Báo cáo khoa học: Characterization of recombinant forms of the yeast Gas1 protein and identification of residues essential for glucanosyltransferase activity and folding pot

Characterization of recombinant forms of the yeast Gas1 protein and identification of residues essential for glucanosyltransferase activity and folding Cristina Carotti1, Enrico Ragni1,

Characterization of recombinant forms of the yeast Gas1 protein and identification of residues essential for glucanosyltransferase activity and folding

Cristina Carotti1, Enrico Ragni1, Oscar Palomares2, Thierry Fontaine3, Gabriella Tedeschi4,

Rosalı´a Rodrı´guez2, Jean Paul Latge´3, Marina Vai5and Laura Popolo1

1

Dipartimento di Scienze Biomolecolari e Biotecnologie, Universita` degli Studi di Milano, Milano, Italy;2Departamento de Bioquimica y Biologia Molecular, Facultad de Ciencias Quimicas, Universidad Complutense, Madrid, Spain;3Institut Pasteur, Laboratoire des Aspergillus, Paris, France;4Dipartimento di Patologia Animale, Igiene e Sanita` Pubblica Veterinaria,

Universita` degli Studi di Milano, Milano, Italy; 5 Dipartimento di Biotecnologie e Bioscienze, Universita` degli Studi

di Milano-Bicocca, Milano, Italy

Gas1p is a glycosylphosphatidylinositol-anchored plasma

membrane glycoprotein of Saccharomyces cerevisiae and is

a representative of Family GH72 of

glycosidases/transgly-cosidases, which also includes proteins from human fungal

pathogens Gas1p, Phr1-2p from Candida albicans and

Gel1p from Aspergillus fumigatus have been shown to be

b-(1,3)-glucanosyltransferases required for proper cell wall

assembly and morphogenesis Gas1p is organized into three

modules: a catalytic domain; a cys-rich domain; and a highly

O-glycosylated serine-rich region In order to provide an

experimental system for the biochemical and structural

analysis of Gas1p, we expressed soluble forms in the

meth-ylotrophic yeast Pichia pastoris Here we report that 48 h

after induction with methanol, soluble Gas1p was produced

at a yield of
10 mgÆL)1of medium, and this value was

unaffected by the further removal of the serine-rich region or

by fusion to a 6· His tag Purified soluble Gas1 protein

showed b-(1,3)-glucanosyltransferase activity that was

abolished by replacement of the putative catalytic residues, E161 and E262, with glutamine Spectral studies confirmed that the recombinant soluble Gas1 protein assumed a stable conformation in P pastoris Interestingly, thermal dena-turation studies demonstrated that Gas1p is highly resistant

to heat denaturation, and a complete refolding of the protein following heat treatment was observed We also showed that Gas1p contains five intrachain disulphide bonds The effects

of the C74S, C103S and C265S substitutions in the mem-brane-bound Gas1p were analyzed in S cerevisiae The Gas1-C74S protein was totally unable to complement the phenotype of the gas1 null mutant We found that C74 is an essential residue for the proper folding and maturation of Gas1p

Keywords: b(1,3)-glucanosyltransferase; Gas1 protein; Pichia pastoris; yeast cell wall

The cell wall is an extracellular compartment that plays

several essential functions in yeast and fungal cells It

determines the cell morphology and preserves osmotic

integrity In fungal pathogens, the cell wall is involved in the

interaction with the host cells and in virulence The

biogenesis of the extracellular matrix is a fascinating aspect

of yeast morphogenesis The elucidation of the enzymatic

activities involved in its assembly could be relevant for the

development of new antifungal drugs [1]

The enzymes responsible for the architecture and remod-elling of the cell wall are still largely unknown Several lines

of evidence suggest that a class of recently identified enzymes, endowed with b(1,3)-glucanosyltransferase activ-ity, could play a role in the cross-linking of cell wall components [2,3] This activity was detected for the first time in the Gel1 protein of Aspergillus fumigatus and subsequentially in the homologous proteins Gas1 of Sac-charomyces cerevisiaeand Phr1-2 of Candida albicans [3,4]

On the basis of the sequence similarity, these enzymes have been grouped in a new family, called Family GH72, in the classification of glycoside hydrolases (Class Glycosidases/ Transglycosidases; http://afmb.cnrs-mrs.fr/CAZY/) Gas1p, Gel1p and Phr1-2p catalyze the splitting of an internal b(1,3)-glycosidic bond of a donor laminarioligo-saccharide followed by the transfer of the new reducing end to the nonreducing end of an acceptor molecule, with the formation of another b(1,3)-glycosidic bond [3]

As the anomeric configuration of the linkage was conserved, these enzymes were also classified as retaining enzymes

Correspondence toL Popolo, Dipartimento di Scienze Biomolecolari e

Biotecnologie, Universita` degli Studi di Milano, Via Celoria 26,

Milano, Italy Fax: +39 02 50314912, Tel.: +39 02 50314919,

E-mail: Laura.Popolo@unimi.it

Abbreviations: DTNB, 5,5¢-dithiobis(2-nitrobenzoate); Endo H,

endo-b-N-acetylglucosaminidase H; GH, glycoside hydrolases; GluTD,

b-(1,3)-glucan transferase domain; GPI,

glycosylphosphatidyl-inositol; H, 6 · His.

