Active Sway Suppression Techniques of a Gantry Crane System

Báo cáo y học: " Masitinib in the treatment of active rheumatoid arthritis: results of a multicentre, open-label, dose-ranging, phase 2a study" pdf

Báo cáo y học: " Masitinib in the treatment of active rheumatoid arthritis: results of a multicentre, open-label, dose-ranging, phase 2a study" pdf

... study was to evaluate the safety and efficacy of masitinib in the treatment of DMARDrefractory active RA Materials and methods Patients Patients from 18 to 75 years of age who had been diagnosed ... administered orally in two daily intakes To evaluate the dose response of masitinib in DMARD-refractory active RA, dose ranging was performed by randomly assigning pa...

Ngày tải lên: 09/08/2014, 14:22

12 471 0
The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System

The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System

... modify a page of data at a time An attempt by a reader to write previously read data causes a memory fault which converts a reader into a writer and invalidates all other page caches A subsequent attempt ... when it initiates a cache replacement A data manager may restrict the use of cached data by issuing a pager_data_lock request, specifying the types of ac...

Ngày tải lên: 12/09/2012, 15:05

23 1,3K 1
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf

Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf

... AAACGCCTTCGCCCAAAGTTTAAAAGATGA TCATCTTTTAAACTTTGGGCGAAGGCGTTT TTTTCTCGAGAAAGATGCCGATTTGGGCGC GGGGCTCGAGGTTTTATATTTGTTGTAAAA ATATTATATATATATATAGGGTCGTATATA AAATTATAGAAAGCAGTAGA TAAAACAATG CTTCGAAGAATATACTAAAAAATGAGCAGG ... GCCCGTCGACATATTATATATATATATAGG CCCGCTCGAGTCTTAGAATTATTGAGAACG GCCCGGATCCTGATAGTAATAGAATCCAAA CCCCGAATTCAAATTATAGAAAGCAGTAGA AAGGCTCGAGAGATCTGTTTAGCTTGCCTC AAAAGTCGACGAGCTCGT...

Ngày tải lên: 16/03/2014, 01:20

9 444 0
The Design and Implementation of a Sequence Database System * docx

The Design and Implementation of a Sequence Database System * docx

... supports relational data as well as sequencedata, using a novel design paradigm of enhancedabstractdata types (BADTs ) The systemimplementation basedon this paradigmallows sequence relational queriesto ... PIVceeding of the ACM SIGMOD Conference on Management of Data, May 1994 [CS92] RakeshChandmand Arie Segev.ManagingTemporalFinancial Data in anExtensible Database. In Procee...

Ngày tải lên: 16/03/2014, 16:20

12 573 0
Báo cáo khoa học: "DESIGN OF A MACHINE TRANSLATION SYSTEM " pptx

Báo cáo khoa học: "DESIGN OF A MACHINE TRANSLATION SYSTEM " pptx

... accordance with these considerations Ccmputational considerations In a transfer-based MT system, actual translation takes place in transfer and can be described as the ocr~putaticnal manipulation ... influenced by target language considerations: the interface structure between analysis and transfer was defined to take advantage of the similarities between the three languages and to acc...

Ngày tải lên: 17/03/2014, 19:21

4 394 0
Báo cáo khoa học: "Joint Learning of a Dual SMT System for Paraphrase Generation" pptx

Báo cáo khoa học: "Joint Learning of a Dual SMT System for Paraphrase Generation" pptx

... evaluations of paraphrase quality and rate tend to be incompatible To address the above problems, we propose a metric for tuning parameters and evaluating the quality of each candidate paraphrase ... criteria in paraphrase generation: adequacy measuring the semantic equivalency and paraphrase rate measuring the surface dissimilarity As they are incompatible (Zhao and Wang, 201...

Ngày tải lên: 23/03/2014, 14:20

5 352 0
Measuring the Economic Value of a City Park System docx

Measuring the Economic Value of a City Park System docx

... Philadelphia Philadelphia parks have support galore In fact, there are more than 100 “friends of parks” organizations Two of them, the Philadelphia Parks Alliance and Philadelphia Green, operate ... tive value of percent as the amount tax receipts that parkland adds to the assessed value of all dwellings within 500 feet of parks (The preponderance of studies has reveale...

Ngày tải lên: 02/04/2014, 08:20

28 386 0
Báo cáo hóa học: "Dynamics of a two-dimensional system of rational difference equations of Leslie–Gower type" doc

Báo cáo hóa học: "Dynamics of a two-dimensional system of rational difference equations of Leslie–Gower type" doc

... other than u1 and u2, then the interior of 〚u1, u2〛 is either a subset of the basin of attraction of u1 or a subset of the basin of attraction of u2 Kalabušić et al Advances in Difference Equations ... subset of the basin of attraction of E All orbits that start below this curve are attracted to E1 All orbits that start above this curve are attracted to E (A1 −...

