... AGGTGCTTT AAGAATAGTT TTT/AAAAACTATT CTTAAAGCAC CTACCAAGCC TCC, 696+A, GGCTTGGTAGGTTTAGCTAGAA- TAGTTTTTGCT/AGCAAAAACTATTCTAGCTAAAC CTACCAAGCC,695+2A,GAGGCTTGGTAGGTGCTG CCTTAAGAATAGTTTTTGC/GCAAAAACTATTCT- ... TTGCTGTAC/GTACAGCAAAAAC- TATTCTTAAGGCTGCGGCCGCACCTACCAAGCCT CC,696+2A, GCTTGGTAGGTTTAGCTGCCAGAA- TAGTTTTTGCTG/CAGCAAAAACTATTCTGGCAG CTAAACCTACCAAGC,695/696+2A, GAGGCTTGG- TAGGTGCTGCCTTAGCTGCCAGAATAGTTTTT ... CCTTAAGAATAGTTTTTGC/GCAAAAACTATTCT- TAAGGCAGCACCTACCAAGCCTC,695+3A, GTAG GAGGCTTGGTAGGTGCGGCCGCATTAAGAATAG- TTTTTGCTGTACGTACAGCAAAAACTATT CTTA- AT GCGGCCGCACCTACCAAGCCTCCTAC, 695+4A, GGAGGCTTGGTAGGTGCGGCCGCAGCCTTAA- GAATAGTTT
Ngày tải lên: 13/08/2014, 01:20
... adaptations to altered sulphate compartmentalization BMC Plant Biol 2010, 10:78. 18 Tomatsu H, Takano J, Takahashi H, Watanabe-Takahashi A, Shibagaki N, Fujiwara T: An Arabidopsis thaliana high-affinity ... Arabidopsis mutants for the group 3 sulfate transporters indicates a role in sulfate translocation within developing seeds Plant Physiol 2010, 154:913-926. 16 Kataoka T, Watanabe-Takahashi A, Hayashi N, ... homeostasis, the molecular mechanisms that regulate the sulfate homeostasis in response to Pi availability remain largely unknown Using bioinformatics analysis, we found that the P1BS cis-acting
Ngày tải lên: 11/08/2014, 11:21
Báo cáo sinh học: " Plasmid-encoded NP73-102 modulates atrial natriuretic peptide receptor signaling and plays a critical role in inducing tolerogenic dendritic cells" pdf
... and generates the intracellular signaling molecule cyclic guanosine monophosphate (cGMP) which can activate cGMP-dependent protein kinase and initiate a cascade of events Patients with asthma ... consists of amino acids 73 to 102 of the ANP prohormone and has bronchoprotective effects in a mouse model of asthma and anti-inflammatory activity in human epithelial cells [9] The amino acid sequence ... NPRA signaling and the activation of several pro-inflam-matory transcription factors in epithelial cells [8,9], has provided the impetus to study the mechanism of how NPRA signaling affects inflammation
Ngày tải lên: 14/08/2014, 19:22
inhibition of connexin 26 43 and extracellular regulated kinase protein plays a critical role in melatonin facilitated gap junctional intercellular communication in hydrogen peroxide treated hacat keratinocyte cells
... transcriptase (Promega, Madi-son, WI, USA) by incubation at 25◦C for 10 min, at 42◦C for 60 min, and at 99◦C for 5 min The synthesized cDNA was amplified using TaKaRa Taq DNA polymerase (TaKaRa ... methoxytrypt-amine), produced especially at night in the pineal gland [11, 12], has antioxidant [13, 14], anti-inflammatory [15, 16], antidepressant [17], and antitumor activities against various cancers ... -ATGCTCCTTTGTCAAGACGT-3 ), Cx43 (sense 5 -TAC-CATGCGACCAGTGGTGCGCT-3, antisense 5 -GAATTC-TGGTTATCATCGGGGAA-3 ), and GAPDH (sense 5 -GTGGATATTGTTGCCATCA-3, antisense 5 -ACTCAT-ACAGCACCTCAG-3)
Ngày tải lên: 02/11/2022, 11:42
Báo cáo khoa học: A novel gene, fad49, plays a crucial role in the immediate early stage of adipocyte differentiation via involvement in mitotic clonal expansion docx
... that the PX domain of p47phox binds intramolecularly to the SH3 domain in the same protein, and that this intramolecular interaction suppresses the lipid-binding activity of the PX domain in the ... (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions The total RNA was converted to single-stranded cDNA using a random primer and ReverTra Ace (Toyobo, Osaka, Japan) The ... domains, suggesting that the PX domain could bind to an SH3 domain of FAD49 To test whether the PX domain could interact with an SH3 domain in FAD49, we performed in vitro binding assays using
Ngày tải lên: 16/03/2014, 04:20
Báo cáo Y học: The a1b1 contact of human hemoglobin plays a key role in stabilizing the bound dioxygen Further evidence from the iron valency hybrids potx
