state space representation of a closed loop system

The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System

The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System

... in nature to a data manager which fails to free data, but is easier to detect and prevent. ã Data manager changes data. A malicious data manager may change the value of its data on each cache refresh. ... data. It is usually made in response to a pager_data_request call made to the data manager by the kernel. Typical data managers will only provide data upon demand (when processing pager_data_request ... it initiates a cache replacement. A data manager may restrict the use of cached data by issuing a pager_data_lock request, specifying the types of access (any combination of read, write, and execute)...

Ngày tải lên: 12/09/2012, 15:05

23 1,3K 1
Báo cáo khoa học: Functional fine-mapping and molecular modeling of a conserved loop epitope of the measles virus hemagglutinin protein pdf

Báo cáo khoa học: Functional fine-mapping and molecular modeling of a conserved loop epitope of the measles virus hemagglutinin protein pdf

... peptide was at least partially oxidized and the signal of the reduced species increased as a result of oxidation. Identification of the active isoform Because of disulfide scrambling HPLC-purified isoforms rapidly ... deaths occur annually, making measles the most important cause of infant mortality worldwide. The low vaccine coverage and the low vaccine efficacy in the presence of maternal antibodies are major ... 0.769), a ễtwo -state reactionế model assuming a conformational change (v 2 ẳ 0.548) and a ễbivalent analyteế (v 2 ẳ 0.539) model using the BIAEVALUATION 3.01 software. It was not possible to generate...

Ngày tải lên: 08/03/2014, 08:20

13 492 0
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf

Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf

... AAACGCCTTCGCCCAAAGTTTAAAAGATGA 22 TCATCTTTTAAACTTTGGGCGAAGGCGTTT 23 TTTTCTCGAGAAAGATGCCGATTTGGGCGC 24 GGGGCTCGAGGTTTTATATTTGTTGTAAAA 25 ATATTATATATATATATAGGGTCGTATATA 26 AAATTATAGAAAGCAGTAGA TAAAACAATG 27 CTTCGAAGAATATACTAAAAAATGAGCAGG CAAGATAAACGAAGGCAAAGTTCAATTCA TCATTTTTTTTTTATTCTTTT 28 ... GCCCGGATCCTGATAGTAATAGAATCCAAA 4 CCCCGAATTCAAATTATAGAAAGCAGTAGA 5 AAGGCTCGAGAGATCTGTTTAGCTTGCCTC 6 AAAAGTCGACGAGCTCGTTTTCGACACTGG 7 TTTTGTCGACATGGCGCAACACGATGAAGC CGTAGACAAC 8 GGGGGGATCCTTACATAAGCGTACAACAAA CACTATTTGATTTCGGCGCCTGAGCATCA TTTAGCTTTTT 9 ... TTTTGTCGACATGGCGCAACACGATGAAGC CGTAGACAAC 18 GGGGGGATCCTTACATAAGCGTACAACAAA CACTATTTGATTTCGGCGCCTGAGCATCA TTTAGCTTTTT 19 ATCCAAAGTTTAGCCGATGACCCAAGCCAA 20 TTGGCTTGGGTCATCGGCTAAACTTTGGAT 21 AAACGCCTTCGCCCAAAGTTTAAAAGATGA 22...

Ngày tải lên: 16/03/2014, 01:20

9 444 0
The Design and Implementation of a Sequence Database System * docx

The Design and Implementation of a Sequence Database System * docx

... object-relational database system Illustra [I11941 provides database support for time-series data along with relational data. A time-series is an ADT(Abstract Data Type) value implemented a& amp; a large ... Catalog Management: Each E-ADT can provide catalogs that maintain statistics and store schema information. Further, certain values may be named. Query Language: An E-ADT can provide a query ... Object-relational systems like Illustra [11194], and Par- adise [DKLPY94] allow an attribute of a relational record to belong to an Abstract Data Type (ADT). Each ADT defines methods that may be...

Ngày tải lên: 16/03/2014, 16:20

12 573 0
Báo cáo khoa học: "DESIGN OF A MACHINE TRANSLATION SYSTEM " pptx

Báo cáo khoa học: "DESIGN OF A MACHINE TRANSLATION SYSTEM " pptx

... transfer-based MT system, actual trans- lation takes place in transfer and can be descri- bed as the ocr~putaticnal manipulation of tree structures. In the absenoe of any formal theory of translation ... This software tool not only allows for the separation of data and algorithms but also provides great flexibility in the organization of grammars and subgrammars, and in the control of the ... ~;Tp~oach does not make any claim to linguistic generaliza- bility for purposes other than the translation of this particular sublanguage. 4.1 Ccmputational considerations In a transfer-based...

