Shell transformation model for simulating cell surface structure

Shell transformation model for simulating cell surface structure

Shell transformation model for simulating cell surface structure

... three main types: shell, shell with a liquid core, and solid model Shell Model The shell model adopts a thin shell theory to describe the deformation of the surface structure This model was applied ... the cell surface structures when the cell carries out the biological processes The changes are represented by transformation strains, forces, and dipoles in the sh...

Ngày tải lên: 10/09/2015, 08:36

142 254 0
Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx

Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx

... ATTTCCTCATTCCAATAATG TTGAACTACGATCCAGAAGC GGATCCTCATTGAGAACAATTTCCTTGA GGATCCATCATGTTCTCATCATCATAATATG GGATCCGTTAAATATAATGCAGTGACGAAGATA GGATCCAAGTCAAACCTTGAGAAAGAACGA CACGGCATATTATGATGATGAGAACATGATGGATCTCG ... ATCCAAACTTATAATATTAAAAAAAGCGCTACTTATATGCATCATTTCATGAATTCGAGCTCGTTTAAAC GCACTAGTATGAAAAGAATAAGATCGCTTT GCCCCGGGATCATTGAGAACAATTTCC GCGGATCCGTATGACCACATTCTATACTGA GAGCCAATATCAAATCTGGTGGT...

Ngày tải lên: 18/02/2014, 06:20

15 476 0
Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt

Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt

... anti-placental alkaline phosphatase (PLAP) agarose (C) SDS ⁄ PAGE and silver stain of proteins isolated from AP sepharose (lane 1) and FN3d–AP sepharose (lane 2) A protein band of approximately 95 kDa is ... nucleolin, mean that calculations of binding affinity are unrealistic at this stage Nucleolin localization in muscle is analogous to PTPr ligand localization To determine wh...

Ngày tải lên: 19/02/2014, 05:20

14 673 0
Báo cáo khoa học: N-Glycosylation is important for the correct intracellular localization of HFE and its ability to decrease cell surface transferrin binding pptx

Báo cáo khoa học: N-Glycosylation is important for the correct intracellular localization of HFE and its ability to decrease cell surface transferrin binding pptx

... effect of HFE binding to TfR1 is to lower the affinity of the receptor for transferrin [15] This most likely reflects the existence of overlapping HFE and transferrin- binding sites on the receptor ... understanding suggests that the majority of cell types regulate cellular iron levels by binding of transferrin to the type transferrin recepto...

Ngày tải lên: 06/03/2014, 22:21

16 540 0
Báo cáo khoa học: Crystal structure of a staphylokinase variant A model for reduced antigenicity pptx

Báo cáo khoa học: Crystal structure of a staphylokinase variant A model for reduced antigenicity pptx

... (1993) Interaction between staphylokinase, plasmin(ogen), and alpha2-antiplasmin Recycling of staphylokinase after neutralization of the plasmin -staphylokinase complex by alpha2-antiplasmin J Biol ... 26 Navaza, J (1994) AMORE: an automated package for molecular replacement Acta Crystallogr A5 0, 157±163 27 Brunger, A (1993) X-PLOR, Version 3.1 A System for X-Ray Crystallogr...

Ngày tải lên: 23/03/2014, 21:21

7 389 0
Báo cáo khoa học: "Structural Topic Model for Latent Topical Structure Analysis" pot

Báo cáo khoa học: "Structural Topic Model for Latent Topical Structure Analysis" pot

... In this paper, we propose a new topic model, named Structural Topic Model (strTM) to model and analyze both latent topics and topical structures in text documents To so, strTM assumes: ... compared with the baseline methods that don’t explicitly model the topical structure The results confirm the necessity of modeling the latent topical structures inside documents, and a...

Ngày tải lên: 30/03/2014, 21:20

10 466 0
Báo cáo hóa học: " Research Article A Robust Structural PGN Model for Control of Cell-Cycle Progression Stabilized by Negative Feedbacks" pdf

Báo cáo hóa học: " Research Article A Robust Structural PGN Model for Control of Cell-Cycle Progression Stabilized by Negative Feedbacks" pdf

... noise and parameters’ random variation The natural follow up of this research is to infer the PGN model from available dynamical data of cell-cycle progression, analogously to what we have done for ... regulatory system of the malaria parasite [5, 6] We anticipate that, very likely, analysis of these dynamical data will uncover unknown negative feedback loops in cell-cyc...

Ngày tải lên: 22/06/2014, 19:20

11 342 0
Báo cáo hóa học: "A Probabilistic Model for Face Transformation with Application to Person Identification" pot

Báo cáo hóa học: "A Probabilistic Model for Face Transformation with Application to Person Identification" pot

... using a face transformation model In the case where we have multiple template images for person P, we should combine them into a single face model ᏹ p (this would require a new formula for the face ... significantly outperform two popular face recognition algorithms, namely eigenfaces and fisherfaces Finally, we outline future work MODELING FACE TRANSFORMATION In this s...