Ngày tải lên: 21/06/2014, 00:20

29 241 0
Báo cáo hóa học: " Local existence and uniqueness of solutions of a degenerate parabolic system" pptx

Báo cáo hóa học: " Local existence and uniqueness of solutions of a degenerate parabolic system" pptx

... this article as: Zhang et al.: Local existence and uniqueness of solutions of a degenerate parabolic system Advances in Difference Equations 2011 2011:12 Submit your manuscript to a journal and ... gradients of solutions to degenerate parabolic systems Discr Contin Dyn Syst 26(2), 597–608 (2010) 14 Ladyzenskaja, OA, Solonnikov, VA, Ural’ceva, NN: Linear and q...

Ngày tải lên: 21/06/2014, 03:20

11 324 0
Báo cáo hóa học: " Research Article Dynamics of a Predator-Prey System Concerning Biological and Chemical Controls" ppt

Báo cáo hóa học: " Research Article Dynamics of a Predator-Prey System Concerning Biological and Chemical Controls" ppt

... involves an active human role Natural enemies of insect pests, also known as biological control agents, include predators, parasites, and pathogens Virtually all pests have some natural enemies, and ... Journal of Inequalities and Applications 17 12 J Sugie, “Two-parameter bifurcation in a predator-prey system of Ivlev type,” Journal of Mathematical Analysis and Appli...

Ngày tải lên: 21/06/2014, 07:20

17 334 0
Báo cáo hóa học: " Research Article Asymptotic Behavior of a Periodic Diffusion System" pot

Báo cáo hóa học: " Research Article Asymptotic Behavior of a Periodic Diffusion System" pot

... 1983 24 O Ladyzenskaja, V Solonnikov, and N Uraltseva, “Linear and quasilinear equations of parabolic type,” in Translations of Mathematical Monographs, vol 23, American Mathematical Society, ... “Global existence and blow-up for a nonlinear reaction-diffusion system,” Journal of Mathematical Analysis and Applications, vol 212, no 2, pp 481–492, 1997 Journal of Inequalities and Appl...

Ngày tải lên: 21/06/2014, 07:20

11 266 0
Báo cáo hóa học: "STABILITY OF A DELAY DIFFERENCE SYSTEM" pdf

Báo cáo hóa học: "STABILITY OF A DELAY DIFFERENCE SYSTEM" pdf

... that is, Ax ∗ ≤ A · x ∗ (4.1) for all x ∈ Rm and any (m × m) matrix A For real (m × m) matrix A, we define, as usual, A = max1≤ j ≤m m |ai j | and A ∞ = i= max1≤i≤m m |ai j | j= We will give a ... and D Komissarova References [1] L Berezansky and E Braverman, On exponential dichotomy, Bohl-Perron type theorems and stability of difference equations, Journal of Mathematical Analysi...

Ngày tải lên: 22/06/2014, 22:20

9 215 0
Báo cáo hóa học: " A Robust Parametric Technique for Multipath Channel Estimation in the Uplink of a DS-CDMA System" pot

Báo cáo hóa học: " A Robust Parametric Technique for Multipath Channel Estimation in the Uplink of a DS-CDMA System" pot

... exploits multipath channel parameters CONCLUSIONS In this paper, a new method for estimating the multipath channel parameters of a single user in the uplink of a DSCDMA system has been proposed The estimation ... way similar to S(τ) based on the already estimated path delays The value of the search step size δ a ects the estimation accuracy of...

Ngày tải lên: 22/06/2014, 22:20

12 439 0
Báo cáo khoa học: "Analysis and simulation of the architecture of a growing root system: application to a comparative study of several tree seedlings" ppsx

Báo cáo khoa học: "Analysis and simulation of the architecture of a growing root system: application to a comparative study of several tree seedlings" ppsx

... oaks and several acacias, which show marked differences in shoot growth and ramification Materials and Methods Acorns of oaks (Quercus petraea Liebl., Q rubra du Roi) and seeds of acacias (Acacia ... Statistical studies of these ture are data allow the determination of elongation laws and branching patterns They may then be integrated into a deterministic three-dimensi...

Ngày tải lên: 09/08/2014, 02:21

6 364 0
Development of a liposomal nanodelivery system for nevirapine ppsx

Development of a liposomal nanodelivery system for nevirapine ppsx

... was added and placed on a carbon coated grid The excess water was absorbed using a filter paper and uranyl acetate stain was added The grid was then washed with water to remove excess uranyl acetate ... atazanavir, by a human brain endothelial cell line Pharm Res 2008, 25:2262-2271 30 Kaur A, Jain S, Tiwary AK: Mannan-coated gelatine nanoparticles for sustained and targeted delivery...

Ngày tải lên: 10/08/2014, 05:21

9 359 0
w