deal of information is available in the literature on the C acidovo-rans XDH, attempts of its expression appeared to be a worthwhile effort which, if successful, would provide a system permitting the use of site-directed mutagenesis to probe the functional roles of amino acid residues implicated

in the catalytic mechanism of this class of enzymes

In this article we describe the sequencing, cloning and conditions required for the high-level expression of func-tional recombinant C acidovorans XDH in E coli It is shown that coexpression of the Pseudimonas aeruginosa xdhC gene is required for stoichiometric MPT incorpor-ation into the recombinant protein and for expression of fully functional enzyme While this manuscript was under review, Leimkuhler et al [23] reported the successful expression of R capsulatus XDH in E coli The similarities and differences of the results of their studies with those reported here are discussed

Materials and methods

Reagents, strains and vectors All reagents and medium components were purchased either from Sigma-Aldrich Co or from Fisher Scientific Co E coli JM109(DE3) was a epst from M W Adams (University of Georgia, Athens, GA, USA) E coli strains TOP10 (Invi-trogen Inc., Carlsbad, CA, USA), XL-1-Blue or XL10-Gold (Stratagene Inc., La Jolla, CA, USA) were used for routine transformations Vectors pGEM-5Zf(+) (Promega Co., Madison, WI, USA) and pCR2.1 (Invitrogen) were used for routine cloning, and vector pET23a(+) (Novagen Inc., Madison, WI, USA) was used as the expression vector

C acidovorans(ATCC 15667) was maintained on minimal medium plates, as described previously [22]

DNA purification and manipulation

C acidovoransplasmid preparations were performed using a combination of cell lysis with SDS and equilibrium centri-fugation in CsCl/ethidium bromide gradients [24] Purifica-tion of cloning and expression vectors for use in DNA sequencing was performed using the QIAprep Spin Miniprep kit (Qiagen Inc., Valencia, CA, USA) All DNA manipula-tions were carried out using standard protocols [24]

LASERGENEsoftware (DNAstar Inc., Madison, WI, USA) was used for sequence manipulation and assembly,BLAST

(NCBI, http://www.ncbi.nlm.nih.gov:80/BLAST/) was used

to identify gene homologies, and the Windows version

of CLUSTAL X (NCBI) and BOXSHADE (Swiss Institute

of Bioinformatics, http://www.ch.embnet.org/software/ BOX_form.html) were used to generate multiple protein sequence alignments Promoter regions were predicted using the NNPP server (http://www.fruitfly.org/seq_tools/ promoter.html)

Fig 1 Gene organization of several sequenced prokaryotic XDH Most

prokaryotic xdh operons contain the xdhC gene, encoding a

molyb-dopterin cofactor insertase, located downstream of the xdhAB genes.

The known exceptions are Berkholdaria mallei and

Berkhol-daria pseudomallei In these organisms, the xdhC gene is either absent

or located elsewhere in the genome C acidovorans, Comamonas

acidovorans; P aeruginosa, Pseudomonas aeruginosa; R capsulatus,

Rhodobacter capsulatus; E coli, Escherichia coli.

Trang 3

Peptide sequences of XDH

Large-scale fermentations (200 L) of C acidovorans were

performed at the University of Georgia Fermentation

Facility Enzyme purification from frozen cell paste was

performed using a simplified method, described previously

by Xiang & Edmondson [22]