... acquire a noticeable resistance against the acidic autoxidation in a manner of contacting with the a chain, no matter which valency state the latter partner is in, the ferrous or the ferric These ... spectra of the separated bO2chain must be most informative if available, because the autoxidation reaction of the b chain contains a very strong proton-catalysis in the isolated form but not in the ... counterpart chains From these results, we have concluded that the formation of the a1b1 or a2b2 contact suppresses remarkably the autoxidation rate of the b chain and thus plays a key role in stabilizing
Ngày tải lên: 31/03/2014, 15:20
Báo cáo y học: "Translational control plays a prominent role in the hepatocytic differentiation of HepaRG liver progenitor cells" docx
... an increased translation of these tran-scripts and validate the array data indicating no change or a slight decrease in LTBP1, SYNE-1 and MMP3 transcript levels in the total RNA compartment and ... hepatocyte and protects the normal paren-chyma against liver injury [32] Jak2 participates in transduc-tion of interleukin (IL)6 signaling in case of acute phase reaction, as well as in the signal transduction ... Network B (Additional data file 1, B) was associated with increased susceptibility to apoptosis and included the initia-tor caspase 8, insulin growth facinitia-tor-binding protein (IGFBP)1, inhibitor
Ngày tải lên: 14/08/2014, 08:20
The lycopene β-cyclase plays a significant role in provitamin A biosynthesis in wheat endosperm
... vitamin A precursor among carotenoids, and plays a crucial role in human health, protecting against age-related degenerative diseases, cardiovascular disease, certain cancers and vita-min A deficiency ... developmental stages of grains: Grain 1 (4–10 days after pollination (DAP)), Grain 2 (10–16 DAP), Grain 3 (16–20 DAP), Grain 4 (20–25 DAP) and Grain 5 (25–35 DAP) As shown in Figure 4,TaLCYB was expressed ... expressed in all of these was observed in the leaf followed by the stamen, pistil, stem and root In developing grains, it was interesting that the expression ofTaLCYB always remained at a relatively
Ngày tải lên: 26/05/2020, 21:12
The UDP-glucose: Glycoprotein glucosyltransferase (UGGT), a key enzyme in ER quality control, plays a significant role in plant growth as well as biotic and abiotic stress in Arabidopsis
... (AT1g77510); PDIL2-1-F: CACACAAAGC CCTTGGCGAGAAAT, PDIL2-1-R: AATCCCTGCCACC GTCATAATCGT, clathrin adaptor (AT5G46630); CLAT-F: GAAACATGGTGGATGCAT; and CLAT-R: CTCAACAC CAAATTTGAATC Additional ... biotic and abiotic stress in Arabidopsis thaliana Francisca Blanco-Herrera1, Adrián A Moreno1,2, Rodrigo Tapia1, Francisca Reyes1,2, Macarena Araya1, Cecilia D ’Alessio3,4 , Armando Parodi3and Ariel ... AtUTr1-F: AAAAGAGTTGAAGTTTTT CCC, AtUTr1-R: ATCCACAAAATTCAAATCATATAT; GCTCGCTCGTTTGG, BiP1/2-R: GGTTTCCTTGGTCA TTGGCA; BiP3 (AT1G09080); BiP3-F: CACGGTTCCAG CGTATTTCAAT, BiP3-R: ATAAGCTATGGCAGCACCC GTT;
Ngày tải lên: 26/05/2020, 21:22
The Theobroma cacao B3 domain transcription factor TcLEC2 plays a duel role in control of embryo development and maturation
... domain containing genes in cacao A Unrooted neighbor-joining consensus tree of full-length amino acid sequences of selected Arabidopsis and Theobroma cacao B3 domain containing genes The scale ... Siela N Maximova1,2and Mark J Guiltinan1,2* Abstract Background: The Arabidopsis thaliana LEC2 gene encodes a B3 domain transcription factor, which plays critical roles during both zygotic and ... (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, Trang 2mechanisms regulating embryogenesis, we have chosen atranslational biology approach, leveraging the knowledge gained from the model
Ngày tải lên: 27/05/2020, 01:46