(Received 20 May 2004, revised 15 July 2004, accepted 21 July 2004)

The reaction mechanism proposed for these enzymes is a

general acid/base catalysis [5] Protonation of the glycosidic

oxygen by a catalytic acid residue is followed by the release

of the cleaved product and stabilization of the carbon cation

by the catalytic nucleophile The new reducing end is then

transferred to the hydroxyl group at the 3-position of the

nonreducing end of another acceptor molecule, yielding a

linear transfer product longer than the original substrate

[3,4] At low concentrations of substrate, the reaction is

preferentially hydrolytic, the hydroxyl group of a water

molecule being the final acceptor In glycoside hydrolases,

as for many cellulases, mannanases or glucanases, the

proton donor and the nucleophile residues are usually

aspartates or glutamates [6–8] These residues are located in

different microenvironments that influence the protonation

state of the carboxyl group of their side-chain [7]

The aim of the present study was to express Gas1p at

high levels for biochemical and structural characterization

of the protein as a representative of the GH72 family

Spectroscopic analyses of the purified proteins were

performed, and the behaviour of the purified protein

upon heat treatment was also monitored By combining

heterologous expression and site-directed mutagenesis, the

role of two putative catalytic residues was investigated

Moreover, the disulphide bonds present in Gas1p were

quantified and the intra- or intermolecular bonding was

determined The effects of the replacement of C74, C105

and C265 with a serine residue on the expression and

complementation of the mutant phenotype of the gas1

null mutant of S cerevisiae were examined These data

provide a first insight into the biochemical features of

proteins of the GH72 family and demonstrate that the

most N-terminal highly conserved cysteine is crucial for

the folding and maturation of Gas1p

Materials and methods

Strains and growth conditions

Pichia pastoris strain GS115 (his4) (Invitrogen, Leek, the

Netherlands) was used for the heterologous expression of

Gas1p To select His+transformants, regeneration dextrose

plates [2% (w/v) dextrose, 1Msorbitol, 1.34% (w/v) Difco

yeast nitrogen base (YNB), 4· 10)5% (w/v) biotin, 2%

(w/v) agar] were used For Mut+ or Muts phenotype

screening, the minimal dextrose [2% (w/v) dextrose, 1.34%

(w/v) YNB, 4· 10)5% (w/v) biotin, 2% (w/v) agar] and

minimal methanol plates [0.5% (v/v) methanol, 1.34% (w/v)

YNB, 4· 10)5% (w/v) biotin, 2% (w/v) agar] were used

To induce the expression of recombinant proteins, the

His+Muts colonies were shifted from a glycerol-complex

medium [1% (w/v) yeast extract, 2% (w/v) peptone, 1%

(v/v) glycerol, 1.34% (w/v) YNB, 4· 10)5% (w/v) biotin]

to a methanol-complex medium [1% (w/v) yeast extract,

2% (w/v) peptone, 0.5% (v/v) methanol, 1.34% (w/v) YNB,

4· 10)5% (w/v) biotin], according to the manufacturer’s

instructions Cells were grown in batches at 30C with

strong agitation, and the growth was monitored through the

increase in attenuance at 600 nm

The S cerevisiae haploid strain, WB2d, carrying an

inactivated GAS1 gene (gas1::LEU2), was used for the

expression of the glycosylphosphatidylinositol

(GPI)-anchored forms C74S, C103S and Gas1-C265S S cerevisiae cells were cultured in batches at 30C

in SC medium [0.67% (w/v) YNB, 2% (w/v) glucose and the required supplements at 50 mgÆL)1for amino acids and uracil and 100 mgÆL)1for adenine]

Construction of expression vectors Recombinant plasmids for integrative recombination in

P pastoriswere generated by cloning BamHI/XhoI-digested PCR fragments into the corresponding sites of the P pas-torisexpression vector, pHIL-S1, to obtain in-frame fusion with the secretion signal of the P pastoris PHO1 gene The recombinant plasmids were named as follows: pSC18 (sGas1523), pSC36 (sGas1523-H), pSC7 (sGas1482) and pSC68 (sGas1482-H)

The plasmid pXH, carrying the full coding sequence of the GAS1gene, was used as a template for PCR amplifications [9] The soluble forms – Gas1523p (lacking the C-terminal GPI-attachment signal) and Gas1482p (also lacking the Ser-box region) – were obtained using the forward primer XHup (5¢-GCATATTCGACTGACTCGAGACGATGT TCCAGCGATTGAA-3¢) and the reverse primers XHdown (5¢-ATCGTCGGGCTCAGGATCCTTAAGATGAAGA TGAAGCTGAAGA-3¢) or XH-Sdown (5¢-GTCGTCG AGCTCAGGATCCTTAATCAACACTACCTGATGC AGA-3¢), respectively XHup is complementary to nucleo-tides +68 to +87 of the coding region of GAS1 and has an XhoI site incorporated (underlined) XHdown and XH-Sdown are complementary to nucleotides +1549 to +1569 and to nucleotides +1426 to +1446, respectively, and have

an in-frame TAA stop codon (shown in bold) and a BamHI site (underlined)

For each construct, a 6· His (H)-tagged soluble form was prepared using the same forward primer, Xhup, and the reverse primer His-XHdown (5¢-ATCGTCGGG CTCAGGATCCTTAGTGATGGTGATGGTGATGAGA

His-XH-Sdown (5¢-GTCGTCGAGCTCAGGATCCTTA GTGATGGTGATGGTGATGATCAACACTACCTGAT GCAGA-3¢), for sGas1482-H (the 6 histidine coding sequence is shown in italics)

Plasmid DNA was purified using plasmid purification kits (Qiagen) DNA sequencing was routinely used to confirm the correct fusions and the absence of undesired mutations throughout the coding sequence (BMR-Servizio sequenziamento; Universita` di Padova, Padova, Italy)

Mutagenesis of E161 and E262 The mutant soluble forms of sGas1523 – sGas1E161Q-H and sGas1E262Q-H – were obtained by overlap extension PCR [10] In the first PCR step, two partially overlapping fragments of GAS1 were amplified using two sets of primers For sGas1E161Q-H, a pairing of the forward

(5¢-TGTTAGTAACTTGATTACCGGCGAAG-3¢), and

a pairing of the forward primer FMGLN161 (5¢-CTT CGCCGGTAATCAAGTTACTAACA-3¢) and reverse primer His-XHdown were used Similarly, for sGas-1E262Q-H, the amplification was carried out using a pairing of the forward primer XHup and reverse primer