N-terminal sequence analysis was obtained by automated

Edman degradation of purified XDH blotted onto

poly(vinylidene difluoride) membranes, or of peptides

iso-lated by HPLC at the Emory University Microchemical

Facility using an Applied Biosystems 494cLC Protein

Sequencer A ReflexIII MALDI-TOF (Bruker Daltonics,

Billarica, MA, USA) and API3000 triplequadruple (Applied

Biosystems, Foster City, CA, USA) mass spectrometers

were also used for peptide sequence determination

Gel electrophoresis

SDS/PAGE and native PAGE gels [25] were used to

confirm the identity of recombinant proteins Western blot

analysis was performed using rabbit polyclonal antisera

raised against C acidovorans XDH, as described previously

[22] Proteins were detected by staining with Coomassie

Brilliant Blue (Sigma), or by activity staining in the presence

of xanthine/Nitro Blue tetrazolium [26] Low molecular

weight SDS/PAGE standards (Bio-Rad Laboratory Inc.,

Hercules, CA, USA) and a 1 kb ladder (Promega) were

used, respectively, as protein and DNA standards

Cloning and sequencing of theC acidovorans xdh

genes by PCR

Eleven polypeptides, sequences of which were obtained by

Edman degradation of C acidovorans XDH peptides and

are shown in the multiple alignments (Fig 2), were chosen

to produce degenerate primers DNA sequencing and DNA

synthesis were performed at the Emory University

Micro-chemical Facility

The degenerate primers were used in a stepdown PCR

method, described previously [27], together with 2.6%

dimethylsulfoxide and 1M betaine as additives The PCR

products were extracted using the MinElute Gel Extraction

kit (Qiagen), ligated and then transformed into E coli

TOP10 competent cells according to the TOPO TA cloning

kit (Invitrogen) manual The required clones were identified

by digestion with EcoRI, sequencing and assembly into a

continuous sequence To extend the sequence from both

ends, random primers were generated based on the

repeti-tion frequency of all octamers in the sequenced porrepeti-tion of

the C acidovorans xdh operon using the programOPTFREQ,

written in this laboratory in ANSI C and available from the

authors upon request Four of the highest frequency

octamers (gcaaggcc, cgagctgg, gtggcgca, gcctgcat), with a

GC content close to that of the C acidovorans genome

(68%), were used to generate 3¢ termini of the PCR primers

The 5¢ termini of the PCR primers were synthesized at equal

nucleotide concentrations The second primer was derived

either from the known 5¢ end of the xdhA gene

(ggcaggaattgaatgcag) or the known 3¢ end of the xdhB gene

(gcccagtacctacaagattc) Localization of xdhAB genes on the

C acidovoransplasmid was established using the AlkPhos

Direct System with the 360 bp probe generated by PCR from the forward (5¢-tccatcattcatgacgacc) and reverse (5¢-atgtacggctccgtcttcct) primers and C acidovorans plasmid DNA as a template

Activity and protein assays XDH activity was measured spectrophotometrically by monitoring the production of uric acid at 295 nm (e295¼ 9600M )1Æcm)1) in activity buffer (100 mM Tris/ HCl, 1 mM EDTA, 0.6 mM xanthine and 2 mM NAD+,

pH 7.8) at 25C One unit of XDH activity is defined as the amount of enzyme catalyzing the production of 1 lmol of uric acid per minute at 25C The Biuret [28] or the Bearden [29] assays were used to estimate protein concentration The protein concentrations of purified enzyme samples were determined by measuring the absorption at 450 nm (e450¼ 37 000M )1Æcm)1) The level of functional enzyme refers to XDH species containing a functional Mo catalytic center The functionality is estimated as a ratio of change in the absorbance at 450 nm after anaerobic reduction of the enzyme with 1 mM xanthine relative to the absorption change after reduction by dithionite

Expression of recombinantC acidovorans XDHAB

inE coli The xdhAB genes, containing coding sequences for both a- and b-subunits of C acidovorans XDH, were amplified

Fig 2 Location of the xdhAB gene operon on an isolated Coma-monas acidovorans plasmid Agarose gel (A) and Southern blot (B) analyses of 0.3 lg of purified intact C acidovorans plasmid (lane 2) and of 0.3 lg of plasmid digested with SacII (lane 3) Lane 1 contains 0.5 lg of a 1 kb DNA ladder standard The Southern blot was developed using a 360 bp probe, as described in the Materials and methods Besides being a DNA size marker, lane 1 serves as a negative control, showing that the probe is specific for xdhAB genes Lane 2 demonstrates that the probe highlights the band corresponding to the

C acidovorans plasmid Lane 3 of the gel (A) shows that after incu-bation of the plasmid with SacII, it becomes completely digested; however, on the blot (B) it remains as a sharp band of lower molecular size Lane 4 shows the effect of double digestion of 0.3 lg of C acido-vorans plasmid with NdeI/SacII, which corresponds to a fragment of the plasmid containing the xdhAB gene.

Trang 4

using stepdown PCR [27] mediated by the forward primer

xb101+ (5¢-gccgcccatatgcaccaccaccaccaccacagcaccagtca

gaactct), the reverse primer xa100– (5¢-gtggtgaattcagc

cagtgtgcccttg), and pNIall2 as a template To facilitate

purification of recombinant enzyme, the xb101+ primer

incorporates an encoded hexahistidine tag into the 5¢ end of

the xdhA gene The reaction product of 4.2 kb was purified

and ligated into a pET23a(+) vector, producing the

pNI453 expression vector Correctness of the construct

was demonstrated by DNA sequencing The expression

construct, pNI453, was introduced into E coli

JM109(DE3) using electroporation (400 lL cuvettes,

2 mm gap, 2500 V,  5 ms), according to the

manufac-turer’s manual The resulting E coli strain, NI453, was

cultured overnight (16 h), at 21C in LBANG media

(Luria–Bertani medium supplemented with 100 mgÆL)1

ampicillin, 1 mM guanosine and 0.25 mM sodium

molyb-date), without isopropyl thio-b-D-galactoside (IPTG)

