GTAG: A Lexicalized Formalism for Text Generation inspired by Tree Adjoining Grammar

Tài liệu Báo cáo khoa học: "Outilex, a Linguistic Platform for Text Processing" pdf

Tài liệu Báo cáo khoa học: "Outilex, a Linguistic Platform for Text Processing" pdf

... naturelles), page to appear, Leu- ven. ATALA. Eric Brill. 1995. Transformation-based error-driven learning and natural language processing: A case study in part-of-speech tagging. Computational Lin- guistics, ... the form of recursive automata (automata that call other automata). The termi- nal symbols are lexical masks (Blanc and Dister, 2004), which are underspecified word tags i.e. that r...

Ngày tải lên: 20/02/2014, 12:20

4 431 0
Tài liệu Báo cáo khoa học: "DiMLex: A lexicon of discourse markers for text generation and understanding" docx

Tài liệu Báo cáo khoa học: "DiMLex: A lexicon of discourse markers for text generation and understanding" docx

... 5 Summary and Outlook Discourse markers, words that signal the pres- ence of a coherence relation between adjacent text spans, play important roles in human text understanding and production. ... though. As we have illustrated above and will elaborate below, these words can carry a wide variety of semantic and pragmatic overtones, which render the choice of a...

Ngày tải lên: 20/02/2014, 18:20

5 535 0
Tài liệu Báo cáo khoa học: "Some Novel Applications of Explanation-Based Learning to Parsing Lexicalized Tree-Adjoining Grammars"" doc

Tài liệu Báo cáo khoa học: "Some Novel Applications of Explanation-Based Learning to Parsing Lexicalized Tree-Adjoining Grammars"" doc

... Some Novel Applications of Explanation-Based Learning to Parsing Lexicalized Tree-Adjoining Grammars" B. Srinivas and Aravind K. Joshi Department of Computer and Information ... tectures to show the effectiveness of our ap- proach. 1 Introduction In this paper we present some novel applications of the so-called Explanation-Based Learning techniq...

Ngày tải lên: 20/02/2014, 22:20

8 389 0
Báo cáo khoa học: "A Tree Transducer Model for Synchronous Tree-Adjoining Grammars" pdf

Báo cáo khoa học: "A Tree Transducer Model for Synchronous Tree-Adjoining Grammars" pdf

... (2009) for a more detailed exposition to XTT. 5 Synchronous tree- adjoining grammar XTT are a simple, natural model for tree trans- formations, however they are not suitably ex- pressive for all ... generally do not dis- cuss trees with error symbols explicitly. 4 Extended tree transducer An extended tree transducer is a theoretical model that computes a tree transfor...

Ngày tải lên: 17/03/2014, 00:20

10 295 0
Báo cáo khoa học: "Encoding Lexicalized Tree Adjoining Grammars with a Nonmonotonic Inheritance Hierarchy" potx

Báo cáo khoa học: "Encoding Lexicalized Tree Adjoining Grammars with a Nonmonotonic Inheritance Hierarchy" potx

... the tree nodes are labeled with syntactic categories and feature information and there is at least one leaf node labeled with a lexical category (such lexi- cal leaf nodes are known as anchors). ... above. an encoding of (largely equivalent) lexical rules that are an integral part of a nonmonotonic inheritance hierarchy that stands as a description of all the ele- ment...

Ngày tải lên: 17/03/2014, 09:20

8 351 0
Báo cáo khoa học: "Extraction of Tree Adjoining Grammars from a Treebank for Korean" pdf

Báo cáo khoa học: "Extraction of Tree Adjoining Grammars from a Treebank for Korean" pdf

... grammar development have been taken during last decades. Automatic grammar development means that a system extracts a grammar from a Treebank which has an implicit Treebank grammar. The grammar ... we extract TAG grammars and tree schemata. Above all, full-scale syntactic tags and well-formed morphological analy- sis in Sejong Treebank allow us to extract syntactic fe...

Ngày tải lên: 23/03/2014, 18:20

6 342 0
Báo cáo khoa học: "Discourse Structures for Text Generation" doc

Báo cáo khoa học: "Discourse Structures for Text Generation" doc

... in a text. The pattern of instantiation of schemas in a text is called a text structure. So, for our example text, one part of its text structure says that the text span of the whole text ... more comprehensive and more informative about text function than the text organization parts of previous text generation systems. 1, The Text Organization Problem Text ge...

