TOPIC 3 FORMS OF THE VERBS

Give correct forms of the verbs

Give correct forms of the verbs

... next week, he (see) the Eiffel Tower 46 I myself (witness) an accident on the Main Road yesterday A boy (knock) down by a car Then he (take) to the nearest hospital 47 Most of the Earth’s surface ... first as I (not get up) so early 66 Cuckoos (not build) nests They (use) the nests of other birds 67 I (wear) my sunglasses today because the sun is very strong 68 I wish that dog...

Ngày tải lên: 07/06/2013, 01:26

2 1,1K 7
Tài liệu Supply the correct form of the verbs1 docx

Tài liệu Supply the correct form of the verbs1 docx

... a snake.were / wouldn't want 14 My brother managed to kill the snake just at the time when I (be) almost exhausted If he (be) a little late, I (kill) by the snake.was / had been / would have ... a snake 14 My brother managed to kill the snake just at the time when I (be) had been almost exhausted If he (be) had been a little late, I (kill) would have been killed by the snake 15 Ha...

Ngày tải lên: 23/01/2014, 07:20

5 1K 3
Tài liệu Báo cáo khoa học: Neuronal growth-inhibitory factor (metallothionein-3): evaluation of the biological function of growth-inhibitory factor in the injured and neurodegenerative brain pdf

Tài liệu Báo cáo khoa học: Neuronal growth-inhibitory factor (metallothionein-3): evaluation of the biological function of growth-inhibitory factor in the injured and neurodegenerative brain pdf

... discovery of a brain- specific MT isoform, GIF, in 1991, sparked considerable interest in understanding the role of all MTs in the brain, and particularly within the injured or diseased brain In the ... studies examining the role of GIF in AD, linked to its initial discovery as a factor deficient in the AD brain There remains no clear consensus on the...

Ngày tải lên: 16/02/2014, 15:20

9 665 0
Báo cáo khoa học: The 3¢-UTR of the mRNA coding for the major protein kinase C substrate MARCKS contains a novel CU-rich element interacting with the mRNA stabilizing factors HuD and HuR ppt

Báo cáo khoa học: The 3¢-UTR of the mRNA coding for the major protein kinase C substrate MARCKS contains a novel CU-rich element interacting with the mRNA stabilizing factors HuD and HuR ppt

... 5¢-CCC CGG GCC CGA ATT CCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT TTT TTT TTC TCG AGC CCC-3¢; antisense: 5¢-GGG GCT CGA GAA AAA AAA AAA GAA AGA AAG AAA GAA AGA AAG AAA GAA AGA AAG ... luciferase -MARCKS construct and for transient transfection with the cDNAs coding for human HuD and HuR The mouse embryonic carcinoma cell line PCC7-Mz1 is a subclone of...

Ngày tải lên: 08/03/2014, 08:20

16 755 0
Báo cáo khoa học: Characterization of recombinant forms of the yeast Gas1 protein and identification of residues essential for glucanosyltransferase activity and folding pot

Báo cáo khoa học: Characterization of recombinant forms of the yeast Gas1 protein and identification of residues essential for glucanosyltransferase activity and folding pot

... influence the protonation state of the carboxyl group of their side-chain [7] The aim of the present study was to express Gas1p at high levels for biochemical and structural characterization of the protein ... acid residues are essential for the two-step activity (Fig 6B,C) In addition, the sGas1482-H protein was analyzed for activity before and af...

Ngày tải lên: 16/03/2014, 18:20

11 435 0
Đề tài " (log t)2/3 law of the two dimensional asymmetric simple exclusion process " pdf

Đề tài " (log t)2/3 law of the two dimensional asymmetric simple exclusion process " pdf

... Annals of Mathematics, 159 (2004), 377–405 (log t)2/3 law of the two dimensional asymmetric simple exclusion process By Horng-Tzer Yau* Abstract We prove that the diffusion coefficient for the two dimensional ... that the result and method in this paper apply to all asymmetric simple exclusion processes; the special choice is made to simplify the not...

Ngày tải lên: 22/03/2014, 16:20

30 354 0
Báo cáo khoa học: Inactive forms of the catalytic subunit of protein kinase A are expressed in the brain of higher primates potx

Báo cáo khoa học: Inactive forms of the catalytic subunit of protein kinase A are expressed in the brain of higher primates potx

... TGCCATGAAGATCTTAGA TGAGCAGTACTACGCCATGA GTAGCCCTGCTGGTCAATGA TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CCTAATGCCCACCAATCCA (VI) TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CTAATCTATGAAATGGCAG ... band seen in NT2-N cells is present in brain, but not in PBL (Fig 3A, lanes and 3) To examine whether the CbD4 variants were expressed in different parts of the...

Ngày tải lên: 30/03/2014, 04:20

13 347 0
Báo cáo khoa học: Expression and characterization of soluble forms of the extracellular domains of the b, c and e subunits of the human muscle acetylcholine receptor pot

Báo cáo khoa học: Expression and characterization of soluble forms of the extracellular domains of the b, c and e subunits of the human muscle acetylcholine receptor pot

... report, we present the expression and characterization of the ECDs of the b, c and e subunits of the human muscle AChR We describe their expression in a soluble, glycosylated form and in satisfactory ... higher expression of the mouse muscle a ECD [21] To test the effect of these additional epitopes ⁄ tags on the yield of the present pr...

Ngày tải lên: 30/03/2014, 10:20

12 401 0
Báo cáo hóa học: " Research Article Some Equivalent Forms of the Arithematic-Geometric Mean Inequality in Probability: A Survey" pptx

Báo cáo hóa học: " Research Article Some Equivalent Forms of the Arithematic-Geometric Mean Inequality in Probability: A Survey" pptx

... X is a random variable The above listed inequalities are also equivalent to the inequalities in Lemma 2.1 4 Journal of Inequalities and Applications Proof The sketch of the proof of this theorem ... Proceedings of the American Mathematical Society Meeting 700, Cleveland, Ohio, USA, 1979 C A Infantozzi, “An introduction to relations among inequalities,” Notices of...

Ngày tải lên: 22/06/2014, 02:20

9 260 0
Choose the correct forms of the verb potx

Choose the correct forms of the verb potx

... living here for years are has has been have been - They _ on the project at the moment working be working is working are working - Do you still _ to the tennis club? belongs are belong belonging ... works - I to a great radio show on the way to work listening to listening have listening was listening - Tom's not here He's out _ his mother visit visited visiting is visiting - She ......

Ngày tải lên: 08/08/2014, 13:22

4 493 0
w