A level physics 8 structure of the atom

Tài liệu High-level Expert Group on reforming the structure of the EU banking sector docx

Tài liệu High-level Expert Group on reforming the structure of the EU banking sector docx

... sheets Nonetheless, the differences in the size of the banking sector in Europe partly reflect the greater dependence on bank intermediation of the European economy, with bank credit being the main ... at consolidated level 2.3.4 Sector consolidation and the emergence of very large institutions The EU banking sector has undergone continuous consolidation (c...

Ngày tải lên: 16/02/2014, 10:20

153 449 0
Tài liệu Báo cáo khoa học: Crystal structure of the catalytic domain of DESC1, a new member of the type II transmembrane serine proteinase family pptx

Tài liệu Báo cáo khoa học: Crystal structure of the catalytic domain of DESC1, a new member of the type II transmembrane serine proteinase family pptx

... structure of the catalytic domain of DESC1 Scheme Domain organization of human DESC1 membrane region The extracellular part of DESC1 consists of a 120-amino acid SEA domain followed by the C-terminal ... growth factors and proteinase inhibitors Biol Chem 380, 473–483 Kataoka H, Uchino H, Asada Y, Hatakeyama K, Nabeshima K, Sumiyoshi A & Koono M (1997) Analy- C...

Ngày tải lên: 19/02/2014, 00:20

13 588 0
Tài liệu Báo cáo khoa học: Crystal structure of the BcZBP, a zinc-binding protein from Bacillus cereus doc

Tài liệu Báo cáo khoa học: Crystal structure of the BcZBP, a zinc-binding protein from Bacillus cereus doc

... References Ivanova N, Sorokin A, Anderson I, Galleron N, Candelon B, Kapatral V, Bhattacharyya A, Reznik G, Mikhailova N, Lapidus A et al (2003) Genome sequence of Bacillus cereus and comparative analysis ... of GAB catalysis have been identified to date [12] which are based either on a single, bifunctional GAB catalyst or on a GAB catalysts pair The available biochemical dat...

Ngày tải lên: 19/02/2014, 00:20

11 711 0
Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

... absorption bands of oxyheme appeared at 540 and 579 nm Then, a broad band appeared at around 660 nm, and was maximal 9–12 after initiation of the reaction The spectral features of the final reaction mixture ... modulation amplitude, 10 G for (A) and (B) and G for (C)–(E); signal acquisition temperature, K for (A) and (B) and 25 K for (C)–(E) (A) The ferric heme c...

Ngày tải lên: 19/02/2014, 05:20

16 618 0
Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx

Tài liệu Báo cáo khóa học: Trichostatin A reduces hormone-induced transcription of the MMTV promoter and has pleiotropic effects on its chromatin structure pptx

... during hormone activation [6] Our results, and the results of others, highlight the pleiotropic effects that TSA administration has on chromatin structure and on gene expression Materials and methods ... structure of chromatin incorporating them To see whether the increased transcription leakage observed at early addition of TSA can be explained by an acc...

Ngày tải lên: 19/02/2014, 12:20

10 506 0
Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc

Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc

... GLU R1 5A forward (5¢-ATTCAAACTATAAAGTTGACGCAA CTGACTTGGAAACCTTC-3¢), GLU R1 5A reverse (5¢GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTT TGAAT-3¢); GLU H44 7A forward (5¢- GCAAGTCATTT TGGATGCTATTAATGATGATGGCTC-3¢), ... form any additional contacts with the molecule A 2164 Catalytic site The catalytic reaction of glucoamylases proceeds with inversion of configuration at the anom...

Ngày tải lên: 07/03/2014, 12:20

11 551 0
Báo cáo khoa học: MR solution structure of the precursor for carnobacteriocin B2, an antimicrobial peptide fromCarnobacterium piscicola Implications of the a-helical leader section for export and inhibition of type IIa bacteriocin activity pdf

Báo cáo khoa học: MR solution structure of the precursor for carnobacteriocin B2, an antimicrobial peptide fromCarnobacterium piscicola Implications of the a-helical leader section for export and inhibition of type IIa bacteriocin activity pdf

... establish the preferred geometry of the precursor We now report the chemical synthesis, biochemical production, and solution structure of preCbnB2, and compare it with the structure of the mature bacteriocin, ... amphipathic nature of the leader peptide is likely to be critical for its export and processing Analysis of the sequences of leader...

Ngày tải lên: 07/03/2014, 15:20

9 520 0
Báo cáo Y học: Solution structure of the Alzheimer amyloid b-peptide (1–42) in an apolar microenvironment Similarity with a virus fusion domain potx

Báo cáo Y học: Solution structure of the Alzheimer amyloid b-peptide (1–42) in an apolar microenvironment Similarity with a virus fusion domain potx

... specificity of Alzheimer s disease gamma-secretase identified by phenylalanine-scanning mutagenesis of the transmembrane domain of the amyloid precursor protein Proc Natl Acad Sci USA 96, 3053–3058 ... strongly hydrophobic side chains; this feature has been aptly described by Rajan et al as a Teflon coating that can surround a helix [16] in the case of a mixture of w...