RMGLN262 (5¢-TACAACCGTATTGAGAGAAGA

AAAC-3¢), and a pairing of the forward primer

TA-3¢) and reverse primer His-XHdown RMGLN161

and FMGLN161 are complementary to nucleotides +467

to +493 of the coding region of GAS1, while RMGLN262

and FMGLN262 are complementary to nucleotides +771

to +796 In these primers, a Gln codon (shown in bold),

instead of the Glu codon, was incorporated For

Gas1E161Q-H, 20 cycles of a 45 s melting step at 94C, a

1 min annealing step at 50C and a 2.5 min extension step

at 72C were performed using the Pfu Turbo DNA

polymerase (Stratagene) For Gas1E262Q-H, the

tempera-ture of the annealing step was 62C with primers XHup

and RMGLN262, and 57C with primers FMGLN262

and His-XHdown The mutations of interest are located in

the region of overlap between the amplified fragments The

pairing of overlapping fragments was used for a second

PCR step, using the forward primer XHup and the reverse

primer His-XHdown, to amplify the full-length mutated

sequence of GAS1 Twenty-five cycles of a 45 s melting step

at 94C, a 1 min annealing step at 50 C for Gas1E161Q-H

and 53C for Gas1E262Q-H, and a 2 min extension step at

72C were performed and the Taq DNA polymerase was

used The corresponding P pastoris expression plasmids

derived from pHIL-S1 were named pE161Q and pE262Q

Mutagenesis of C74, C103 and C265

The mutant GPI-anchored forms – C74S,

Gas1-C103S and Gas1-C265S – were constructed by PCR-based

mutagenesis For Gas1-C74S, two fragments of GAS1 were

amplified using two sets of primers: the primer pair OligoUP

(5¢-TACCATTTATCGATTACTGGCATACAATGGT-3¢), complementary to nucleotides)830 to )800, and Oligo1

(5¢-TCTGGAGCTCgaCTCATAATTGGCCAAAGG-3¢),

partially complementary to nucleotides +199 to +228; and

AGATATTCCATACCT-3¢), partially complementary to

nucleotides +214 to +242, and OligoDOWN (5¢-ATAC

GCTCCATCTACATATGCTGACG-3¢) complementary

to nucleotides +2408 to +2433 Oligo1 and Oligo2 have

a SacI site (underlined) containing a serine codon (in bold)

instead of the C74 codon and two exchanged bases (lower

case) that allow the retention of residue S73 For

Gas1-C103S, the reverse primer Oligo3 (5¢-AGCCTTC

complementary to nucleotides +288 to +318, and Oligo4

(5¢-CTCCGAATCGATGAAGGCTTTGAATGATGC-3¢)

partially complementary to nucleotides +300 to +329

substituted for Oligo1 and Oligo2, respectively Oligo 3

and Oligo4 have a ClaI site (underlined) containing a

serine codon (shown in bold) instead of the C103

codon For Gas1-C265S, the reverse primer Oligo5

(5¢-TCGTTGGATCCGTATTCAGAGAAGAAAAC-3¢),

partially complementary to nucleotides +772 to +800, and

the forward primer Oligo6 (5¢-AATACGGATCCAA

CGAAGTAACACCAAGAC-3¢), partially

complement-ary to nucleotides +784 to +814, were used instead of

Oligo1 and Oligo2 Oligo5 and Oligo6 have a BamHI site

(underlined) containing a serine codon (in bold) instead of

the C265 codon Pfu Turbo DNA polymerase was used All

mutant forms of the GAS1 gene were cloned into the YCplac33 ARS-CEN shuttle vector and the resulting plasmids were used to transform the WB2d (gas1::LEU2) strain As a control, the same strain was transformed with the wild-type GAS1 gene cloned in the same single copy vector

Transformation ofP pastoris and expression

of recombinant Gas1 proteins Plasmids, linearized with BglII, were transformed into

P pastoris cells using the
EasyComp chemical transfor-mation method (Invitrogen) His+Muts mutants were obtained by selecting His+transformants that grew well

on minimal dextrose, but poorly on minimal methanol plates To induce the expression of recombinant proteins, the positive clones were cultured at 30C overnight in

10 mL of glycerol-complex medium with strong agitation and the cells were spun down and resuspended in 20 mL of methanol-complex medium to an attenuance of 1.0 at

600 nm Fresh methanol was added daily to 0.5% (v/v) The culture medium was collected 48 h after the induction, centrifuged and culture supernatants were quickly frozen and stored at)20 C prior to purification

Purification of His-tagged Gas1 proteins

A 10–20 mL sample of the culture supernatant was dialyzed

at 4C for 16 h against lysis buffer (50 mM sodium phosphate buffer, pH 8.0, 200 mM NaCl) Two millilitres

of 50% (w/v) Ni-nitrilotriacetic acid agarose (Qiagen) was added to the dialyzed supernatant, the mixture was incubated at 4C for 1 h under gentle vertical rotation and then applied to the column (0.7· 10 cm or 1 · 10 cm; Econo Column, Bio-Rad) The resin was washed twice with

8 mL of wash buffer (50 mM sodium phosphate buffer,

pH 8.0, 200 mMNaCl, 3–5 mMimidazole) The His-tagged protein was eluted with elution buffer (50 mM sodium phosphate buffer, pH 8.0, 200 mMNaCl, 200 mM imidaz-ole) and 1 mL fractions were collected The position of Gas1 protein in the elution profile was determined Protein fractions, corresponding to the major peaks, were collected Protein concentration was determined by using the dye reagent protein assay (Bio-Rad)

Endo-b-N-acetylglucosaminidase H treatment

Endo-b-N-acetylglucosaminidase H (Endo H) treatment was performed on culture supernatant or on purified proteins For the treatment of culture supernatant, 80 lL

of a deglycosylation buffer [300 mMsodium citrate, pH 5.5, 0.5% (w/v) SDS, 2% (v/v) 2-mercaptoethanol] was added to

80 lL of culture supernatant and boiled for 2 min After repartition into two equal volumes, one aliquot was added to