Ngày tải lên: 24/03/2014, 01:21

9 307 0
Báo cáo khoa học: "TAG''''s as a Grammatical Formalism for Ceneration" doc

Báo cáo khoa học: "TAG''''s as a Grammatical Formalism for Ceneration" doc

... trees. As Kmch and Jmhi point out, this means that a TAG is incomplete ms an account of the structure of a natural language, e.g. a TAG grammar wW contain ~th an active and a passive form ... Adj~g Grammars, or "TAG's', (Josh/, Levy & Takahash/ 1975; Josh/ 1983; Kroch & Josh/ 1965) we~ developed as an al~ma~ive to the aandard tyntac~ formalism...

Ngày tải lên: 24/03/2014, 02:20

10 505 0
Báo cáo khoa học: "SemTAG: a platform for specifying Tree Adjoining Grammars and performing TAG-based Semantic Construction" pptx

Báo cáo khoa học: "SemTAG: a platform for specifying Tree Adjoining Grammars and performing TAG-based Semantic Construction" pptx

... 13–16, Prague, June 2007. c 2007 Association for Computational Linguistics SemTAG: a platform for specifying Tree Adjoining Grammars and performing TAG-based Semantic Construction Claire Gardent CNRS ... tree adjoining grammars. In Proceedings of LACL05, Bordeaux, France. A. Joshi and Y. Schabes. 1997. Tree- adjoining gram- mars. In G. Rozenberg and A. S...

Ngày tải lên: 31/03/2014, 01:20

4 204 0
báo cáo hóa học:" A rapid method for the generation of uniform acellular bone explants: a technical note" pot

báo cáo hóa học:" A rapid method for the generation of uniform acellular bone explants: a technical note" pot

... data analysis and the preparation of the manuscript. MJS supervised the study plan- ning, data analysis and preparation of the manuscript. All authors read and approved the final manuscript. Acknowledgements The ... reproduction in any medium, provided the original work is properly cited. Technical Note A rapid method for the generation of uniform acellula...

Ngày tải lên: 20/06/2014, 04:20

4 403 0
Báo cáo hóa học: " 3D-SoftChip: A Novel Architecture for Next-Generation Adaptive Computing Systems" pdf

Báo cáo hóa học: " 3D-SoftChip: A Novel Architecture for Next-Generation Adaptive Computing Systems" pdf

... such as a cellular phone, a GPS receiver, an MP3 player, an e-book reader, a digital camera, a portable television, a satellite radio, a handheld gaming platform, and so forth. This concept also ... program 4 execution Unit chip 2: program 2 execution Unit chip 3: program 3 execution Data frame buffer Data frame buffer Data frame buffer Data frame buffer Data memory Data memory Data m...

Ngày tải lên: 22/06/2014, 23:20

13 229 0
Báo cáo hóa học: " A Generalized Algorithm for the Generation of Correlated Rayleigh Fading Envelopes in Wireless Channels" ppt

Báo cáo hóa học: " A Generalized Algorithm for the Generation of Correlated Rayleigh Fading Envelopes in Wireless Channels" ppt

... variables at the output of the Rayleigh simulator may have arbitrary values, depending on the variances of the Gaussian random variables at the inputs of Doppler filters as well as the characteristics ... random variables (with Rayleigh fading envelopes) is achieved. In addition, note that the variance of the jth Gaussian random variable in Z is the jth ele...

Ngày tải lên: 23/06/2014, 00:20

15 607 0
Báo cáo y học: "FusionSeq: a modular framework for finding gene fusions by analyzing paired-end RNA-sequencing data" pdf

Báo cáo y học: "FusionSeq: a modular framework for finding gene fusions by analyzing paired-end RNA-sequencing data" pdf

... Access FusionSeq: a modular framework for finding gene fusions by analyzing paired-end RNA-sequencing data Andrea Sboner 1,2† , Lukas Habegger 1† , Dorothee Pflueger 3 , Stephane Terry 3 , David ... of each pri- mer (forward, TMPRSS2 exon 1 - TAGGCGC GAGCTAAGCAGGAG; reverse, ERG exon 5 - GTAGGCACACTCAAACAACGACTGG; as published by Tomlins et al. [23]) and 50 ng cDNA at...

Ngày tải lên: 09/08/2014, 22:23

19 522 0
GTAG: A Lexicalized Formalism for Text Generation inspired by Tree Adjoining Grammar

GTAG: A Lexicalized Formalism for Text Generation inspired by Tree Adjoining Grammar

... G-TAG: A Lexicalized Formalism for Text Generation inspired by Tree Adjoining Grammar LAURENCE DANLOS TALANA, Université Paris 7 & LORIA Introduction G-TAG is a formalism to generate texts ... & Joshi 1998) have proposed also a TAG grammar for text. Their approach will be compared with mine in Section 6. 8 / G-TAG : a Lexicalized Formalism for...

Ngày tải lên: 22/10/2014, 11:27

26 1,1K 0
w