Ngày tải lên: 08/03/2014, 09:20

7 626 0
Báo cáo khoa học: The oxidative effect of bacterial lipopolysaccharide on native and cross-linked human hemoglobin as a function of the structure of the lipopolysaccharide A comparison of the effects of smooth and rough lipopolysaccharide ppt

Báo cáo khoa học: The oxidative effect of bacterial lipopolysaccharide on native and cross-linked human hemoglobin as a function of the structure of the lipopolysaccharide A comparison of the effects of smooth and rough lipopolysaccharide ppt

... presence of EDTA The rough S minnesota LPS increased the initial fast phase of the reaction, but decreased the rate of the slow phase of oxidation in the presence of EDTA A comparison of rough and smooth ... reported that the oxidation of the a chains of Hb A0 was 10 times faster than that of the beta chains and that the oxidation of t...

Ngày tải lên: 08/03/2014, 10:20

6 749 0
Báo cáo Y học: Crystal structure of the catalytic domain of a human thioredoxin-like protein pdf

Báo cáo Y học: Crystal structure of the catalytic domain of a human thioredoxin-like protein pdf

... Crystallization and preliminary X-ray analysis of a Trx domain of human thioredoxin-like protein Acta Crystallogr 57, 1712–1714 32 Otwinowski, Z & Minor, W (1997) Processing of X-ray diffraction data ... identity, dissimilar crystal forms and dissimilar intermolecular contacts near the active site in the crystal, the conformation of the active site (-Cys-Gly-ProCys...

Ngày tải lên: 08/03/2014, 22:20

9 536 0
Báo cáo Y học: Electrostatic properties of the structure of the docking and dimerization domain of protein kinase A IIa doc

Báo cáo Y học: Electrostatic properties of the structure of the docking and dimerization domain of protein kinase A IIa doc

... pivot about the stable AKAP-bound dimerization and docking domain, and to weakly associate with another part of the molecule, possibly the tandem cAMP binding domains of the regulatory subunit ... secondary, tertiary, and quaternary structure packing and stability In addition, we discuss the role of charges in function of RIIa D/D MATERIALS AND METHODS Sampl...

Ngày tải lên: 08/03/2014, 22:20

12 542 0
Báo cáo khóa học: Structural characterization of the human Nogo-A functional domains Solution structure of Nogo-40, a Nogo-66 receptor antagonist enhancing injured spinal cord regeneration ppt

Báo cáo khóa học: Structural characterization of the human Nogo-A functional domains Solution structure of Nogo-40, a Nogo-66 receptor antagonist enhancing injured spinal cord regeneration ppt

... characterization of the Nogo -A functional domains (Eur J Biochem 271) 3513 Fig Schematic representation of the domain organization of the human Nogo -A protein (A) The domain organization of human ... fragments The Nogo -A cDNA (designated KIAA 0886) was obtained from the Kazusa DNA Research Institute (KazusaKamatari, Kisarazu, Chiba, Japan) A DNA fra...

Ngày tải lên: 16/03/2014, 16:20

11 494 0
Báo cáo khoa học: Crystal structure of the halotolerant c-glutamyltranspeptidase from Bacillus subtilis in complex with glutamate reveals a unique architecture of the solvent-exposed catalytic pocket docx

Báo cáo khoa học: Crystal structure of the halotolerant c-glutamyltranspeptidase from Bacillus subtilis in complex with glutamate reveals a unique architecture of the solvent-exposed catalytic pocket docx

... asymmetric unit, and the glutamate- binding modes are identical to each other (Fig 2A) The a- carboxyl and a- amino groups of the bound glutamate are at the bottom of the pocket, and are held in this position ... was amplified by PCR from the plasmid pCY167 (Suzuki H & Yamada C, Unpublished), using forward primer 5¢-CATATGGATGAGTACAAACA AGTAGATG-3¢ and reverse primer...

Ngày tải lên: 22/03/2014, 21:20

10 375 0
Báo cáo khoa học: Structure of the core oligosaccharide of a rough-type lipopolysaccharide of Pseudomonas syringae pv. phaseolicola docx

Báo cáo khoa học: Structure of the core oligosaccharide of a rough-type lipopolysaccharide of Pseudomonas syringae pv. phaseolicola docx

... Shashkov, A. S., Kocharova, N .A & Knirel, Y .A (2004) Structural diversity of the O polysaccharides of the lipopolysaccharides and serological classification of Pseudomonas syringae pv garcae and ... of the OSHOAc (Fig 2) as well as of the full core oligosaccharide of P syringae pv phaseolicola GSPB 711 (Fig 5) The structure of the P syringae LPS...

Ngày tải lên: 23/03/2014, 13:20

10 326 0
Báo cáo khoa học: Structure of the O-polysaccharide fromProteus myxofaciens Classification of the bacterium into a newProteusO-serogroup pptx

Báo cáo khoa học: Structure of the O-polysaccharide fromProteus myxofaciens Classification of the bacterium into a newProteusO-serogroup pptx

... O-polysaccharide in a yield of 20% of the LPS weight Rabbit antisera and serological assays Polyclonal O-antisera were obtained by immunization of rabbits with heat-inactivated bacteria of P myxofaciens ... the O-polysaccharide of P myxofaciens Fig 1H NMR spectrum of the O-polysaccharide of P myxofaciens COOH of AlaLys) A relatively high-field position of...

Ngày tải lên: 23/03/2014, 21:20

7 348 0
w