100 mU of Endo H (Roche) and the other was used as a control After 18 h of incubation at 37C, an equal volume

of 2· Laemmli buffer was added and the samples were boiled for 2 min prior to electrophoresis For the treatment of purified proteins, 2 lg of protein in 50 mMsodium acetate,

pH 5.5, was used Samples were divided into two aliquots: one was used as a control and the other was treated with 2 lL

of Endo H (10 mU) For treatment of the denatured protein,

SDS and 2-mercaptoethanol were added to final

concentra-tions of 0.02% (w/v) and 0.1M, respectively, prior to division

into two aliquots and the addition of the enzyme To test the

effect of removal of N-linked chains on enzyme activity,

20 lg of native protein was treated with 10 mU Endo H in

0.1Msodium acetate, pH 5.5 After checking a small aliquot

of the sample for the complete removal of N-linked chains,

the remainder was used to assay the b(1,3)-endoglucanase

activity

Electrophoresis and immunoblotting procedures

Total protein extracts from S cerevisiae cells were obtained

as described previously [11] Aliquots of P pastoris culture

supernatants, or fractions from the purification procedure,

were denaturated by boiling for 3 min in SDS sample buffer

[0.0625M Tris/HCl, pH 6.8, 2.3% (w/v) SDS, 5% (v/v)

2-mercaptoethanol, 10% (v/v) glycerol and 0.01% (v/v)

Bromophenol blue] Proteins were separated by SDS/

PAGE in 7 or 8% polyacrylamide gels For analysis of

the proteins under nonreducing conditions,

2-mercaptoeth-anol was omitted from the SDS sample buffer, and samples

were processed as previously described [12] Samples were

boiled for 3 min and then divided into two samples of equal

volume Dithiothreitol (20 mM final concentration) was

added to one sample, which was then reheated for 3 min

When loaded side-by-side, all samples received 100 mM

N-ethylmaleimide after cooling

After electrophoresis, proteins were either stained with

Coomassie Blue R-250 or using a silver nitrate kit

(Amer-sham Pharmacia Biotech, Bucks., UK) For detection by

Western blotting, proteins were transferred to nitrocellulose

membranes and processed as described previously [13]

Rabbit anti-Gas1p immunoglobulin, diluted 1 : 3000, was

used to detect Gas1p A monoclonal anti-(polyHistidine)

immunoglobulin, diluted 1 : 3000 (Sigma), was used to

detect the 6· His tag Horseradish peroxidase-conjugated

anti-rabbit or anti-mouse secondary immunoglobulins were

used Bound antibodies were revealed using the ECL

Western blotting detection reagents (Amersham Pharmacia

Biotech) To check the equivalence of protein loading,

primary antibodies were stripped and filters were treated

with anti-phosphofructokinase 1 (Pfk1p) immunoglobulin

(kindly provided by J J Heinisch, Universitat Hohenheim,

Stuttgart, Germany), diluted 1 : 30 000

Pulse–chase experiment and immunoprecipitation

A total of 2.5· 108logarithmically growing cells

(equival-ent to a value of 12 at an attenuance of 450 nm) were

resuspended in 4 mL of SC medium, incubated at 30C for

20 min, then pulse-labelled for 7 min with 350 lCi of

[35S]methionine Pulse labelling was terminated upon the

addition of 40 lL of chase solution containing 0.3% (w/v)

methionine and 0.3M (NH4)2SO4 Immediately following

the addition of chase mixture, or after 10, 30 and 60 min

chase periods, 1 mL of culture was withdrawn and further

reactions were stopped by the addition of NaF and NaN3to

final concentrations of 10 mM Cells were rapidly collected

by centrifugation in a microfuge at 4C and resuspended in

50 lL of TBS/SDS buffer [(50 mM Tris/HCl, pH 7.2,

150 m NaCl, 1% (w/v) SDS] with protease inhibitors:

2 mM phenylmethanesulfonyl fluoride, 1 lgÆmL)1 pepsta-tin, 50 lgÆmL)1aprotinin, and 10 lgÆmL)1leupeptin Cells were broken by vortexing with glass beads (0.45 mm diameter) for four, 1 min periods, and then lysates were denaturated for 5 min at 100C This treatment fully solubilized Gas1p [14] Then, 450 lL of RIPA-minus buffer [10 mMTris/HCl, pH 7.2, 150 mMNaCl, 1% (v/v) Triton X-100, 1% (w/v) sodium deoxycholate plus protease inhibitors], was added and, in this way, the percentage of SDS was lowered to 0.1 After a 15 min incubation at 4C, beads and cellular debris were sedimented by a 2 min centrifugation in a microfuge, followed by a further centrifugation of the surpernatant for 15 min at 4C Eight microlitres of preimmune serum was added to the cleared supernatant, and the tubes were gently mixed for 1 h

at 4C Fifty microlitres of a 30% (v/v) suspension of Protein A–Sepharose was added and, after incubation for

1 h, immune complexes were sedimented at low speed at

4C The supernatant was transferred to a new Eppendorf tube and 8 lL of anti-Gas1p IgG were added Incubation was continued overnight at 4C Then, 50 lL of the Protein A–Sepharose suspension was added, incubation continued for 1 h and, after sedimentation, the Protein A–Sepharose immune complexes were washed five times with 1 mL of RIPA buffer [the same composition of RIPA-minus buffer but containing 0.1% (v/v) SDS], containing protease inhibitors Immunoprecipitated Gas1p was then solubilized

by heating the pellet in 50 lL of SDS sample buffer (2·), and Protein A–Sepharose beads were removed by centrif-ugation Supernatants were analysed by SDS/PAGE and gels were stained with Coomassie Brilliant blue, fluoro-graphed with Amplify (Amersham) and exposed to X-ray films

Enzyme assays

To test for b(1,3)-glucanosyltransferase activity, the puri-fied proteins were incubated at concentrations of 0.09–0.32 mgÆmL)1 with 3 mM reduced laminarioligosac-charide G13 in 50 mM sodium acetate buffer, pH 5.5, at

37C Aliquots of 2.5 lL were withdrawn at different time-points, supplemented with 45 lL of 50 mMNaOH and then analysed by high-performance anion-exchange chromato-graphy (HPAEC) though a CarboPAC-PA1 column (Dio-nex 4.6 mm· 250 mm), as described by Hartland et al [4]