induc-tion For large-scale preparations, two 12-L fermenters

(New Brunswick Scientific, Edison, NJ, USA) were used

for overnight culture (16 h) of E coli NI453 at a stirring

rate of 400 r.p.m with an airflow of either 6 LÆmin)1for

low aerated preparations or 12 LÆmin)1for highly aerated

preparations The cells collected by centrifugation were

stored at)80 C

Preparation and expression of XDHABC, containing the

gene encodingP aeruginosa xdhC, in E coli NI850

The xdhC gene (PA1522) was amplified from genomic

DNA of P aeruginosa PAO1-LAC, via stepdown PCR,

using forward xc1+ (ctgaacaagcttgatcgggaggatgacgag) and

reverse xc1e– (gcggggctcgagtcaggattcgtgggcgc) primers The

PCR product was digested with HindIII/XhoI, purified,

ligated with T4 ligase into plasmid pNI453 and transformed

into E coli JM109(DE3) by electroporation Clones

con-taining the correct inserts were identified by restriction

digests with HindIII/XhoI and by DNA sequencing The

growth of E coli NI850 was performed under conditions

similar to those described for E coli NI453, except that high

aeration was achieved at 6 LÆmin)1 and low aeration at

2 LÆmin)1airflow in a 10 L BIOFLO 3000 bioreactor (New

Brunswick Scientific)

Purification of recombinant XDHABand XDHABC

Cell pastes of E coli strains NI453 and NI850, cultured as

described above, were resuspended in three volumes of

buffer A (50 mM KH2PO4, 1 mM EDTA, 2 mM

2-merca-ptoethanol, pH 7.8) and disrupted using a combination of

lysozyme treatment (0.1 mgÆmL)1 lysozyme incubated at

37C for 20 min) and sonication (five 1 min intervals at an

80% power level of 550 Watts)

The cell extract was clarified by centrifugation at 45 000 g

for 30 min, mixed with 0.8 volumes of DE-52 resin and

packed onto a column of 0.4 volumes of fresh DE-52 in a

batch manner The column was washed with buffer A until

the absorbance at 280 nm (A280) was lower than 0.1; the

washing buffer was then replaced with buffer B (50 mM

KH2PO4, 2 mM2-mercaptoethanol, pH 7.8) After washing

with five column volumes, the protein was eluted with a salt

gradient (0–1 NaCl) in buffer B Fractions containing

catalytic activity were pooled and applied directly to a Ni2+ bound Talon column

To remove nonspecifically bound proteins, the Talon column was washed with buffer C (50 mM KH2PO4,

300 mMNaCl, 5 mMimidazole, 2 mM2-mercaptoethanol,

pH 7.8) until the A280was lower than 0.03 Bound material was eluted with buffer D (50 mMKH2PO4, 300 mMNaCl,

150 mMimidazole, 2 mM2-mercaptoethanol, pH 7.8) The active fractions were pooled, concentrated by ultrafiltration

in an Amicon concentration unit (Millipore, Billerica, MA, USA), and chromatographed on a Sephacryl S-300 (Amer-sham Biosciences) gel filtration column equilibrated with buffer E (50 mMHepes, 1 mMEDTA, 2 mM 2-mercapto-ethanol, pH 7.8), to exchange the buffers from D to E, concentrated by ultrafiltration and stored at)80 C The recombinant enzymes purified from E coli strains NI453 and NI850 were named XDHAB and XDHABC, respect-ively,

Protein characterization UV/Vis spectra were measured using a Lambda 2 spectro-meter (Perkin-Elmer) at 25C using buffer E as a reference

CD spectra were recorded in 10 mm path length cells on an AVIV 62DS spectrometer EPR spectral data were recorded using a Bruker ER-200D spectrometer equipped with

an Oxford Instruments cryogenic system for liquid He temperatures

Metal and cofactor analysis Prior to the metal and cofactor analysis, protein solutions were passed through a small Chelex-100 column to remove all adventitious metals Mo analysis was performed using the dithiol method [30], while iron analysis was performed

by using the modified ferrozine complex method [31] Metal analysis of the recombinant protein samples were also performed using Thermo Jarrel-Ash965 inductively coupled argon plasma spectroscopy at the Chemical Analysis Laboratory, University of Georgia The flavin content of recombinant protein samples was measured by UV/Vis absorption spectra after acid precipitation of the protein [32]

GenBank accession number The DNA sequences of xdhAB, xprA and ssuACB are available in GenBank (accession number AY082333)

Results

Gene localization and sequence The observation of a naturally occurring plasmid as part of the C acidovorans genomic DNA [26] raised the question of location of the xdhAB operon The plasmid size is estimated

to be 24 kb, by comparison to the mobility of a supercoiled DNA standard on electrophoresis (data not shown) Agarose gel (Fig 2A) and Southern blot (Fig 2B) analyses

of the intact and of SacII digested C acidovorans plasmid DNA provide direct evidence that the xdhAB genes are located on the plasmid

