Sample role plays from ESL role plays

Sample role plays from ESL role plays

Sample role plays from ESL role plays

... guests try to get their money back Preparation - Copy / cut role play cards before class Prepare one role play card per hotel owner and one role play card per pair of guests Divide students into groups ... family’s restaurant, but when you graduated from culinary school it closed because of this restaurant You got a job here so you could destroy the restaurant from the inside It’s a...

Ngày tải lên: 25/08/2016, 12:56

9 154 0
Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

Tài liệu Báo cáo Y học: The b-1,4-endogalactanase A gene from Aspergillus niger is specifically induced on arabinose and galacturonic acid and plays an important role in the degradation of pectic hairy regions pdf

... the arabinogalactans from potato, onion and soy was determined as described [21] Onion arabinogalactan consists of 99% D-galactose and 0.3% L -arabinose and is predominantly linear Potato arabinogalactan ... arabinogalactan consists of 86% D-galactose and 6.6% L -arabinose, while soy arabinogalactan consists of 57% D-galactose and 38% L -arabinose Methylation analysis...

Ngày tải lên: 21/02/2014, 01:21

9 669 0
Báo cáo khoa học: NtKTI1, a Kunitz trypsin inhibitor with antifungal activity from Nicotiana tabacum, plays an important role in tobacco’s defense response pot

Báo cáo khoa học: NtKTI1, a Kunitz trypsin inhibitor with antifungal activity from Nicotiana tabacum, plays an important role in tobacco’s defense response pot

... 5¢-GATTCTTAGCAGGTTCATCGCCATCT-3¢ 5¢-TGCACACACTTGGACAGAACAC-3¢ 5¢-GCGAAAACCTAGCTTGGGGAAG-3¢ 5¢-TATATAACGTGAAATGGACGC-3¢ 5¢-GAAGCTCTTCAGGAGGCACTTCCT-3¢ 5¢-CAATGGTGGGTACGCAGAGAGGAT-3¢ 5¢-GAAGCTTACGTTCCGATGCAAAGTC-3¢ ... three important phytopathogenic fungi: R solani, Rhizopus nigricans and Phytophthora parasitica var nicotianae The antifungal activity towards R solani was prominent (Fig 4...

Ngày tải lên: 23/03/2014, 03:20

13 501 0
Báo cáo Y học: The a1b1 contact of human hemoglobin plays a key role in stabilizing the bound dioxygen Further evidence from the iron valency hybrids potx

Báo cáo Y học: The a1b1 contact of human hemoglobin plays a key role in stabilizing the bound dioxygen Further evidence from the iron valency hybrids potx

... have used this time the valency hybrid tetramers As a result, the b chain was found to acquire a noticeable resistance against the acidic autoxidation in a manner of contacting with the a chain, ... of the a1 b1 or a2 b2 contact greatly suppresses the autoxidation rate, particularly of the b chains [8] In the autoxidation reaction of HbO2, as well a...

Ngày tải lên: 31/03/2014, 15:20

10 651 0
Tài liệu Báo cáo khoa học: Golgi reassembly stacking protein 55 interacts with membrane-type (MT) 1-matrix metalloprotease (MMP) and furin and plays a role in the activation of the MT1-MMP zymogen pdf

Tài liệu Báo cáo khoa học: Golgi reassembly stacking protein 55 interacts with membrane-type (MT) 1-matrix metalloprotease (MMP) and furin and plays a role in the activation of the MT1-MMP zymogen pdf

... et al MT1-MMP and furin can interact with GRASP55 Overexpression of GRASP55 has been found to increase the amount of complex containing MT1MMP and furin, and the expression of a catalytically inactive ... with a full-length furin cDNA, were permeabilized and stained with polyclonal antibodies against furin and GRASP55 Arrows show examples of membrane c...

Ngày tải lên: 18/02/2014, 04:20

18 605 0
Tài liệu Báo cáo khoa học: The most C-terminal tri-glycine segment within the polyglycine stretch of the pea Toc75 transit peptide plays a critical role for targeting the protein to the chloroplast outer envelope membrane ppt

Tài liệu Báo cáo khoa học: The most C-terminal tri-glycine segment within the polyglycine stretch of the pea Toc75 transit peptide plays a critical role for targeting the protein to the chloroplast outer envelope membrane ppt

... derivatives used in this study Name Sequence (residues 91–100) WT polyAla AGG GAG GGA GAA AGA AAG GGD GGE GGL GGN GGS GGP GGGAGGGGGG *SA*AAAAA* AAA******* ****AAA*** *******AAA ****AAAAAA AAA****AAA ... Transit peptide of Toc75 A J Baldwin and K Inoue Fig The biogenesis of pea Toc75 The precursor, intermediate, and mature forms of Toc75 are indicated as prToc75, iToc75...

Ngày tải lên: 19/02/2014, 07:20

9 498 0
Peptidylarginine deiminase (PAD) is a mouse cortical granule protein that plays a role in preimplantation embryonic development docx

Peptidylarginine deiminase (PAD) is a mouse cortical granule protein that plays a role in preimplantation embryonic development docx

... identical to that of ePAD or AAH53724 (an egg and embryo abundant peptidylarginine deiminase) Mouse cortical granules contain PAD To ascertain if mouse cortical granules contain PAD, antibodies made ... a classical marker for mouse oocyte cortical granules [23] This lead to the conclusion that calreticulin is localized in a population of granules that is distinc...