Spectroscopical analyses

CD spectra were obtained at different temperatures in the far-UV range (200–250 nm) on a Jasco J-715 spectropola-rimeter (Japan Spectroscopic Co., Tokyo, Japan), as described previously [15] The protein concentration was 0.20–0.28 mgÆmL)1 in 50 mM sodium acetate buffer,

pH 5.5 Mean residue mass ellipticity was calculated based

on 107.98 as the average molecular mass per residue, obtained from the amino acid composition, and expressed

in terms of [h]MWR (degree· cm2· dmol)1) Thermal unfolding of sGas1523-H was monitored by recording the ellipticity at 220 nm while heating from 20C to 80 C and cooling again at 1CÆmin)1 using a computer-controlled circulation waterbath Fluorescence emission spectra were obtained on an SLM Aminco 8000 spectrofluorimeter at

25C and in 0.2-cm optical path-cells, using 4 nm slits for

both excitation and emission beams The sample

concen-tration was 0.20 mgÆmL)1in 50 mMsodium acetate buffer,

pH 5.5

Quantification of disulphide bonds and free sulphydryl

groups

The disulphide bonds were quantified using

5,5¢-dithio-bis(2-nitrobenzoate) (DTNB), as described previously [16]

Purified sGas1 protein was dialyzed overnight against

50 mMphosphate buffer, pH 8.0 When the quantification

was performed using an Endo H-treated protein, a second

round of affinity purification was carried out in order to

remove Endo H The reaction with DTNB was carried out

in phosphate buffer, pH 8.0, at 25C using a 2 lMprotein

solution The final volume of the reaction was 1 mL The

formation of the product was monitored at 412 nm using

E ¼ 13 113M )1Æcm)1 In order to expose thiol groups,

which may be buried in the interior of the protein, the

sample was denaturated by boiling for 3 min before reaction

with DTNB To analyze disulphide thiols, freshly prepared

100 mM 1,4-dithioerythritol solution was added to the

denaturated sample and the reduction was carried out for

2 h at 25C Excess dithioerythritol was removed by gel

filtration on PD10 before incubation with DTNB

Results and discussion

Production of recombinant soluble forms of Gas1p

inP pastoris Gas1 is a plasma membrane GPI-anchored glycoprotein of

125–130 kDa It contains a large N-terminal catalytic domain of about 310 residues (D23–P332), known as the b-(1,3)-glucan transferase domain (GluTD), a cystine-rich region containing a motif of eight cysteines (C370–C462) and a serine-rich region in which 28 serines are clustered in a region between residues S485 and S525 (Fig 1A) The serine-rich region is a target for O-glycosylation and is dispensable for activity [2,13] A secretory signal peptide (M1–A22) and a signal sequence for GPI attachment are present at the N- and C-terminal ends, respectively In order

to undertake a biochemical characterization of Gas1p, we attempted to express it in P pastoris DNA sequences, encoding different soluble forms of Gas1p, were subcloned

in the pHIL-S1 expression vector in-frame with the DNA sequence encoding the P pastoris Pho1p signal sequence The expression of the proteins was driven by the methanol-inducible AOX1 promoter Constructs encoding forms of Gas1p lacking the GPI-attachment signal (sGas1523) or the GPI-attachment signal and the serine-rich region (sGas482) and their His-tagged (H) versions are shown in Fig 1B

Fig 1 Scheme of the mutant Gas1 proteins (A) Modular organization of Gas1p (B) Soluble recombinant proteins expressed in Pichia pastoris The different constructs were placed under the control of the AOX1 methanol-inducible promoter and expressed in strain GS115 (C) Glycosylphos-phatidylinositol (GPI)-anchored proteins expressed in Saccharomyces cerevisiae Constructs were placed under the control of the natural GAS1 promoter and cloned in the centromeric YCpLac plasmid Recombinant plasmids were used for transformation of gas1 null mutant cells The position of the cysteine replacement is shown.

A major band of
110 kDa was detected in the medium of

cells transformed with the construct encoding sGas1523after

24 h of induction Forty-eight hours after induction

(Fig 2A, lanes 4–6), levels reached a concentration

equiv-alent to 10 lgÆmL)1, determined using an ovalbumin

standard (data not shown) At 72 h the protein level was

equivalent to that observed at 48 h, and no degradation

products were detected, indicating that the secreted protein

was stable (data not shown) The 110 kDa protein was

identified as Gas1p because it was absent in the medium

obtained from cells transformed with the vector alone

(Fig 2A,B, lanes 1–3) and was recognized by anti-Gas1p

immunoglobulin (Fig 2B, lanes 5 and 6) Removal of the

serine-rich region gave origin to a protein of
90 kDa

(sGas1482), which was produced at levels equivalent to sGas1523(Fig 2A, lanes 7–9) The presence of the His-tag (sGas1-H) did not appreciably modify the expression level

of sGas1523and sGas1482, suggesting no deleterious effects

of the additional amino acids on Gas1p expression and secretion (Fig 2A, lanes 10–12 and 13–15) Where the tag was present the proteins were also recognized by a PolyHis monoclonal antibody (data not shown) The difference in molecular mass between sGas1523and sGas1482is
20 kDa and exceeds the 4 kDa predicted by the length of the segment removed This is consistent with previous evidence that the serine-rich region is a highly O-glycosylated segment in the Gas1 protein [13]

The glycosylation profile of the proteins was examined Aliquots of medium containing the recombinant proteins were treated with Endo H and analysed by Western blotting using anti-Gas1p immunoglobulin (Fig 2C) The apparent molecular mass of both sGas1523-H and sGas1482-H decreased by
18–20 kDa, indicating that the proteins are N-glycosylated in P pastoris Interestingly, the contri-bution of the N-linked glycans was
10 kDa lower than in sGas1p expressed in S cerevisiae (data not shown) This is

in agreement with the evidence that N-linked oligosaccha-ride chains are shorter in P pastoris than in S cerevisiae [17]

Spectroscopical characterization of Gas1p Because no direct structural information of Family GH72 proteins are available, we determined the signature spectra

of recombinant Gas1p Gas1p was purified by affinity chromatography on Ni-NTA agarose (Fig 5B below) The