Aldehyde dehydrogenase activity plays a Key role in the aggressive phenotype of neuroblastoma
... resuspended in 1 ml ALDEFLUOR assay buffer The ALDH substrate BOD-IPY™-aminoacetaldehyde (BAAA) was added to the cells Immediately after mixing, half of the suspension was used as the negative ... quantifies the percentage of each detected variant Statistical analysis Statistical analyses were performed using GraphPad Prism 5.04 (GraphPad Software, Inc., La Jolla, USA) Unpaired two-tailed parametric ... (DMSO, Sigma-Aldrich) for 3 days prior functional assays, while maintaining the same amount of DEAB or DMSO during the assay Proliferation assay Cell proliferation was assessed using the MTS/PMS
Ngày tải lên: 20/09/2020, 18:14
rho kinase myosin light chain kinase pathway plays a key role in the impairment of bile canaliculi dynamics induced by cholestatic drugs
... Trang 1Rho-kinase/myosin light chain kinase pathway plays a key role in the impairment of bile canaliculi dynamics induced by cholestatic drugs Ahmad Sharanek1,2,*, Audrey Burban1,2,*, Matthew ... organization and cell motility6 The RhoA/Rho-kinase (ROCK) pathway plays a major role in vasocontraction and vascular tone regulation7 Activation of the RhoA/ROCK pathway is also essential for the ... functions in the liver22 Using these cholestatic agents and taking advantage of the well-polarized HepaRG and human hepatocytes, we investigated whether the ROCK/MLCK pathway has a criti-cal role in
Ngày tải lên: 04/12/2022, 16:20
Báo cáo hóa học: "Rac1-mediated signaling plays a central role in secretion-dependent platelet aggregation in human blood stimulated by atherosclerotic plaque" ppt
... unraveled a Ca2+-dependent pathway regulating secretion in throm-bin-stimulated human platelets linking Rac1 activation to actin dynamics: Calcineurin®Rac1 ®class-II PAKs activation®cofilin dephosphorylation ... PBS containing 0.1% fatty acid-free albumin from the outlet channel Care was taken to coat the viewing window of the channel and to leave the inlet channel free The plaque coating was allowed ... platelet aggregation in blood stimulated by a wide array of platelet agonists including atherosclerotic plaque By specifically inhibiting platelet secretion, the pharmacological targeting of Rac1
Ngày tải lên: 18/06/2014, 16:20
báo cáo hóa học: " LPS preconditioning redirects TLR signaling following stroke: TRIF-IRF3 plays a seminal role in mediating tolerance to ischemic injury" doc
... that lead to NFB activation and pro-inflammatory responses In contrast, TLR signaling pathways that activate IRFs can induce antiinflammatory mediators and type I IFNs that have been associated ... Shizuo Akira (Osaka University, Osaka Japan) and were bred in our facility All mice were housed in an American Association for Laboratory Animal Careapproved facility Procedures were conducted according ... Background Stroke is one of the leading causes of death and the leading cause of morbidity in the United States [1] The inflammatory response to stroke substantially exacerbates ischemic damage
Ngày tải lên: 19/06/2014, 22:20
Hepatocyte growth factor plays a particular role in progression of overall cardiac damage in experimental pulmonary hypertension
... via right jugular vein under tribromoethanol anaesthesia [22] Collection of samples was collected from caudal vena cava using EDTA as an anticoagulant, plasma was separated by centrifugation ... Immunoassay MHG00 (R&D Systems, USA) was used according to the manufacturer’s instructions The assay uses a quantitative sandwich enzyme immunoassay technique and detects natural and recombinant ... ratio, further indicating a causal relationship with sustained pressure overload-related RV damage Interestingly, we detected a significant increase of plasma HGF already two weeks after MCT administration,
Ngày tải lên: 16/01/2020, 03:22
