Method development for the detection of microorganisms
... METHOD DEVELOPMENT FOR THE DETECTION OF MICROORGANISMS Liang Zhu (M Sc.) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF CHEMISTRY NATIONAL UNIVERSITY OF SINGAPORE ... usually required for the detection of the presence of pathogens in environmental samples and food samples As an example, in the detection of virus volume in ex...
Ngày tải lên: 16/09/2015, 15:54
... v INTERNATIONAL STANDARD ISO 6579:2002(E) Microbiology of food and animal feeding stuffs — Horizontal method for the detection of Salmonella spp WARNING — In order to safeguard the health of ... Members of ISO and IEC maintain registers of currently valid International Standards ISO 6887-1, Microbiology of food and animal feedin...
Ngày tải lên: 07/03/2014, 16:20
... 5'-CCGTAGGCGATGGTCGTCCTAACRAAYTGNGG-3' 5'-TACAAAATACAGCGAGTGATANATRAARCA-3' ORF 59 (RFHV/KSHV)7 5'-TGAAAATCCACAGGCATGAT-3' 1The terminal "a" or "b" in the primer name indicates the plus or minus sense of the gene transcription, ... at the WaNPRC DNA samples were obtained from PBMC of a random assortment of thirty macaques housed at the WaNPRC and analyzed using the...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt
... Capture probe 5-GAGGAGGATGAAATAGATGGTCCAGCTGG ACAAGCAGAACCGGACAGAGCCCATTACAATAT TGTAACCTTTTGTTGCAAGTGTGACTCT ACGCTTCGGT-3 Secondary probe 5-GGAGCGACCCAGAAAGTTACCACAGTTATGC ACAGAGCTGCAAACAACTA-3 ... on the basis of the cutoff value Detection of HPV- 16 with QDs and superparamagnetic nanoparticle-based hybridization The rationale of QDs and superparamagnetic nanopartic...
Ngày tải lên: 21/06/2014, 01:20
Báo cáo khoa học: " Development of a sandwich ELISA for the detection of Listeria spp. using specific flagella antibodies" potx
... Development of a sandwich ELISA for the detection of Listeria spp using specific flagella antibodies 45 Table Detection of spiked L monocytogenes 4b by sandwich ELISA Contamination levels of L monocytogenes ... the monoclonal antibodies (MAbs) and IgY against flagella of Listeria monocytogenes 4b, and to compare the sensitivity and specificity of...
Ngày tải lên: 07/08/2014, 18:21
Báo cáo khoa học: "Development of a Lightcycler-based reverse transcription polymerase chain reaction for the detection of foot-and-mouth disease virus" pps
... emaN ecneuqeS eborP esreveR drawroF eborP esreveR drawroF eborP esreveR drawroF '3-pxGCCAATTTCAGCCCAGGCACAAAm-'5 '3-TYCGGTTYGGGACCATGTT-'5 '3-AACTGTACAGRAGGACGTAGA-'5 '3-TAGCGCATGGTGGGCAACCTCCA-'5 ... 55/lizarb/oriezurc/4 2A rof ecneuqes ehT sniarts 21 eht rof dezylana saw noiger tegrat ehT )ASU ,ratsanD( erawtfos ratsanD eht gnisu dengila dna )1 elbaT( A C aisA 2TAS O O O O O O O O 55/liz...
Ngày tải lên: 07/08/2014, 18:21
Báo cáo khoa học: "Development of immunoassays for the detection of kanamycin in veterinary fields" pps
... ta nim 03 rof detabucni erew setalp eht ,yltneuqesbuS llew hcae ot dedda saw noitulos etartsbus )]dica cinoflus enilozaihtzneb lyhte-3[id-oniza-2,2( STBA lµ 001 ,gnihsaw retfA h rof esadixorep ... syad evitucesnoc rof yad/gk/gm 02 ta stibbar ot ylralucsumartni deretsinimda saw nicymanaK nicymanak fo noitartsinimda ralucsumartni retfa amsalp tibbar ni nicymanak fo eliforp noitelpeD elbaT ... e...
