Vector sum phase shifter using a quadrature magic t for application in polarization control

Vector sum phase shifter using a quadrature magic t for application in polarization control

Vector sum phase shifter using a quadrature magic t for application in polarization control

... substrate in the coupled line area of the quadrature Magic- T A thinner substrate will result in a width of the coupled line in the magic- T being too thin to be fabricated; a thicker substrate ... between the two outputs The key component in part A is the novel Quadrature Magic- T The unique feature of this Quadrature Magic- T is its capability to perform v...

Ngày tải lên: 30/09/2015, 10:11

144 238 0
Design of broadband vector sum phase shifters and a phased array demonstrator

Design of broadband vector sum phase shifters and a phased array demonstrator

... types of phased arrays: passive and active phased arrays In passive phased arrays, antenna elements have a central transmitter/receiver (T/R) and a power distribution network There is generally ... diagram of phased array demonstrator and the 360º VSPS .48 Figure 5-3: Photo of the phased array demonstrator .49 Figure 5-4: Photo of the DAC AD5390 control of...

Ngày tải lên: 01/10/2015, 17:27

78 416 0
Báo cáo khoa học: Identification of sodium salicylate as an hsp inducer using a simple screening system for stress response modulators in mammalian cells pptx

Báo cáo khoa học: Identification of sodium salicylate as an hsp inducer using a simple screening system for stress response modulators in mammalian cells pptx

... Ishihara et al (Eur J Biochem 270) Here we examined the effects of SA on stress response in mammalian cells using a simple screening system, and revealed that SA is a potent Hsp inducer in mammalian ... expression of endogenous heat shock proteins such as Hsp1 0 5a and Hsp7 0 in various mammalian cells Enhancement of thermoresistance of cells...

Ngày tải lên: 17/03/2014, 10:20

8 471 0
Báo cáo khoa học: "Automatic Story Segmentation using a Bayesian Decision Framework for Statistical Models of Lexical Chain Features" pdf

Báo cáo khoa học: "Automatic Story Segmentation using a Bayesian Decision Framework for Statistical Models of Lexical Chain Features" pdf

... We have presented a Bayesian decision framework that performs automatic story segmentation based on statistical modeling of one or more lexical chain features, including lexical chain starts, ... Modeling of Lexical Chain Features Chain starts and ends We follow (Chan et al 2007) to model the lexical chain starts and ends at a story boundary with a s...

Ngày tải lên: 23/03/2014, 17:20

4 406 1
báo cáo hóa học: " A preliminary study of clinical assessment of left unilateral spatial neglect using a head mounted display system (HMD) in rehabilitation engineering technology" pdf

báo cáo hóa học: " A preliminary study of clinical assessment of left unilateral spatial neglect using a head mounted display system (HMD) in rehabilitation engineering technology" pdf

... potential to develop a human performance testing and training environment [23] and also a VR system for training individuals with unilateral spatial neglect to cross streets in a safe and vigilant ... deterioration of visual acuity The HMD system has the advantage of being non-invasive, safe, and one can easily change the size of the visual field Although the standard...

Ngày tải lên: 19/06/2014, 10:20

9 542 0
Báo cáo y học: "Threshold for detection of diabetic peripheral sensory neuropathy using a range of research grade monofilaments in persons with Type 2 diabetes mellitu" pot

Báo cáo y học: "Threshold for detection of diabetic peripheral sensory neuropathy using a range of research grade monofilaments in persons with Type 2 diabetes mellitu" pot

... 20 00 Nagai Y, Sugiyama Y, Abe T, Nomura G: The 4-g Monofilament is Clinically Useful for Detecting Diabetic Peripheral Neuropathy Diabetes Care 20 01, 24 :183-184 Saltzman CL, Rashid R, Hayes A, ... http://www.jfootankleres.com/content/1/1/9 Abbreviations ANOVA: analysis of variance; DM: diabetes mellitus; DPSN: diabetic peripheral sensory neuropathy; EST: particip...

Ngày tải lên: 10/08/2014, 21:23

7 312 0
Báo cáo y học: "Children''''s unique experience of depression: Using a developmental approach to predict variation in symptomatology" potx

Báo cáo y học: "Children''''s unique experience of depression: Using a developmental approach to predict variation in symptomatology" potx

... were transformed into a minority http://www.capmh.com/content/1/1/9 variable Similar to the analysis for gender, a factorial ANOVA with minority status (minority versus Caucasian) and the low and ... MA and the internalizing ratio score The sample's mean internalizing ratio score was 49 with a standard deviation of 25 The results indicate that mental age was a strong correlate of...

Ngày tải lên: 13/08/2014, 18:21

8 280 0
Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests

Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests

... Framework - Introd uced Marine Pests Phase – Consultancy  Identified current management capabilities and approaches  Priorities and hazards for APEC Economies  Considerations for a Risk Management ... Risk Management Framework  Conclusions, including the results of the November 2001 Workshop Management Framework - Introd uced Marine Pests Man...