Trang 5

Amino acid sequences obtained by Edman degradation of

tryptic or Lys-C generated peptides of purified C

acidovo-rans XDH were used to design primers according to the

alignment of the peptide sequences with B taurus, D

mel-anogaster, and R norvegicus XDHs (Figs 3 and 4) The

stepdown PCR, with addition of dimethylsulfoxide and

betaine, was used to overcome the high GC content

( 68%) typical of the Comamonas genus The resulting

sequence assembled from sequencing reads of the PCR

clones covered both xdhAB genes separated by one

adeno-sine nucleotide, as determined from the alignment of N- and

C-terminal protein sequences from both subunits; their

translated amino acid sequences are shown in Figs 3 and 4

All peptide sequences (Figs 3 and 4), identified by Edman

degradation, and by MALDI and ESI mass matching, were

located on the protein sequence that corresponded to the

xdhAB nucleotide sequence According to the sequence

obtained, the b-subunit contains 535 amino acids with a

calculated average molecular mass of 57 752 Da and the

a-subunit contains 808 amino acids with a calculated average

molecular mass of 87 392 Da The total calculated average

molecular mass of the heterotetrameric (a2b2) protein is

290 298 Da Electrospray MS of purified C acidovorans

XDH showed the a-subunit mass to be 87 427 ± 30 Da

and the b-subunit mass to be 57 774 ± 15 Da (data not

shown) The differences between the observed and

calcula-ted masses, 35 Da for the a-subunit and 22 Da for the

b-subunit, are within the experimental error of the

instru-ment These data also demonstrate that the enzyme does not

contain any detectable post-translational modifications

Four additional genes, with homologs in P aeruginosa and E coli genomes, encoding putative xanthine/uracil permease (xprA) and three subunits of the putative sulfo-nate ATP-binding cassette transporter (ssuACB), were identified by extension of the 3¢ terminal sequence of the xdhAB genes None of these genes were similar, at the protein level, to the xdhC gene, which is a member of the majority of bacterial xdh operons (Fig 1) Prediction of

a prokaryotic promoter in front of xdhA and in front

of ssuA suggests that xprA is cotranscribed with xdhAB genes as a single operon The presence of a predicted Shine– Dalgarno motif for xdhB in front of the xdhA stop codon implies translational coupling between the two subunits A similar relationship is observed between xdhABC genes in

P aeruginosaand R capsulatus

Expression of recombinantC acidovorans XDHAB

and XDHABCinE coli Optimal expression levels of the functional enzyme XDHAB

in E coli requires the presence of 0.25 mMNa2MoO4and

1 mM guanosine in the media, no IPTG induction, and a low (6 LÆmin)1) air supply Guanosine is added because it is

a known precursor in the biosynthesis of the MPT cofactor and is permeable to the cell Induction of XDHAB expression with IPTG concentrations ranging from 0 to

1 mM results in decreased specific activities in cellular extracts

The influence of aeration levels on XDH functionality was tested because the enzyme catalyzing sulfuration of the

Fig 3 Sequence alignment for the small subunit (xdhA) The sequence of the small subunit of Comamonas acidovorans was aligned with those of the XDHs from Bos taurus [38] and Rhodobacter capsulatus [3] XDH peptides identified by Edman degradation (solid arrows), or by MALDI or ESI mass matching (dotted arrows), are indicated The peptides used to generate PCR primers are underlined with double arrows.

Trang 6

Mo cofactor has been shown to utilize cysteine as the source

of sulfur [19] Therefore, the level of sulfuration of

recombinant XDH may be influenced by the redox state

of the thiols in the cell Indeed, the level of XDHABactivity

observed in crude cell extracts was 60-fold higher in cell

cultures grown with a lower level of aeration (6 L of air

min)1) than that observed with a higher level of aeration

(12 L of air min)1) (Table 1)

Under optimal conditions, functional XDHAB was

observed at a level (0.25 UÆmg)1 of total protein and

2.16 mg of enzyme L)1 of culture) comparable to that

produced by C acidovorans grown on minimal media

containing hypoxanthine (0.46 UÆmg)1 and 1.87 mgÆL)1)

[22] and lower relative to the reported expression of

R capsulatus XDHABC in E coli (12.5 mgÆL)1) [23] As

we were unable to isolate xdhC from C acidovorans, a gene

encoding xdhC was cloned from P aeruginosa Its

coex-pression within the xdhABC excoex-pression construct resulted in

the expression (2.28 UÆmg)1and 8.04 mgÆL)1) of functional

C acidovoransXDHABCin E coli cellular extracts It also showed that the xdhC gene product is active in the assembly

of an XDH from a different bacterial species In contrast to the results obtained with the expression of XDHABin E coli (see above), the level of culture aeration had no influence

on the level of expression of observed XDHABCactivity Purification and characterization of XDHABand XDHABC

