a land transformation model for the saginaw bay watershed

... Human Exon 1.0 ST array and contains 10 paired tumor-normal cancer samples The data was ana-lyzed before [9, 26] and is publicly available on the Affymetrix website The HTA data The Human Transcriptome ... replicates This data set was also used to illustrate the FIRMA method [26] and is publicly available on the Affymetrix website The colon cancer data The colon cancer data was also generated with the ... signal in a microarray data set Given that exon k has been identi-fied to have substantial variation between the arrays, the Trang 4Fig 1 A clarification of the parameter estimation by the REIDS

Ngày tải lên: 25/11/2020, 17:48

... pro-Azaadi or pro-Pakistan; Jammu and Ladakh constitute the remaining 50 percent of the population and are largely pro-India 3 Bose, Sumantra Kashmir: Roots of Conflict, Paths to Peace (Massachusetts: ... between India and Pakistan The Kashmir issue – albeit not the only cause for conflict between India and Pakistan – remains a huge thorn in the India-Pakistan relationship Pakistan itself has consistently ... tourism The last interest is somewhat less straight-forward, since for the maximalists, azaadi can only mean independence from India Assuming all of Kashmir Valley’s Muslim population want to break

Ngày tải lên: 20/10/2022, 03:32

... molecules has a smaller impact on the final surface area of a skin graft Note also that the value for the latter parameter has a relatively large impact on the total number of days that the boundaries ... in a reduction of the final surface area of a skin graft Within the chosen ranges for the values of the parameters, we observe that a change in the value for the rate of morphoelastic change has ... with the gradual increase in the surface area of the skin graft, and the gradual decrease in both the cell density of the myofibrob-lasts and the concentration of the collagen molecules within the

Ngày tải lên: 19/11/2022, 11:40

... to the equations of motion Trang 14Equivalence of T-mode phase space to phase space of gravity in AdS1 ↔ 1 map between conserved charges in AdS and in wAdS !3 3 3 ● choose ● can show analytically ... Virasoro x Virasoro symmetry of non-propagating phase space ● propagating modes around black strings: Detournay, MG '12 Chern-Simons M.G., Strominger'10 Trang 20Stability analysis for travelling ... ● alternate writing: ● thermodynamics/ unit length identical to BTZ black string ● Limits → Poincaré/global null warped AdS Detournay, MG '12 Trang 11Phase space● all dependence in ; conformal

Ngày tải lên: 27/09/2017, 09:44

... p0ðqÞpg; for all U in the phase domain 2.2 Shock waves and the curves of admissible shock waves Recall that a shock wave of(1.1) and (1.2)between the two states Ul¼ ðql;ul;alÞ; Ur¼ ðqr;ur;arÞ (al¼ ar) ... Uris located on the right of the rarefaction fan, seeFig 2 Note that as a consequence of the formulas of the eigenvectors r1and r2, we have Trang 6The backward i-rarefaction wave curve RBiðU0Þ ... R2ðU2;URÞ; therefore the solution(3.51)makes sense Similar to theTheorem 3.1, we also have the following theorem Theorem 3.2 Assume that UL2 G2and aR>aL Consider the open set OBand the rectangle

Ngày tải lên: 16/12/2017, 14:16

... descriptive data (metadata) for a learning resource, including social data and paradata that are further shared in a common pool for aggregation, amplification and analysis However, this framework is application-bounded, ... aggregating social and usage data about their users suffer from a series of weaknesses In particular, they lack a common information model that would allow for exchanges of interaction data at ... The other model focuses on inferred data, or indicators, that are calculated after a series of transformations over the raw context metadata Trang 63.1 The raw context model The raw context model