Ngày tải lên: 07/08/2014, 18:21
Báo cáo khoa học: "Development and evaluation of indirect ELISA for the detection of antibodies against Japanese encephalitis virus in swine" pptx
... saw noitcaer cinegomorhc eht dna ,nim 51 rof detabucni erew setalp ehT dedda saw )ASU ,LPK ;tanoflusnilozihtneb-lyhte-3-id-oniza-'2.2( STBA etartsbus eht fo emulov lacitnedi na ,h rof Co73 ta noitabucni ... 1.0/05DICT 002 gniniatnoc noisnepsus suriv 9981VK a fo emulov lauqe na htiw dexim erew ares eht fo snoitulid dlof-owt laireS sllec 401FT gnisu setalporcim llew-69 a ni demrofrep saw nim 03...
Ngày tải lên: 07/08/2014, 18:21
Báo cáo khoa học: " Development of a fluorescent quantitative real-time polymerase chain reaction assay for the detection of Goose parvovirus in vivo" ppsx
... template DNA preparation GPV CHV strain, a high-virulence strain of GPV, was obtained from Key Laboratory of Animal Diseases and Human Health of Sichuan Province Aleutian disease virus (ADV), canine ... size (bp) GPV-F GPV-R GPV-FP GTGCCGATGGAGTGGGTAAT ACTGTGTTTCCCATCCATTGG 6FAM-FTCGCAATGCCA ATTTCCCGAGGP TAMRA AAGCTTTGAAATGGCAGAGGGAGGA GGATCCCGCCAGGAAGTGCTTTATTTGA 3084-3103 3122-3143...
Ngày tải lên: 12/08/2014, 04:20
Báo cáo khoa học: "Genomic variability in Potato virus M and the development of RT-PCR and RFLP procedures for the detection of this virus in seed potatoes" ppt
... doi:10.1186/1743-422X-7-25 Cite this article as: Xu et al.: Genomic variability in Potato virus M and the development of RT-PCR and RFLP procedures for the detection of this virus in seed potatoes Virology ... detected in several potato samples from an experimental farm in the province of Page of Figure Sensitivity of RT-PCR using pr...
Ngày tải lên: 12/08/2014, 04:21
Báo cáo khoa học:" Development of TaqMan® MGB fluorescent real-time PCR assay for the detection of anatid herpesvirus 1?" pdf
... demonstrated that the established FQ -PCR assay is of highly specific The intra -assay and inter -assay CV of this established FQPCR was in the range of 1–3% for most of the dynamic range (from 1.0 × 109 ... TaqMan real-time PCR method Results Development and optimization of FQ -PCR and conventional PCR Following the optimization of FQ -PCR, final concent...
Ngày tải lên: 12/08/2014, 04:21
Báo cáo khoa học: " Development of TaqMan® MGB fluorescent real-time PCR assay for the detection of anatid herpesvirus 1" pdf
... demonstrated that the established FQ -PCR assay is of highly specific The intra -assay and inter -assay CV of this established FQPCR was in the range of 1–3% for most of the dynamic range (from 1.0 × 109 ... TaqMan real-time PCR method Results Development and optimization of FQ -PCR and conventional PCR Following the optimization of FQ -PCR, final concent...
Ngày tải lên: 12/08/2014, 04:21
Báo cáo y học: "Comparison of a Two-Lead, Computerized, Resting ECG Signal Analysis Device, the MultiFunction-CardioGramsm or MCG (a.k.a. 3DMP), to Quantitative Coronary Angiography for the Detection of Relevant Coronary Artery Stenosis (70%)
... Coronary angiography remains the gold standard for the morphologic diagnosis of CAD and also allows revascularization during the same procedure [12, 13] Coronary angiography is a relatively safe and ... Combined Analysis Total USA Asia Germany female male < 65 years 65+ years Female, < 65 years Female, 65+ years Male, < 65 years Male, 65+ years No Revasc PCI CABG Revasc...
Ngày tải lên: 03/11/2012, 10:58
Genotoxicity of 255 chemicals in the Salmonella microsome test (Ames test) and 8-hydroxyguanine (8-OH-Gua) assay for the detection of carcinogens
... Identification of C8-modified deoxyinosine and N2- and C8-modified deoxyguanosine as major products of the in vivo reaction of N-hydroxy-6-aminochrysene with DNA and the formation of the adducts in isolated ... recommend the Ames test using these sensitive strains (especially YG1041 and/ or YG1042) in combination with the standard tester strains (TA98 and TA...
Ngày tải lên: 05/09/2013, 08:40