Ngày tải lên: 17/03/2014, 19:21

4 394 0
Báo cáo khoa học: "Joint Learning of a Dual SMT System for Paraphrase Generation" pptx

Báo cáo khoa học: "Joint Learning of a Dual SMT System for Paraphrase Generation" pptx

... not readily available (Zhao et al., 2010). In contrast, bilingual parallel data is in abundance and has been used in extracting paraphrase (Ban- nard and Callison-Burch, 2005; Zhao et al., 2008b; Callison-Burch, ... issues are also raised in (Zhao and Wang, 2010) about using automatic metrics: paraphrase changes less gets larger BLEU score and the evaluations of paraphrase quality and rate tend to be incompatible. To ... and William B. Dolan. 2011. Collecting highly parallel data for paraphrase evaluation. In ACL, pages 190–200. David Chiang. 2007. Hierarchical phrase-based transla- tion. Computational Linguistics,...

Ngày tải lên: 23/03/2014, 14:20

5 352 0
Measuring the Economic Value of a City Park System docx

Measuring the Economic Value of a City Park System docx

... First, land cover data are obtained through analysis of aerial photographs. This reveals forested as well as open grassy areas and also water surface; it also reveals impervious surfaces in parks—roadways, ... D.C.’s Parks Value of properties within 500 feet of parks Assumed average value of a park Value of properties attributed to parks Effective annual residential tax rate Annual property tax capture ... to park-based social capital. Philadelphia Department of Parks and Recreation 11 Reducing the Cost of Managing Urban Stormwater Stormwater runoff is a significant problem in urban areas....

Ngày tải lên: 02/04/2014, 08:20

28 386 0
báo cáo hóa học: " Error mapping controller: a closed loop neuroprosthesis controlled by artificial neural networks" doc

báo cáo hóa học: " Error mapping controller: a closed loop neuroprosthesis controlled by artificial neural networks" doc

... interpre- tation of data and manuscript drafting; EDM have made part of acquisition of data, analysis and interpretation of data and have been involved in drafting the manuscript; and GF have made substantial ... present at this stage of the movement. The effect of variations of T fat was much more evident, when negative variations of T fat were simulated (meaning a faster occurrence of fatigue) and in fact ... increase of the RMSE was obtained when T rec was increased. Naturally, the first wave was not affected much by the variation of this parameter, like the variation in T fat , because fatigue was not...

Ngày tải lên: 19/06/2014, 10:20

13 394 0
Báo cáo hóa học: "Dynamics of a two-dimensional system of rational difference equations of Leslie–Gower type" doc

Báo cáo hóa học: "Dynamics of a two-dimensional system of rational difference equations of Leslie–Gower type" doc

... E 2 are locally asymptotically stable and E 3 is a saddle. There exists the global stable manifold W s (E 3 ) that separates the positive quadrant so that all orbits below this manifold are attracted ... 〚u 1 ,u 2 〛 other than u 1 and u 2 , then the interior of 〚u 1 ,u 2 〛 is either a subset of the basin of attraction of u 1 or a subset of the basin of attraction of u 2 . Kalabušić et al. Advances in Difference ... There exists a continuous increasing curve W E which is a subset of basin of attraction of E. All orbits that start below this curve are attracted to (+∞, 0). All orbits that start above this curve are attracted...

Ngày tải lên: 21/06/2014, 00:20

29 241 0
Báo cáo hóa học: " Local existence and uniqueness of solutions of a degenerate parabolic system" pptx

Báo cáo hóa học: " Local existence and uniqueness of solutions of a degenerate parabolic system" pptx

... quasilinear equations of parabolic type. Translation of Mathematical Monographs. American Mathematical Society, Providence. 23 (1968) 15. Friedman, A: Partial Differential Equations of Parabolic Type. ... RESEA R C H Open Access Local existence and uniqueness of solutions of a degenerate parabolic system Dazhi Zhang, Jiebao Sun * and Boying Wu * Correspondence: sunjiebao@126. com Department of Mathematics, Harbin ... Global and nonglobal weak solutions to a degenerate parabolic system. J Math Anal Appl. 324(1), 177–198 (2006). doi:10.1016/j.jmaa.2005.12.012 4. Okubo, A: Diffusion and Ecological Problems: Mathematical...

Ngày tải lên: 21/06/2014, 03:20

11 324 0
Báo cáo hóa học: " Research Article Dynamics of a Predator-Prey System Concerning Biological and Chemical Controls" ppt

Báo cáo hóa học: " Research Article Dynamics of a Predator-Prey System Concerning Biological and Chemical Controls" ppt

... Journal of Inequalities and Applications 17 12 J. Sugie, “Two-parameter bifurcation in a predator-prey system of Ivlev type,” Journal of Mathematical Analysis and Applications, vol. ... involves an active human role. Natural enemies of insect pests, also known as biological control agents, include predators, parasites, and pathogens. Virtually all pests have some natural enemies, and ... Management IPM is a pest control strategy that uses an array of complementary methods: natural predators and parasites, pest-resistant varieties, cultural practices, biological controls, various...

Ngày tải lên: 21/06/2014, 07:20

17 334 0
w