Ngày tải lên: 10/01/2020, 07:20

... previous stage At the second stage, the variables of decision are related to with the machines to be used, the amount of available time in each process and the annual demand for each item The demand ... 242 Variables Accounts receivable associated with the sales of item [$] Accounts payable associated with the purchase of raw material for item [$] Binary variable equal to 1 if the machine ... on the assets needs to maximize the EVA, 0, otherwise Activation variable (binary) for the cost The first stage maximization formulation is stated taking into account equation (1) and (2) The

Ngày tải lên: 14/05/2020, 22:17

... delivering the research as well as the importance of the application of FC Model as a vocabulary teaching aid in improving students' language learning is revealed The aims and the significances of the ... various sources of vocabulary Vocabulary Trang 122 learning is an important and indispensable part of any language learning process Second or foreign language vocabulary acquisition has been an ... vocabulary Vocabulary is considered as an important component in English language teaching and learning According to Thornbury (2002), vocabulary is a crucial aspect in learning a language as languages

Ngày tải lên: 20/08/2020, 14:23

... (i.e the occurrecur-rence of an another mammary tumor on the same mammary gland) and/or of a new primary mammary tumor, and the animal’s outcome (alive or dead and cause of death, i.e., unrelated ... Normal mammary gland with a score 2+ for IGF1R, c Invasive ductal mammary carcinoma with a score 0 for IGF1R, d Invasive ductal mammary carcinoma with a score 1+ for IGF1R, (E) Invasive ductal mammary ... univariate analysis (Additional file 3: Tables S3 and Additional file 4: Table S4) By multivariate analysis, Table 3 Factors associated with overall survival (OS) in canine invasive mammary carcinomas

Ngày tải lên: 28/09/2020, 01:44

... employees and managers about the benefits of their tasks for themselves If the Made in Vietnam lean management is about the human intelligence, then “Tam The” is about the spiritual power “Tam The” ... organization Therefore, “Tam The” plays an important role in establishing the thinking foundation for the successful operation of Vietnamese organizations Practically, the Made in Vietnam lean management ... theoretical framework and rationale for research, the secondary data are collected through reviewing the relevant literature of Lean higher education, Vietnam higher education management and the Made

Ngày tải lên: 30/03/2022, 11:57

... of their own learning, moving away from a passive approach A major hurdle was their readiness to embrace this shift, particularly the habit of watching educational videos before class, as many ... in a rural area.The writing assessment rubric evaluates student responses across four key areas: Task Achievement, Coherence and Cohesion, Lexical Resource, and Grammatical Range and Accuracy These ... key criteria: Message Content, Fluency and Coherence, Lexical Resource, Grammatical Range and Accuracy, and Performance These criteria serve as the foundational elements for marking and assessing

Ngày tải lên: 28/06/2022, 10:00

... presents the absolute percentage bias associated with the ASE estimator(APBASE) Across all parameters, the mean APBASE value is about 9.3% (see last row) TheAPBASE values for the mean parameters of the ... each data set s, compute the median s.e for each model parameter across the 10 draws. Call this MSED, and then take the mean of the MSED values across the 20 data sets and label this as the asymptotic ... the mean estimate for each model parameter across the 10 random permutations used Label this as MED, and then take the mean of the MED values across the data sets to obtain a mean estimate Compute

Ngày tải lên: 19/10/2022, 02:54

... where AN is the national direct requirements matrix, ZN is the national transactions flow matrix and, XN is the diagonal matrix of the national total sectoral output Trang 6Based on the debate ... regional Input-Output table 3.2.1 Adjustment to a national I-O table As a start for the regionalisation the national transactions flow matrix was converted to the direct requirements matrix as follows: ... 3.1 Data used All the necessary data for the regionalization procedure were collected from the National Statistical Institute of Bulgaria (NSI), specifically the department of national accounts

Ngày tải lên: 21/10/2022, 16:24

... rather than separate location variables and coefficients, and we treated the variant’s annual mileage-by-age figures as usage values in the equations After calculating EDA-based repair costs by age, ... panel-data analytic techniques As more years of data on individual vehicles become available, it may be advantageous to adopt a panel-data approach 8 Improving Recapitalization Planning: Toward a Fleet ... Recapitalization Planning: Toward a Fleet Management Model for the HMMWV Table 4.1 Fleet Management Model Assumptions in Sensitivity Analyses and Base Case Replace Earlier Base Case Replace Later...