XDHAB and XDHABCwere purified, as described in the Materials and methods, and visualized on Western blots (Fig 5A), confirming the cross-reactivity with antisera raised against C acidovorans XDH Activity staining with xanthine/Nitro Blue tetrazolium of native gels containing equal levels of activity (10 lU) of recombinant and native enzymes showed no detectable difference in the mobility of intact functional enzyme (Fig 5B) All expressed enzyme samples migrated as a single band on native PAGE and

as two bands on the denaturing gels (Figs 5A and 4C),

Fig 4 Sequence alignment for the large subunit (xdhB) The sequence of the large subunit of Comamonas acidovorans was aligned with those of the XDHs from Bos taurus [38] and Rhodobacter capsulatus [3] XDH peptides identified by Edman degradation (solid arrows), or by MALDI or ESI mass matching (dotted arrows), are indicated The peptides used to generate PCR primers are underlined with double arrows.

Trang 7

corresponding to the two subunits of 60 and  90 kDa,

respectively

Although Western blot analysis showed that both XDH

subunits are expressed at comparable levels, the expression

levels of neither the XDH subunits nor XdhC were

sufficiently high to be detected in crude cellular extracts by

staining with Coomassie Brilliant blue (data not shown)

SDS/PAGE gels (Fig 5C) of purified XDH and

XDHABC showed a co-purified third band at  40 kDa (the band is very insubstantial in the XDHABpreparation) MALDI-TOF MS analysis identified this protein to be the

E colielongation factor EF-Tu (43 kDa) The presence of EF-Tu in the XDH preparation is not expected to affect any

of the kinetic parameters, or spectral or physical properties

of the purified enzyme, because the XDH concentration is calculated based on the absorbance at 450 nm contributed

by the [2Fe)2S] centers and the FAD cofactor

The specific activity of the purified XDHABgrown under conditions of high aeration was 67-fold lower than that grown under conditions of low aeration (Table 1) Both enzyme preparations contained the appropriate levels of Fe–S and FAD cofactors, as judged by their respective visible absorption spectra (Fig 6) and by metal and flavin analyses Both preparations contained low levels of Mo

Table 1 Effect of culture aeration on the functionality and cofactor content of pure recombinant Comamonas acidovorans xanthine dehydrogenase (XDH) expressed in Escherichia coli NI453 (XDH AB ) and NI850 (XDH ABC ).

C acidovorans preparation [22] Low aeration High aeration Low aeration High aeration

a Based on the moles of ab protomer determined from the absorption at 450 nm and e 450 ¼ 37 000 M )1 Æcm)1.

Fig 5 Electrophoretic characterization of recombinant XDH Western

blot analysis (A) with 0.25 lg of protein loaded per lane, (B) native

PAGE activity staining with 10 lU of enzyme, and (C) a Coomassie

Brilliant blue-stained SDS/PAGE gel with 5 lg of protein loaded per

lane, compares purified XDH AB (lane 1), XDH ABC (lane 2) and native

Comamonas acidovorans XDH (lane 3) The third band of  40 kDa

observed in C is identified as Escherichia coli EF-Tu and is copurified

in both recombinant preparations (more clearly visible in the XDH ABC

preparation).

Fig 6 UV/Vis absorption spectra of pure enzymes (A) Native Com-amonas acidovorans xanthine dehydrogenase (XDH), (B) recombinant XDH AB purified from Escherichia coli NI453 expressed at low aer-ation, (C) recombinant XDH AB purified from E coli NI453 expressed

at high aeration and (D) the enzyme XDH ABC isolated from E coli NI850 expressing the xdhABC construct (similar for either aeration) The absorption spectra have been offset from one another for clarity of presentation.

Trang 8

(10–15% of a stoichiometric level) Therefore, the

similar-ities of metal and flavin content for both preparations

suggest that the difference in activity is directly linked to the

difference in the level of sulfuration of their respective MPT

centers We estimate that the enzyme preparation purified

from cells grown under aeration conditions of 6 L of air per

min has all of its Mo centers in an active, sulfurated form,

whereas the enzyme purified from cells grown under

aeration of 12 L of air per min has less than 2% of its

Mo centers in an active, sulfurated form

It was previously shown that R capsulatus xdhC is

required for efficient incorporation of MPT into R

capsul-atusXDH [21] Similarly, it appears that the coexpression of

xdhCwith the xdhAB genes is required for the expression

of functional recombinant C acidovorans XDH (termed

XDHABC) with a stoichiometric level of MPT Growth of

this strain under aeration at 6 LÆmin)1, and purification of

the expressed XDHABC, resulted in an enzyme preparation

with a stoichiometric quantity of MPT (Table 1) as well as

of FAD and Fe–S centers and a level of functionality

approaching 100% Growth of the E coli cultures under

different aeration conditions did not significantly affect the

functionality of the recombinant XDHABC(Table 1)