CD spectrum of sGas1523-H in the far-UV range (peptide bond region) that provides information about its secondary structure, is shown in Fig 3A Deconvolution of the spectrum of the protein at 20C by the convex-constraint analysis method [18] gave the following composition: 15% a-helix, 29% b-sheet, 28% b-turn and 28% nonregular conformation Thermal unfolding of the protein was followed by CD analysis in order to study the stability of sGas1523-H Changes in ellipticity were recorded at 220 nm upon heating from 20C to 80 C The unfolding transition

of sGas1523-H was monophasic, with a melting point at 56.5C, and also highly cooperative (Fig 3B) As shown in the CD spectrum of Fig 3A, the structural changes upon heating to 80C resulted in a decrease of regular secondary structure content (8% a-helix and 17% b-sheet) Interest-ingly, these structural changes were totally reversible because sGas1523-H recovered the initial structure at

20C after cooling from 80 C (Fig 3A) Figure 3C shows the fluorescence emission spectrum obtained for sGas1523-H (spectrum 1) The emission of the protein was dominated by the tryptophan contribution (spectrum 2, excitation at

295 nm) with a maximum at 320 nm and a shoulder at

332 nm The intrinsic tryptophan fluorescence of a protein

is a sensitive indicator of the local environment of its tryptophan residues The mature Gas1 protein contains five tryptophan residues The fact that the tryptophan emission

in sGas1523-H was shifted to a lower wavelength than expected for solvent-exposed tryptophans strongly suggests that these residues are located in a hydrophobic environ-ment in the protein The low tyrosine contribution,

Fig 2 Analysis of culture supernatants from Pichia

pastoris-trans-formed cells (A) Coomassie Blue staining of 100 lL of culture

supernatant at 24 and 48 h from the shift (time zero) of cells containing

the pHIL-S1 vector (lanes 1–3), the cassette expressing sGas1523(lanes

4–6), sGas1 482 (lanes 7–9), sGas1 523 -H (lanes 10–12) and sGas1 482 -H

(lanes 13–15) (B) Immunoblot analysis of culture supernatants at 0, 24

and 48 h time-points from induction A 40 lL sample was analysed by

SDS/PAGE and blotted proteins were incubated with anti-Gas1p IgG.

As representative samples, culture supernatants from cells containing

the pHIL-S1 vector (lanes 1–3), or the cassette expressing sGas1523

(lanes 4–6), are shown (C) Endo-b-N-acetylglucosaminidase H

(Endo H) treatment of culture supernatants containing the indicated

recombinant proteins A 40 lL sample of culture supernatant

obtained 48 h after induction was incubated with (+) or without (–)

Endo H and analysed by SDS/PAGE Proteins were detected by

immunoblot using anti-Gas1p immunoglobulin.

30 residues in Gas1p, is also displayed in this figure

(spectrum 3) All these results support the notion that

sGas1523-H produced in P pastoris assumes a stable

conformation consisting of a structure that contains both

a-helices and b-sheets, and that the latter ones predominate

Quantification of disulphides and free sulphydryl groups

present in Gas1p

Proteins of Family GH72 are rich in cysteines but no

determination of disulfide bonds has yet been reported The

yeast Gas1 protein contains 14 cysteines We used DTNB

to quantify the number of disulphides plus free sulphydryl

groups in Gas1p The recombinant protein lacking the

O-glycosylated region, which is dispensable for activity and

is devoid of cysteines, was analysed As shown in Table 1,

sGas1482-H contains four thiols – one of which is readily

accessible to the reagent in native conditions – and five

disulphide bridges The same results were obtained after

treatment with Endo H (Table 1), which completely

removes the N-linked chains (data not shown) This

indicates that accessibility to the reagent is not influenced

by the N-linked chains Equivalent results were obtained for sGas1523-H

In order to determine whether the disulphide bridges were intra- or intermolecular, the electrophoretic mobility of Gas1p was analysed under reducing and nonreducing conditions When samples are denaturated in the absence

of a reducing agent a decrease in electrophoretic mobility of the nonreduced sample, with respect to the corresponding reduced sample, indicates the presence of interchain disul-phide bridges, whereas an increase in mobility is related to the presence of intrachain bonds As shown in Fig 4, nonreduced Gas1p has a higher mobility than reduced Gas1p, indicating that the disulphide bonds are intrachain Both the GPI-anchored form of Gas1p present in the yeast cellular extract, and the purified sGas1523-H and sGas1482-H proteins, gave similar results (Fig 4A,B) In conclusion, Gas1p has five intrachain disulphide bonds

Conserved features of the catalytic domain of Family GH72 and identification of the catalytic residues

in Gas1p The sequences spanning the catalytic domain (GluTD) of 40 proteins have been aligned Two glutamic acid residues (shown in bold) are conserved in the A/S-G-N-E-V/I and S-E-Y/F-G-C subsequences Similarly to other protein families of the GH-A clan, to which Family GH72 belongs,

it has been proposed that these residues might be important for catalysis A role of proton donor and nucleophile has been proposed for these residues [2,19] Moreover, six glycine residues (159-197-243-264-290-304), five tyrosine residues (92-113-198-231-294) and five cysteine residues (74-103-216-234-265), are strictly conserved in all GluTD sequences Clan GH-A comprises many proteins that share

a low degree of conservation of the primary structure, but contain a conserved fold consisting of a (b/a)8 with the putative catalytic residues located at the end of strands b-4 and b-7 This fold has also been predicted for Gel1p [19,20]

Fig 3 Spectroscopical characterization of Gas1p (A) Far-UV (200–250 nm) CD spectra of purified sGas1523-H at 20 C (j), after heating at 80 C (d) and cooling again at 20 C (s) [h] MRW , mean residue mass ellipticity (B) Thermal unfolding of sGas1 523 -H in 50 m M sodium acetate buffer,

pH 5.5; changes in ellipticity at 220 nm were continuously monitored upon heating from 20 C to 80 C (C) Fluorescence emission spectra of sGas1523-H Spectrum 1 was obtained for excitation at 275 nm Spectrum 2 (tryptophan contribution) was obtained for excitation at 295 nm and normalized at wavelengths above 380 nm Spectrum 3 (tyrosine contribution) was calculated as the difference spectrum (spectrum 1 minus spectrum 2) Fluorescence is expressed in arbitrary units All the spectra were recorded at 25 C and pH 5.5.

Table 1 Quantification of disulphides and suphydryl groups in Gas1p.