Ngày tải lên: 15/03/2014, 21:20

... Singapore The Straits of Malacca The Straits of Singapore The Straits of Singapore The Straits of Malacca The South China Sea The South China Sea The Straits of Singapore The Straits of Malacca The ... result in a gain for others The optimal management of shared stocks is an area that requires collaborative effort among the littoral nations of the Bay of Bengal and the Andaman Sea Demersal fish ... the Straits of Malacca and the adjacent waters of the Andaman Sea and the Indian Ocean In the process, an attempt is made to identify, examine, and rank those threats that have transboundary effects...

Ngày tải lên: 06/03/2014, 15:21

... wave  breaking  on  a natural  beach  To  verify  the accuracy  of  the numerical  model on  the simulation  of  the wave  transformation on  a natural  beach,  existing  experimental data on the wave dynamics in  ... of  various  wave  characteristics,  it  can  be  remarked  that  the numerical  model can  simulate  wave  transformation in  the nearshore  region  with  an acceptable accuracy.  006 005 ... wave  dynamics  in  the near  shore  area  and  in  the vicinity  of  coastal  structures.  It  has  been  found  that  the numerical  model can  satisfactorily  simulate  the wave  transformation,  ...

Ngày tải lên: 28/03/2014, 15:20

... Materials and methods All mathematical analysis and numerical tting were performed using the software package Mathematica 7.0 (Wolfram Research, Inc Champaign, IL, USA) The substrate in the calorimetric ... and off rate At a xed k2, a change in this ratio may be interpreted as a change in the afnity of the enzyme for the substrate Hence, we can assess relationships of this afnity parameter and the ... both qualitative and quantitative, are captured by the model For example, the model accounts well for the diminished burst (i.e the disappearance of the maximum) at low S0 (below 510 lm) In these...

Ngày tải lên: 28/03/2014, 23:20

... by the TUNEL labelling assay, to further validate the importance of cleaved caspase-3 as a relevant biomarker for apoptosis In an ideal setup these data would have been correlated to actual patient ... (GAPDH) (forward 5'AGAACGGGAAGCTTGTCATC; reverse 5'TGC-TGATGATCTTGAGGCTG) spanning an amplicon of 247 bp were always run in parallel for reasons of control RT-PCR products of caspase-3 were normalized ... regulator of the apoptotic pathway such as caspase-3 was also evaluated immunohistologically to study the induction of apoptosis For the cell lines, druginduced expression of caspase-3 was analyzed...

Ngày tải lên: 12/08/2014, 15:20

... £30,000/QALY Page 12 of 14 Another limitation relates to the available vaccine efficacy data Firstly, as the SPS trial did not include patients aged 50 to 59, the model assumed that the efficacy values ... [11] Validation Once the model had been developed, it was validated by comparison to the available clinical data Using the clinical information from the SPS trial comparing vaccine with placebo ... were available for mild, moderate, and severe pain associated with HZ and PHN Alternative utility values, based on an HZ population, were available from Bala et al [29] and the SPS [15] For both...

Ngày tải lên: 13/08/2014, 11:22

... the ACC Paradigm paper With the understanding that there is a great deal of room for qualification, clarification, and interpretation, we believe that Palmer's postulates capture the essential ... theory A theory is an explanation It is an effort to explain and make understandable a set of observations or facts that are otherwise confusing, paradoxical, or self-contradictory in some way, and ... musculoskeletal pain complaints, the overwhelming majority of which are spine related A small subset, approximately 5%, of patients have headache as a primary complaint Any reasonable estimate would place...

Ngày tải lên: 13/08/2014, 13:22