These results provide direct evidence that the gene

product of xdhC functions in E coli as either MPT or Mo

insertase, as suggested previously, by the work of

Leimkuh-ler et al [21], on R capsulatus XDH expressed in R

cap-sulatus.The protein product of xdhC appears to exhibit a

redox role in maturation of the XDHABCby eliminating the

dependence of its functional expression on the redox state of

the cell (Table 1) These data also show that P aeruginosa

xdhCis able to participate in assembly of the C acidovorans

XDH in E coli

The steady state kinetic properties of the purified

recombinant C acidovorans XDHABCare essentially

iden-tical (Table 1) to those determined previously for the

naturally occurring enzyme [22] Therefore, the recombinant

enzyme appears to be functionally identical to the native

enzyme

Spectroscopic studies of purified XDHAB and XDHABC

The UV/Vis spectrum of recombinant C acidovorans

XDHAB (Fig 6), purified from a 6 LÆmin)1 aeration

preparation of E coli NI453, is very similar to the spectrum

of native enzyme in either an oxidized (as isolated) or a

reduced (with 0.6 mM xanthine) state In a range of

300–500 nm, the Fe–S clusters exhibit spectral properties

typical of a [2Fe)2S] ferredoxin absorption maxima (315,

420, and 467 nm), which overlap with FAD absorption

maxima at 370 and 450 nm [33] As observed with bovine

and native C acidovorans XDHs, the absorbance in the

300–500 nm range is bleached upon addition of 1 mM

xanthine owing to reduction of the Fe–S and FAD centers,

and it is reduced even further upon addition of dithionite

crystals, indicating that the enzyme exhibits 15%

func-tionality (Table 1) Similarities of the oxidized and reduced

absorption spectra of the recombinant XDH, with those of

the native XDH and of bovine XDH, are consistent with the

metal and flavin analysis data (Table 1) and demonstrate

the presence of two nonidentical [2Fe)2S] iron–sulfur

centers and an FAD cofactor

The identity of the two [2Fe)2S] iron–sulfur clusters was further confirmed by CD (Fig 7) and EPR (Fig 8) spectroscopies Previous data in the literature have reported that the visible CD spectrum of bovine milk XO is dominated by contributions from the two [2Fe)2S] centers [33], a property also exhibited by C acidovorans XDH [22] Figure 7 shows the visible CD spectra of the recombinant XDHABin its oxidized form, after reduction with xanthine, and after reduction with dithionite The overall shape of the oxidized spectrum was identical to that of native C acido-voransXDH and similar to that published [34] for bovine milk XO, showing a characteristic positive band with a maximum at 430–440 nm and two negative bands with maxima at 370–380 nm and at 560–570 nm Similar CD spectra were obtained for purified preparations of XDHAB (grown at low aeration) and with XDHABC (independent

of the culture aeration level) The level of reduction by xanthine was higher than expected from the level of functionality (15%), owing to the reduction of non-functional enzyme by non-functional XDH in the time required for collection of six CD scans These spectral data further support the fact that recombinant XDH contains [2Fe)2S] clusters identical to those in the naturally occurring enzyme Low temperature EPR spectra of reduced samples of purified recombinant preparations (Fig 8), taken at 10 K and 70 K, demonstrate the presence of [2Fe)2S] I and the fast-relaxing [2Fe)2S] II (observed at temperatures lower than 20 K) in both forms of recombinant enzyme (XDHAB and XDHABC) Thus, the incorporation of these two Fe–S clusters within the enzyme is independent of the coexpres-sion of xdhC The EPR spectrum of XDH at 70K shows

Fig 7 CD spectra of recombinant xanthine dehydrogenase (XDH) AB

(low aeration) in oxidized (solid line), xanthine reduced (dashed line) and dithionite reduced (dotted line) states The CD spectrum for XDH ABC

was identical (only one for the oxidized form is shown, in large dots) Upon addition of xanthine, the reduction was incomplete, as seen by the further reduction with dithionite, and indicates the presence of nonfunctional enzyme The level of reduction by xanthine was higher than expected from the level of functionality, as a result of the reduction of nonfunctional enzyme by functional XDH in the time required for collection of six CD scans Conditions: 22.89 l M of XDH AB (low aeration) and 5.4 l M of XDH ABC (low aeration) in

50 m M Hepes, 1 m M Tris, pH 7.8, 25 C Excess 1 m M xanthine and a few crystals of dithionite were used for reduction.