The number of DTNB molecules per protein molecule as a mean of

three different determinations (SD < 10%) are shown in parenthesis.

Endo H, endo-b-N-acetylglucosaminidase H.

Protein and condition Number of cysteines

sGas1 482 -H

Native conditions 1 (0.72)

After denaturation 4 (4.30)

After denaturation and reduction 14 (13.6)

Endo H-treated sGas1482-H

Native conditions 1 (0.71)

After denaturation 4 (3.92)

After denaturation and reduction 14 (14.4)

The conserved glutamates correspond to residues E161

and E262 in Gas1p In order to test the involvement of E161

and E262 in the active site of Gas1p, we constructed two

mutant His-tagged forms of Gas1 – sGas1E161Q-H and

sGas1E262Q-H (Fig 1B) The mutant proteins were

secre-ted in the P pastoris culture medium at the same level as

sGas1523-H, suggesting that they are properly folded

(Fig 5A) To confirm this, recombinant Gas1 proteins

were purified and their signature CD spectra were

deter-mined (Fig 5B,C) No significant differences were detected

among the spectra of sGas1523, sGas1E161Q-H or

sGas-1E262Q-H, demonstrating that sGas1523 and the mutant

proteins assume the same folding (Fig 5C) Next, we tested

whether the mutant proteins were enzymatically active

Endo-b-(1,3)-glucanase activity was assayed by a reducing

sugar assay [4] and b-(1,3)-glucanosyltransferase activity by

an assay described in the Materials and methods No

endo-b(1,3)-glucanase activity was observed for the two mutant

proteins (data not shown) Analysis of the

b(1,3)-glucano-syltransferase activity is shown in Fig 6 Using G13

laminarioligosaccharide as a substrate, sGas1523-H

pro-duced smaller and larger oligosaccharides (Fig 6A) that

corresponded to the released and transferred products, as

previously characterized [4], and confirmed the following

two-step enzyme activity:

In contrast, with sGas1E161Q-H and sGas1E262Q-H, no

transferase activity was observed, indicating that both

glutamic acid residues are essential for the two-step activity

(Fig 6B,C) In addition, the sGas1482-H protein was

analyzed for activity before and after removal of the

N-linked chains by Endo H The complete deglycosylation occurred using both the native and the SDS-denaturated Gas1 protein, suggesting that N-linked chains are com-pletely accessible to Endo H The native deglycosylated

Fig 5 Expression and purification of sGas1523and the mutant forms sGas1E161Q and sGas1E262Q from Pichia pastoris culture super-natants (A) Immunoblot with anti-Gas1p IgG of culture supernatants (48 h from induction) from P pastoris-transformed strains expressing the His-tagged forms sGas1 523 , sGas1E161Q and sGas1E262Q (B) Representative purification of sGas1523-H Silver staining of the dif-ferent steps of the purification are shown Lane 1, culture supernatant; lane 2, dialyzed fraction; lanes 3–5, three eluted fractions (E2, E3 and E4) (C) CD spectra of His-tagged sGas1 523 (d), sGas1E161Q (n) and sGas1E262Q (m).

Fig 4 SDS/PAGE mobility of Gas1p under reducing and nonreducing

conditions Non-reduced (nr) and reduced (r) samples of total extracts,

corresponding to
60 lg of protein from W303-1B cells (A) and

0.5 lg of the indicated purified recombinant proteins (B), were loaded

on adjacent lanes and subjected to SDS/PAGE in a 7%

polyacryl-amide gel Immunoblots obtained with anti-Gas1p immunoglobulin

are shown The film in (A) was deliberately overexposed.

Gas1 protein was as active as the fully glycosylated form,

indicating that N-linked chains are not required for activity

(data not shown)

Essential role of C74 in the folding and stability

of the GPI-anchored Gas1p

To gain insight into the putative role played by the cysteine

residues in the original GPI-anchored form of Gas1p, we

performed experiments based on site-directed mutagenesis

We chose C74, the most N-terminal cysteine, the one next to

it (C103), and C265, which is close to the E262 catalytic

residue in the primary sequence Each cysteine residue was

replaced with a serine A gas1D mutant strain of S

cere-visiae was transformed with a centromeric plasmid

har-bouring the wild-type GAS1 gene or the mutant constructs

(C74S, C103S and C265S, Fig 1C) We reasoned that if

folded properly and localized correctly, the mutant proteins

should be able to fully complement the in vivo defects typical

of the mutant lacking Gas1p [21] Upon microscopic

analysis, Gas1-C74S-expressing cells displayed the typical

gas1D abnormal morphology, whereas gas1D cells

expressing the mutant proteins (C103S or

Gas1-C265S) showed partial reversal of the morphological

defects, and cells expressing the wild-type GAS1 exhibited

the normal morphology (data not shown) Consistently with

these observations, the Gas1-C74S protein did not

comple-ment the slow growth phenotype of gas1D cells, the

duplication time (Td) in SC medium at 30C being 3.5 h

either for cells expressing Gas1-C74S or for gas1 cells

Fig 6 High-performance anion-exchange

chromatography (HPAEC) analysis of products

from the incubation of the recombinant

sGas1523p, sGas1E161Q-H and

sGas1E262Q-H mutant proteins with reduced

laminari-oligosaccharides The recombinant purified

proteins were incubated with 3 m M reduced

laminarioligosaccharide of size G 13 , and

HPAEC analysis from samples taken at the

indicated time-points are shown The size of

some of the major products is indicated.

