Electromagnetic properties and macroscopic characterization of composite materials
... ELECTROMAGNETIC PROPERTIES AND MACROSCOPIC CHARACTERIZATION OF COMPOSITE MATERIALS QIU CHENGWEI B ENG., UNIVERSITY OF SCIENCE AND TECHNOLOGY OF CHINA, 2003 A DISSERTATION ... negative-index materials (NIMs) In this thesis, the microscopic and macroscopic properties, the control of the geometry and functionality, and the potential applications of various c...
Ngày tải lên: 30/09/2015, 06:38
... describe the first purification of human recombinant kynureninase to homogeneity The protein was fully Fig Inhibition of kynureninase activity by L-kynurenine as a function of 3-hydroxykynurenine concentration ... regulation of enzyme activity in vivo and consequent channeling of substrate 3-hydroxykynurenine down the tryptophan– kynurenine metabolic pathway The p...
Ngày tải lên: 08/03/2014, 22:20
... MECHANICS AND ANALYSIS OF COMPOSITE MATERIALS MECHANICS AND ANALYSIS OF COMPOSITE MATERIALS Valery V Vasiliev Professor of Aerospace Composite Structures Director of School of Mechanics and ... elasticity, mechanics of composite materials, design, analysis, fabrication, and application of composite structures According to the list of books o...
Ngày tải lên: 22/03/2014, 12:20
design, synthesis, and characterization of polymeric materials for uses in energy storage applications
... focuses on the design, synthesis, and characterization of polymeric materials for energy storage applications, which include small molecule electrolyte additives, solid polymer electrolyte, and gel ... numbers of other synthetic polymers were developed and commercialized in response to the growing need for new materials in the automotive and aerospace indu...
Ngày tải lên: 13/11/2014, 11:13
Experimental investigation for powder reinforcement effect on mechanical properties and natural frequency of isotropic hyper composite plate with various boundary conditions
... 70 Table Experimental natural frequency results for isotropic hyper composite plate with different reinforcements short fiber and powder effect for various boundary conditions plate, with AR=1 ... 1316.2 Table Experimental natural frequency results for isotropic hyper composite plate with different reinforcements short fiber and powder...
Ngày tải lên: 09/09/2015, 10:06
Fabrication and characterization of composite membranes for gas separation
... Comparison of separation performance for hollow fiber membranes between the O2/N2 mixed gas and pure gas measurements……… … 245 Table B.3 Comparison of separation performance for hollow fiber membranes ... FABRICATION AND CHARACTERIZATION OF COMPOSITE MEMBRANES FOR GAS SEPARATION JIANG LANYING (B Sci., Wuhan University, P R China) A THESIS SUBMITTED FOR...
Ngày tải lên: 12/09/2015, 11:24
Computational study of EM properties of composite materials
... Applications of Composite Materials 1.2.2 Synthesis of Composite Materials 1.2.3 Measurement of Composite Materials 1.2.4 Analysis of Composite Materials ... development of composite materials The modeling of electromagnetic (EM) properties of the composite materials is widely carried out by many researchers [5—7] The accurate modeling of composite...
Ngày tải lên: 14/09/2015, 22:01
Synthesis and characterization of nanostructured materials using dispersion polymerization
... nanoparticles (size of Ag: 20 ± nm)……………… 141 XVI Chapter Introduction 1.1 Overview of Nanostructured Materials Nanostructured materials have attracted great research interest and the technology of their ... preparation of aqueous colloids, which is to use steric stabilizers in dispersion polymerization in aqueous media The dispersion polymerization produces particle...
Ngày tải lên: 15/09/2015, 17:10
Tài liệu A Dissertation on the Medical Properties and Injurious Effects of the Habitual Use of Tobacco pptx
... ***** A DISSERTATION ON THE MEDICAL PROPERTIES AND INJURIOUS EFFECT OF THE HABITUAL USE OF TOBACCO: READ, ACCORDING TO APPOINTMENT, BEFORE THE MEDICAL SOCIETY OF THE COUNTY OF ONEIDA, AT THEIR ... consumers, and why the candid among them acknowledge that these evils arise from its use? The health of the medical gentleman above named was materi...
Ngày tải lên: 17/02/2014, 22:20
Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx
... A novel high-activity D-hydantoinase from Jannaschia sp CCS1 obtain optically pure amino acids, namely chemical and enzymatic syntheses Chemical synthesis gives racemic mixtures of amino acids ... precipitate fraction; sup, supernatant fraction The molecular weight standard (lane M) is indicated on the right A novel high-activity D-hydantoinase from Jannaschia sp...
Ngày tải lên: 18/02/2014, 08:20
Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx
... Kumagaye KY, Nakajima K, Watanabe T, Kawai T, Kawakami Y, Niidome T, Sawada K, Nishizawa Y et al (1994) Omega-agatoxinTK containing D-serine at position 46, but not synthetic omega-[L-Ser46]agatoxin-TK, ... Inoue A, Kawakami Y, Nishizawa Y, Katayama K & Kuwada M (1995) Isolation and characterization of a peptide isomerase from funnel web spider venom J Biol Chem 270, 16719–16723 To...
Ngày tải lên: 18/02/2014, 17:20
Tài liệu Báo cáo khoa học: Molecular modeling and functional characterization of the monomeric primase–polymerase domain from the Sulfolobus solfataricus plasmid pIT3 doc
... mechanism of both RNA and DNA synthesis [17] In a previous study, we reported the findings of an analysis of the complete sequence of the cryptic plasmid pIT3 isolated from the crenarchaeon S solfataricus ... analyses of the predicted amino acid sequence showed that the C-terminal half of the RepA of the pIT3 plasmid is sequence-similar to the heli...
Ngày tải lên: 18/02/2014, 18:20
Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx
... TTCTCGAGATGGGAAAGTCTTCAGAGT GGT ACMSD real-time PCR: primer and probe ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT 2fw ATCCCAGGAAACACCAGTAGA 10rev ATTGTTTTCTCTCAAGACCCAA TaqMan probe T1 ACACCACAGCAAGGGAGAAGCAAAG ... kit (Stratagene, La Jolla, CA, USA) Mutagenic primers were: 5¢-CGCTCGAGA TGAAAATTGACATCGCTAGTCATATTCTACC-3¢ and its complement for His6Ala; 5¢-GACATCCATAGTGCT ATTCTACCAAAAGAATGGCC-3¢ and it...
Ngày tải lên: 19/02/2014, 02:20