Trang 9

a signal at  349 mT caused by Mo(V), which is not

apparent in the spectrum of XDHABat 60K because the Mo

content is 10-fold lower

Discussion

Our knowledge of the structure and function of Mo-dependent enzymes has increased dramatically over the past several years as a result of successes in the structural elucidation of a number of enzymes in this class by X-ray crystallography This structural information can be exploi-ted to use site-direcexploi-ted mutagenesis, in a detailed manner, as additional probes of enzyme structure and mechanism The complexity of the molybdopyranopterin site (the catalytic site for most of the enzymes in this class) adds further difficulty in the successful expression of molybdoenzymes in the xanthine oxidoreductase family

The most important factor involved in producing a functional MPT center in recombinant XDH, using the

E coli expression system, is the coexpression of xdhC (thought to be an MPT insertase [21]) Failure to coexpress this protein leads to a recombinant enzyme preparation being highly dependent on the level of culture aeration or redox state of the cell and having a low Mo content (Table 1), consistent with the results of Leimkuhler et al [21] on the expression of R capsulatus XDHABin R cap-sulatuswhere xdhC was disrupted The data presented here show that Fe–S cluster formation and FAD incorporation into the recombinant XDH do not require a functional XdhC

In contrast, Leimkuhler et al [23] find the level of MPT

in their R capsulatus XDH preparation, expressed in

E coli, to be stoichiometric and independent of the presence

of xdhC, and their data suggest that the level of MPT sulfuration is lower in the absence of xdhC than in its presence Assuming that the level of incorporated MPT and

Mo is the same in an enzyme preparation, and that the

R capsulatusXDH is very similar to C acidovorans XDH,

we suggest the following explanation for these seemingly contradictory results

Partial (10%) incorporation of molybdenum into recom-binant C acidovorans XDH expressed in E coli JM109(DE3) may be explained by the presence of an intrinsic E coli Mo insertase It is possible that a product of the E coli gene yqeB, exhibiting weak homology to the

P aeruginosa xdhCor R capsulatus xdhC, can perform this function with a broad specificity for MPT and MGD cofactors However, as the majority of MPT produced by

E coli JM109(DE3) is converted to MGD by MGD synthase [35], only a small amount of MPT is available for incorporation into the expressed apoprotein On the other hand, E coli TP1000, used for the expression of

R capsulatusXDH [23], carries a disrupted MGD synthase and produces MPT as a final product of the cofactor biosynthesis, resulting in its stoichiometric incorporation into R capsulatus XDH From the results presented in this study, one would predict that the expression of the latter enzyme, under low culture aeration conditions, might yield

a fully functional enzyme in the absence of xdhC Alternat-ively, the intrinsic E coli Mo insertase may have a lower insertase activity with the heterologously expressed

C acidovoransXDH than with the R capsulatus enzyme The co-expression of P aeruginosa xdhC with C acido-vorans xdhAB, or R capsulatus xdhC with R capsulatus xdhAB, results in the production of enzymes with stoichio-metric levels of MPT, independently of E coli or of aeration

Fig 8 EPR spectra of dithionite reduced recombinant Comamonas

acidovorans xanthine dehydrogenase (XDH) AB (low aeration) and

XDH ABC preparations All spectra were calculated as an average of

four or five scans to reduce the signal-to-noise ratio The xanthine

reduced spectrum for XDH AB was very weak as only a small fraction

of [2Fe )2S] centers were reduced by the substrate Xanthine-reduced

spectra for XDH ABC were similar in shape and intensity to the

dithionite-reduced spectrum (data not shown), as the enzyme is fully

functional The molybdenum signal at 349 mT was more prominent in

XDH ABC (at 70 K) compared with the XDH AB preparations (A) The

spectra were taken at 12 K (top) and 60 K (bottom) The enzyme

concentration was 81.7 l M in buffer E; microwave frequency

9.65 GHz; microwave power 0.2 mW; modulation frequency

100 KHz; receiver gain 2 · 10 4

; modulation amplitude 1 mT (B) The spectra were taken at 10 K (top) and 70 K (bottom) The enzyme

concentration was 70 l M in buffer E; microwave frequency 9.66 GHz;

microwave power 0.2 mW; modulation frequency 100 KHz; receiver

gain 2 · 10 4

; modulation amplitude 1 mT.