Fig 7 C74 is essential for maturation of the glycosylphosphatidylinos-itol (GPI)-anchored form of Gas1p in Saccharomyces cerevisiae (A) Immunoblot of total protein extracts from the gas1D strain of

S cerevisiae transformed with the empty vector (YCplac33) or with the same vector carrying the GAS1 gene or its mutant forms encoding Gas1-C74S, Gas1-C103S or Gas1-C265S The filter was treated first with anti-Gas1 IgG and, after stripping of the antibodies, was treated with anti-Pfk1p immunoglobulin to verify the loading The arrow indicates the position of the a-subunit (B) Pulse-labelling and immu-noprecipitation of cells harbouring the YCplac33-GAS1 or the YC-plac33-GAS1-C74S plasmid Cells were labelled for 7 min with [35S]methionine and chased for the indicated times before being processed for immunoprecipitation with anti-Gas1p IgG.

transformed with the empty vector Control gas1 cells

carrying the wild-type GAS1 gene showed a Tdof 1.8 h The

Tdof cells expressing Gas1-C103S or Gas1-265S was 2.6 h,

indicating a partial complementation of the slow-growth

phenotype

The total inability of Gas1-C74S and the partial ability

Gas1-C103S or GasC265-S proteins to rescue the gas1

phenotype could be primarily a result of alterations in

expression or folding of the mutant proteins To exclude

effects at the mRNA level, a Northern blot analysis was

performed Cells containing either the wild-type GAS1 gene

or the mutated alleles had comparable levels of GAS1

mRNA (data not shown) Therefore, the mutations do not

affect transcript accumulation

The endoplasmic reticulum (ER) is the folding

compart-ment for proteins, such as Gas1p, destined for the plasma

membrane Failure to acquire a proper native conformation

leads to recognition by the quality control machinery in the

ER, provoking retention and eventually degradation

[22,23] Total protein from gas1D-transformed cells was

analysed by immunoblotting using anti-Gas1p

immuno-globulin As shown in Fig 7A, mature Gas1p (130 kDa)

was present in cells expressing the wild-type GAS1 and the

mutant Gas1-C103S or Gas1-C265S forms, while no

immunoreactive band corresponding to the mature protein

was detected in Gas1-C74S-expressing cells However, a

faint band with the typical mobility of the ER 105 kDa

form was detectable in cells expressing Gas1-C74S Cells

expressing Gas1-C103S or Gas1-C265S also showed an

accumulation of the ER form that was not detectable in cells

expressing the wild-type Gas1p These results suggest that

Gas1-C74S does not fold properly and is retained in the ER,

whereas the processing of the Gas1-C103S and Gas1-C265S

precursors is slower than for wild-type Gas1p To test, more

accurately, the effect of C74S replacement on Gas1p

maturation, a pulse–chase experiment was performed Cells

expressing wild-type Gas1p or the Gas1-C74S mutant were

labelled for 7 min with [35S]methionine and the behaviour of

the labelled forms was monitored at different time-points

after the chase (Fig 7B) The ER form of Gas1p migrated

at 105 kDa, and the mature form, after processing in the

Golgi, migrated at 130 kDa (as determined by SDS/

PAGE), in agreement with the well-known maturation

process of Gas1p [24–26] After a 7 min pulse, both the ER

form of Gas1p and of the mutant (C74S) were detectable at

equivalent levels During the chase, the maturation of

Gas1p proceeded and the mature form was already

detectable at 10 min At 30 min all the precursor had been

converted into the mature protein No maturation of the

mutant form occurred and the protein level progressively

decreased for 60 min when the immature form was almost

undetectable This indicates that the GPI-anchored

Gas1-C74S is synthesized at the level of ER, but is not further

processed and undergoes degradation

Conclusions

Proteins of Family GH72 play an active role in yeast and

fungal morphogenesis but, to date, no detailed biochemical

characterization has been reported Previously, Gas1p has

proven to be useful for studies on protein transport along

the secretory pathway in yeast In this work, Gas1p was

used as a model protein to undertake a first biochemical characterization of an enzyme of Family GH72 Here we have shown that P pastoris is a suitable host for the high-level expression and secretion of Gas1p The protein yield was estimated to be about 100 times higher than for an equivalent construct expressed in S cerevisiae under the control of the natural GAS1 promoter in a multicopy vector (L Popolo & M Vai, unpublished data) The purified His-tagged sGas1 is active and could be used for future structural characterization of the protein Our results suggest that the high-level expression of secreted forms of proteins in P pastoris could constitute a valuable tool in the study of fungal and plant GPI proteins involved in cell wall biogenesis

Multiple sequence alignment performed on the 40 members of Family GH72 suggested that glutamates 161 and 262 in Gas1p could play the role of catalytic residues These predictions have been supported experimentally because the replacement of these residues with glutamine abolished the activity of Gas1p, whereas no significant changes in the protein conformations were detected by CD spectroscopy analysis These results extend those obtained for Gel1p of A fumigatus, in which the replacement of E160 and E261 with a Leu and a Phe, respectively, totally abolished the in vitro glucanosyltransferase activity, and for

C albicanswhere a glutamine substitution at position E169

or E270 yielded a Phr1 protein that was not able to complement in vivo the morphological defects of a phr1D mutant [19,27] These results could be valuable in the design

of inhibitors for b(1,3)-glucanosyltransferase activity, and Gas1p could be considered a potential interesting molecular target for the development of new antifungal agents Purified sGas1p was found to be quite resistant to heat treatment The structural changes induced in the protein after heating to 80C were totally reversible upon cooling

to 20C This is a structural feature typical of proteins with disulphide bridges Here we have demonstrated that 10 out

of the 14 cysteines present in Gas1p are engaged in intrachain disulphide bridges The presence of disulphide bonds in Gas1p is also consistent with a study on the effects

of reducing conditions on the transport of Gas1p from the

ER to the Golgi, which had indirectly revealed the requirement of at least one disulphide bond for the exit of Gas1p from the ER [25]

Multiple alignment indicated that five cysteines are conserved in the catalytic domain of members of Family GH72 No data are available, to date, on the role of these residues Here we have shown that C74 of the catalytic domain is crucial for the proper folding of Gas1p C74 is the most N-terminal cysteine in Gas1p and could be required for non-native disulphide bond formation during folding pathway, as has been suggested to occur for some mammalian multidomain proteins [28], or for the sequential and independent folding of the single domains – assuming

a vectorial mode of folding for Gas1p In any case, the replacement of C74 with a serine could entrap the protein in

a folding intermediate that is no longer processed and is degraded Frand & Kaiser reported that the ER form of Gas1p accumulates in cells treated with dithiothreitol or in cells defective in Ero1p, and is stable [25] Our finding, that the Gas1-C74S protein is unstable, is not necessarily in contrast with their results In the presence of the reducing