NR2F2 plays a major role in insulin-induced epithelial-mesenchymal transition in breast cancer cells
... h The next day, cells were incubated in medium with or without insulin for certain time and then total RNA was extracted using RNeasy plus mini kit from Qiagen (Valencia, CA, USA) as previously ... migration and invasion of breast cancer cells through alterations in EMT-related molecular markers In order to assess whether EMT was involved in their migration and invasion caused by insulin ... were made The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material If material
Ngày tải lên: 06/08/2020, 05:26
The Yin/Yan of CCL2: A minor role in neutrophil anti-tumor activity in vitro but a major role on the outgrowth of metastatic breast cancer lesions in the lung in vivo
... fixed in paraformaldehyde, embedded in paraffin, subjected to H&E staining, then the number of metastases counted Statistical analyses The Kruskal-Wallis (KW) test, a nonparametric analog of analysis ... than an anti-tumor effect Methods Cell lines and animals 4T1 (ATTCC-CRL-2539) were obtained from ATCC and the 67NR cells were obtained through an materials transfer agreement from the Karmanos ... at 37 °C Intranasal Delivery of CCL2 Mice were anesthetized using an isoflurane vaporizer and then 100 ng of CCL2 in 10 μl of PBS was delivered by the intranasal route The solution of CCL2 was
Ngày tải lên: 20/09/2020, 01:16
Báo cáo khoa học: Transmembrane helix 12 plays a pivotal role in coupling energy provision and drug binding in ABCB1 pot
... indicate that TM12 plays a key role in the progression of the ATP hydrolytic cycle in ABCB1 and, in particular, in coordinating conformational changes between the NBDs and transmembrane domains. Abbreviations ABC, ... alteration in the extent of labelling by BM in any conformational state examined. In contrast, there was a dramatic reduction in labelling by the hydrophilic FM as the protein progressed to the ... label- ling according to the following relationship: t 1=2 ¼ Ln2 = k Statistical analysis All data manipulations and statistical analyses were per- formed using graphpad prism 4.0. Comparison of datasets for...
Ngày tải lên: 06/03/2014, 22:21
Tài liệu University Oars Being a Critical Enquiry Into the After Health of the Men Who Rowed in the Oxford and Cambridge Boat-Race, from the Year 1829 to 1869, Based on the Personal Experience of the Rowers Themselves pdf
... them from accidental causes, one only three years after the race, and the other only five). I have calculated that on an average the Oars who pulled in this match, instead of surviving the race ... attained to more than double that age, and unless some extraordinary fatality should befall them, it is certain that any Insurance Company which accepted the 16 lives in the year 1829 would have ... passage from his letter: " About a week before the race I felt a pain in my left arm as if I had got rheumatism, and it became rather stiff till after the race, and then severe inflammation...
Ngày tải lên: 14/02/2014, 21:20
Tài liệu Finance and Economics Discussion Series Divisions of Research & Statistics and Monetary Affairs Federal Reserve Board, Washington, D.C.: Interest Rate Risk and Bank Equity Valuations doc
... Jonathan Wright, Emre Yoldas, Hao Zho u, and seminar participants at the IMF, the Federal Reserve Board, the 2011 Federal Reserve Day-Ahead Conference on Financial Markets and Institutions, and ... themselves with the underlying cause(s) of interest rate changes. In particular, the y treat all changes in interest rates in the same way, making no attempt to control for economic news that might be causing ... whi ch a bank engages in lending a traditional banking activity—by including the ratio of total loans to total asset s (LNS /A) in the vector X it , as well as for bank size measured by the log...
Ngày tải lên: 17/02/2014, 03:20