Trang 10

levels, indicating that XdhC is specific for MPT insertion It

remains for future work to delineate the detailed function

and mechanism of the xdhC gene product in MPT insertion

into the molybdoenzymes

The finding that XDHAB activity levels are dependent

on the level of culture aeration suggests that, in the

absence of XdhC, the incorporation of the terminal sulfur

ligand into the Mo center is dependent on the redox state

of the cell [23] Our functionality data suggest that at a

lower culture aeration level, all the molybdenum present

in the XDHAB preparation is sulfurated by an E coli

sulfurase, which may be different from the E coli MPT

insertase and which has a function that is redox state

dependent A multitude of information has accumulated

over the past few years to demonstrate that the enzyme

catalyzing this reaction contains pyridoxal phosphate and

provisions for a persulfide bond formation [16]

Appar-ently, this enzyme is present in E coli and is functional

with the heterologously expressed XDH Current evidence

supports the source of the sulfur moiety to be free cysteine

and that it is required to be in the reduced form to be an

effective sulfur donor [19] We propose the following

explanation for the effect of the level of culture aeration

on the expression of recombinant protein Raising the

cellular redox potential by increasing aeration levels is

expected to reduce the level of cysteine and increase the

level of cystine in the cell, thus reducing the availability of

a sulfur donor for the sulfuration reaction producing

active XDH This would explain the dependence of

activity levels of XDHAB observed on culture aeration

How the presence of XdhC protects against this effect

remains to be established, but does suggest a redox role

for this protein in addition to its insertase function

It is of interest that expression of the MPT-dependent

enzyme rat liver sulfite oxidase in E coli [36] does not

require the coexpression of an MPT insertase, as there was

no mention of a dependence of the level of culture aeration

in the expression of recombinants These results, together

with the results presented in the current report,

demon-strate that the incorporation of MPT into XDH is a more

complex process than the incorporation of MPT into

sulfite oxidase Differences have been observed in the

reactivity of MPT in bovine milk XO compared with that

of rat liver sulfite oxidase [37] The authors propose that

bovine XO contains MPT in the quinonoid dihydro form

and that the MPT in sulfite oxidase is a different dihydro

isomer These suggested differences in the respective MPT

cofactors of these two molybdoenzymes may be related to

differences in requirements for MPT insertion into the

apoproteins

Little is known regarding the structure or mechanism of

the gene product of xdhC It appears to be present as part of

the xdh operon in a number of prokaryotes (Fig 1) A

screen of the genomic DNA library of C acidovorans has

been performed using a probe based on the consensus

sequence of the xdhC genes present in other bacteria and, to

date, has not been successful in identifying xdhC Our failure

to locate the xdhC gene within the xdh gene operon of

C acidovoranssuggests that it resides at another location, as

it appears to be essential for molybdopterin incorporation

into XDH Unfortunately, XdhC proteins are not highly

conserved (P aeruginosa and R capsulatus XdhC proteins

are only 36% identical) and not even present in the xdh operon (Fig 1) of some bacteria Therefore, design of an optimal probe is problematic

The sequence of C acidovorans XDH shows a high level

of identity around the molybdopterin (Fig 9) and [2Fe)2S] centers (residues 45–56, 130–140, 170–182) with other structurally characterized XDHs, despite the lower overall similarity (43% identity/55% similarity to R capsulatus XDH [6] and 31% identity/46% similarity to the bovine enzyme [5]) An example of this structural identity is shown

in Fig 9, where the structure around the MPT site in bovine XDH is shown and the corresponding amino acids in

C acidovorans are shown in parenthesis The residues around the Mo site are identical

The results from this study show the development of an XDH expression system that should be beneficial for future detailed mutagenesis studies on the mechanism of the

C acidovoransrecombinant enzyme with its direct applica-bility to the mechanism of the eukaryotic enzyme Addi-tionally, this system should prove of value as a tool to explore the function of XdhC in its role of assembly of a functional MPT active site in the xanthine oxidoreductase class of enzymes

Acknowledgements

This study was supported by a grant from the National Institutes of Health (GM-29433).

References

1 Harrison, R (2002) Structure and function of xanthine oxido-reductase: where are we now? Free Radic Biol Med 33, 774–797.

2 Hille, R (1996) The mononuclear molybdenum enzymes Chem Rev 96, 2757–2816.

3 Leimkuhler, S., Kern, M., Solomon, P.S., McEwan, A.G., Schwarz, G., Mendel, R.R & Klipp, W (1998) Xanthine dehy-drogenase from the phototrophic purple bacterium Rhodo-bacter capsulatus is more similar to its eukaryotic counterparts

Fig 9 Schematic representation of the active site of the Comamo-nas acidovorans XDHMo center The figure is based on the Bos taurus XDH structure (residues of which are shown in parenthesis) with corresponding conserved C acidovorans XDH residues (shown in bold).

Ngày đăng: 16/03/2014, 23:20

TỪ KHÓA LIÊN QUAN

TÀI LIỆU CÙNG NGƯỜI DÙNG

TÀI LIỆU LIÊN QUAN

🧩 Sản phẩm bạn có thể quan tâm