Ngày tải lên: 23/06/2014, 01:20

12 357 0
Báo cáo khoa học: "Developing an Agrobacterium-mediated transformation system for Lilium x formolongo using thin cell layer of bulb scales" ppsx

Báo cáo khoa học: "Developing an Agrobacterium-mediated transformation system for Lilium x formolongo using thin cell layer of bulb scales" ppsx

... expression, implying a successful transformation of Lilium x formolongo by Agrobacterium using thin cell layers of bulb scales Fig Results of transformation via Agrobacterium using thin cell layers ... Nguyen Thi Thuy, Nguyen Quang Thach experiments, we investigated the potential of using thin cell layers of bulb scales for production of trangenic...

Ngày tải lên: 06/08/2014, 19:20

6 344 0
Báo cáo y học: "Identification of subpopulations with characteristics of mesenchymal progenitor cells from human osteoarthritic cartilage using triple staining for cell surface markers" docx

Báo cáo y học: "Identification of subpopulations with characteristics of mesenchymal progenitor cells from human osteoarthritic cartilage using triple staining for cell surface markers" docx

... by trypsin treatment (0.05% trypsin, 0.02% EDTA; Biochrom) at 75% confluence Flow cytometry analysis of cells Either isolated cells from OC were directly used for flow cytometric analysis or cells ... functionality of cell surface molecules on human mesenchymal stem cells J Biomed Sci 2003, 10:228-241 Reyes M, Verfaillie CM: Characterization of multipotent adult pro...

Ngày tải lên: 09/08/2014, 01:23

11 348 0
báo cáo khoa học: " Surface structure, model and mechanism of an insect integument adapted to be damaged easily" pot

báo cáo khoa học: " Surface structure, model and mechanism of an insect integument adapted to be damaged easily" pot

... cuticle surface of other arthropods than sawflies, such as in nymphs of bugs and ticks [13] and in adults of flies and dragonflies [14,15] Their function is to allow by stretching an increase of body ... for defense Insect Defenses: adaptive mechanisms and strategies of prey and predators Edited by: Evans DL, Schmidt JO Albany: State Univ of New York Press; 1990:...

Ngày tải lên: 11/08/2014, 00:22

11 224 0
Báo cáo khoa học: " A rapid and efficient method for studies of virus interaction at the host cell surface using enteroviruses and real-time PCR" potx

Báo cáo khoa học: " A rapid and efficient method for studies of virus interaction at the host cell surface using enteroviruses and real-time PCR" potx

... suspension for h at 4°C and virus attachment was subsequently measured using RT-PCR B) MOI TCID50 /cell of CVB2O was incubated as described in A) at 4°C or at room temperature and attached virus was measured ... demonstrating that incubation at a higher temperature reduced unspecific attachment of this virus to CHO cells, while attachment to CHO-CAR, CHO-DAF and...

Ngày tải lên: 12/08/2014, 04:21

6 231 0
Báo cáo y học: " Six host range variants of the xenotropic/polytropic gammaretroviruses define determinants for entry in the XPR1 cell surface receptor" ppt

Báo cáo y học: " Six host range variants of the xenotropic/polytropic gammaretroviruses define determinants for entry in the XPR1 cell surface receptor" ppt

... infectivity on mouse cells carrying the variants of Xpr1 (Table 2) Both viruses infected NIH 3T3 (Xpr1n) and cells carrying Xpr1sxv, but did not infect cells of M pahari (Xpr1p) or cells carrying Xpr1c ... carrying Xpr1sxv with high efficiency, shows very poor infectivity on cells carrying Xpr1c and on Rat2 cells, and is restricted by hamster cells and cells carrying the mouse Xpr...

Ngày tải lên: 12/08/2014, 23:22

11 217 0
Báo cáo sinh học: "Data transformation for rank reduction in multi-trait MACE model for international bull comparison" doc

Báo cáo sinh học: "Data transformation for rank reduction in multi-trait MACE model for international bull comparison" doc

... Table V Ranking correlations for Holstein bulls of the multiple lactation MACE (ML -MACE) and the reduced rank random regression MACE models with the random regression MACE model Rank reductions ... deviations, Interbull Bull 32 (2004) 46–52 Rank reduction in MT -MACE models 307 [10] Madsen P., Jensen J., Mark T., Reduced rank estimation of (co)variance components fo...

Ngày tải lên: 14/08/2014, 13:22

14 221 0
Development of human stem cell based model for developmental toxicity testing

Development of human stem cell based model for developmental toxicity testing

... toxicity 15 2.2.2 In vivo animal studies for developmental toxicity testing 17 2.3 In vitro animal -based models for developmental toxicity testing 18 2.3.1 The MM assay 19 2.3.2 ... However, current animal -based models for developmental toxicity testing is limited by time, cost and high inter-species variability, while human pluripotent stem cell (hPSC) mod...

Ngày tải lên: 09/09/2015, 08:18

165 243 0
w