Ngày tải lên: 28/10/2013, 11:15

10 584 0
Tài liệu Báo cáo khoa học: "A Finite-Slate Parser for Use in Speech Recognition" pdf

Tài liệu Báo cáo khoa học: "A Finite-Slate Parser for Use in Speech Recognition" pdf

... decomposed into [~'t][slzl In grammar and produces as output a chart like that below, indicating the this way standard chart parsing techniques can be adopted to process starting point and ending point ... point of each phrase in the input string allophonic and phonotactic constraints, if the constraints are reformulated in terms of a grammar lnput~ Sentenc(l: They t are flying planes H...

Ngày tải lên: 21/02/2014, 20:20

7 420 0
Báo cáo khoa học: A pre-docking role for microtubules in insulin-stimulated glucose transporter 4 translocation ppt

Báo cáo khoa học: A pre-docking role for microtubules in insulin-stimulated glucose transporter 4 translocation ppt

... demonstrating that microtubule-depolymerizing agents inhibit insulin-stimulated glucose uptake and GLUT4 translocation [19–21] and perturbation of the function of kinesin retards insulin-stimulated ... obligatory for insulin-stimulated GLUT4 translocation ** – Insulin Nocodazole – + – – + + + Fig Microtubule disruption inhibited insulin-stimulated GLUT4 translocation to the...

Ngày tải lên: 16/03/2014, 06:20

8 421 0
Báo cáo khoa học: Identification of a novel binding site for calmodulin in ammodytoxin A, a neurotoxic group IIA phospholipase A2 docx

Báo cáo khoa học: Identification of a novel binding site for calmodulin in ammodytoxin A, a neurotoxic group IIA phospholipase A2 docx

... CAAATACaAgCGGGtGAACGGGGCTATCGTCTGTGaAAAAGGC GGAATTCGCgGCcGCCtTGTCACACTCACAAATCCGATTCTC GGGCAAGCTTGCgGCcGCAATCTGCTTTCGAcAGAATCTGAAcACATAttcgAAAAAGTATATGC GGGCAAGCTTGCgGCcGCAATCTGCTTCCGAcAGAATCTGAAcACATACAgCTATATATATAGG ... 2a+ 2b+ 2– 3+wt 3+YIRN 3– TAATACGACTCACTATAGGGAGACCACAACGGTTTCC GGGCaagcTTCCCCGTCTCCtCCAGGATCATCtTCCCG GGGCAAgcttgCTaTTcCCTCCTACTCCTcTTACGGATGCTACTGCGGCtgGGGGGG GACTGCAaCCCC...

Ngày tải lên: 17/03/2014, 03:20

8 402 0
facile synthesis of porous a - fe2o3 nanorods and their application in ethanol sensors

facile synthesis of porous a - fe2o3 nanorods and their application in ethanol sensors

... °C in air at a heating rate of 10 °C min-1 X-ray diffraction (XRD) analysis was performed on a D/MAX-RAX diffractometer with Cu KR radiation (λ ) 0.154 18 nm) operating at 40 kV and 100 mA Diffraction ... porous R -Fe2O3 nanorods increases dramatically with the increase in the ethanol vapor concentration and is much higher than that of the R -Fe2O3 nanoparticles under...

Ngày tải lên: 19/03/2014, 16:48

5 459 1
báo cáo hóa học:" Force-feedback interaction with a neural oscillator model: for shared human-robot control of a virtual percussion instrument" doc

báo cáo hóa học:" Force-feedback interaction with a neural oscillator model: for shared human-robot control of a virtual percussion instrument" doc

... Force–feedback interaction with a neural oscillator model: for shared human–robot control of a virtual percussion instrument Edgar Berdahl∗ (edgar.berdahl@imag.fr), Claude Cadoz (claude.cadoz@imag.fr) ... Using a mechanical analog parameterization, we derive a force–feedback model structure that enables a human to share con- trol of a virtual percussion...

Ngày tải lên: 21/06/2014, 17:20

58 330 0
Tài liệu Báo cáo khoa học: "Lexical transfer using a vector-space model" doc

Tài liệu Báo cáo khoa học: "Lexical transfer using a vector-space model" doc

... (for a travel arrangement task), whose hierarchy is based on that of the Japanese commercial thesaurus Kadokawa Ruigo Jiten (Ohno and Hamanishi, 1984) We used our English-Japanese phrase book (a ... Japanese) Sato, S and Nagao, M (1990) Toward memory-based translation, Coling-90, pp 247-252 Sumita, E (2000) Word alignment using matrix PRICAI-00, 2000, (to appear) Tanaka H (1995) Statisti...

Ngày tải lên: 20/02/2014, 18:20

7 658 0
w