Ngày tải lên: 05/03/2014, 17:20

22 522 0
Báo cáo khoa học: Transmembrane helix 12 plays a pivotal role in coupling energy provision and drug binding in ABCB1 pot

Báo cáo khoa học: Transmembrane helix 12 plays a pivotal role in coupling energy provision and drug binding in ABCB1 pot

... single cysteine mutations, and demonstrated that this helix plays a prominent role in the coupling process in ABCB1 [25–28] A number of mutations in TM6 caused alterations in drug- stimulated ATP ... Catalytic intermediate CM BM FM Basal AMP-PNP Vi trapped Basal AMP-PNP Vi trapped Basal AMP-PNP Vi trapped Basal AMP-PNP Vi trapped Basal AMP-PNP Vi trapped Basal AMP-PNP...

Ngày tải lên: 06/03/2014, 22:21

12 380 0
Báo cáo khoa học: A novel gene, fad49, plays a crucial role in the immediate early stage of adipocyte differentiation via involvement in mitotic clonal expansion docx

Báo cáo khoa học: A novel gene, fad49, plays a crucial role in the immediate early stage of adipocyte differentiation via involvement in mitotic clonal expansion docx

... that the PX domain of p47phox binds intramolecularly to the SH3 domain in the same protein, and that this intramolecular interaction suppresses the lipid-binding activity of the PX domain in the ... 5579 fad49 plays a crucial role in adipogenesis T Hishida et al Fig Characterization of the PX domain of FAD49 (A) Phosphoinositide binding specificity of the...

Ngày tải lên: 16/03/2014, 04:20

13 385 0
Báo cáo khoa học: Peroxisome proliferator-activated receptor a plays a vital role in inducing a detoxification system against plant compounds with crosstalk with other xenobiotic nuclear receptors docx

Báo cáo khoa học: Peroxisome proliferator-activated receptor a plays a vital role in inducing a detoxification system against plant compounds with crosstalk with other xenobiotic nuclear receptors docx

... 5¢-ACCACTCTCTGGATGTGATTGGA-3¢ and 5¢- TCAAGAACATTTTATTTCCCACATTTT-3¢ for Ugt2b5; 5¢-ATTGCCCATATGGTGGCCAAAGGAG-3¢ and 5¢- GGCTGCCACACAAGCGAGTAGGAAT-3¢ for Ugt2b37; 5¢-GGGAAGGACATGAAGGAGAGAGC-3¢ and ... 5¢-AGAGATGATCCCATGAGAAACGG TGAA-3¢ for Cyp 3a4 4; 5¢-AGATCATCATTCCTTGGCA CTGG-3¢ and 5¢- ATTGCAGAAAGGAGGGAAGATGG -3¢ for Cyp 4a1 0; 5¢-CCAGTTGAGTGACGAGGAG ATGG-3¢ and 5¢-TCTGCATGCCCTCAAATGTTACC-...

Ngày tải lên: 16/03/2014, 14:20

9 285 0
Báo cáo khoa học: Acylation of lysophosphatidylcholine plays a key role in the response of monocytes to lipopolysaccharide ppt

Báo cáo khoa học: Acylation of lysophosphatidylcholine plays a key role in the response of monocytes to lipopolysaccharide ppt

... carried out in duplicate isolated and incubated in the same way as the experiments with MonoMac cells (Fig 3) In addition to TNF -a, the in ammatory cytokine IL-6 was also measured to check that ... LPCAT may alter the cell membrane lipid environment so as to favor the assembly of a signaling complex which can then activate the cellular response [15] To elucid...

Ngày tải lên: 31/03/2014, 01:20

7 324 0
Báo cáo hóa học: "Rac1-mediated signaling plays a central role in secretion-dependent platelet aggregation in human blood stimulated by atherosclerotic plaque" ppt

Báo cáo hóa học: "Rac1-mediated signaling plays a central role in secretion-dependent platelet aggregation in human blood stimulated by atherosclerotic plaque" ppt

... was added to the anticoagulant [17] The final concentration of ASA in the blood was mM Platelet aggregation and ATP-secretion in blood Whole blood platelet aggregation was determined by impedance ... than aspirin in inhibiting the effect of ADP on platelets in blood and (2) NSC23766 inhibits a- granule secretion and platelet aggregation stimulated by ADP ind...

Ngày tải lên: 18/06/2014, 16:20

10 441 0
báo cáo hóa học: " LPS preconditioning redirects TLR signaling following stroke: TRIF-IRF3 plays a seminal role in mediating tolerance to ischemic injury" doc

báo cáo hóa học: " LPS preconditioning redirects TLR signaling following stroke: TRIF-IRF3 plays a seminal role in mediating tolerance to ischemic injury" doc

... this article as: Vartanian et al.: LPS preconditioning redirects TLR signaling following stroke: TRIF-IRF3 plays a seminal role in mediating tolerance to ischemic injury Journal of Neuroinflammation ... detrimental effect of TLR signaling is associated with the pathways that lead to NFB activation and pro-inflammatory responses In contrast, TLR si...

Ngày tải lên: 19/06/2014, 22:20

12 217 0
báo cáo hóa học: " Interferon regulatory factor 3 plays an anti-inflammatory role in microglia by activating the PI3K/Akt pathway" doc

báo cáo hóa học: " Interferon regulatory factor 3 plays an anti-inflammatory role in microglia by activating the PI3K/Akt pathway" doc

... that indicate that the PI3K pathway plays a predominantly anti-inflammatory role in microglial activation It played a particularly potent role in the induction of anti-inflammatory and immunoregulatory ... enhanced by PI3K/Akt presumably by post-transcriptional modification, since mRNA levels did not change Role of PI3K/Akt in astrocyte cytokine production In o...

Ngày tải lên: 19/06/2014, 22:20

50 336 0
w