Electromagnetic Field Theory: A Problem Solving Approach Part 17 doc

... system or a gate. An AI problem solver can thus use a systemic grammar as part of its knowledge base, and solve grammatical problems in exactly the same way as it solves medical problems using ... where AI problem solving techniques are applied directly to an unadulterated systemic gram- mar. This approach is made possible by a special relationship between systemic gramm...

Ngày tải lên: 18/03/2014, 02:20

... CTC ACC AGG AGA TTA CAA CAT GG Malorny et al., 2004 minced meat 2: AGC TCA GAC CAA AAG TGA CCA TC fish 3: CAC CGA CGG CGA GAC CGA CTT T fimC 10 3 CFU/ml 1: ATA AAT ... 1: CATTGATGCCATGGGTGACART 2: CGTGACGATAATCCGTGTAC 3: TACACGAGTCACTAAATCCTTCAGT (Set II) Table 3. Detection of Salmonella using real-time PCR.increase of the released dye concentratio...

Ngày tải lên: 22/06/2014, 04:20

... Rotary         ∂ ∂ − ∂ ∂ +       ∂ ∂ − ∂ ∂ +         ∂ ∂ − ∂ ∂ = ∂ ∂ ∂ ∂ ∂ ∂ =×∇= y a x a k x a z a j z a y a i aaa zyx kji aarot x y zx y z zyx    Số phức Hàm mũ ( ) ysiniycoseee xiyxz +== + Hàm mũ là một hàm tuần hoàn có chu kì là 2πi. Thực vậy, ta có 1k2sinik2cose ik2 =π+π= π Suy ... Các tham số điện và hình học c a hệ điện từ và môi trường đối...

Ngày tải lên: 12/10/2012, 15:00

... phương trình Maxwell sau đây t E JEH 0E ∂ ∂ εε++σ=×∇ r rrr , J E ≡ J O (1.83) t H JE 0M ∂ ∂ μμ−−=×∇ r rr Ta được 33 6 2 211 ac a a cca r r r + ∂ ∂ +=×∇ (1.84) 6 1 5442 a a caca ∂ ∂ −−=×∇ r rr ... luật cảm ứng điện từ c a Faraday và định luật dòng điện toàn phần c a Ampere, Maxwell bằng lý thuyết đã chỉ ra sự tác dụng tương hỗ gi a đt và từ trườ ng cùng với việc đ a ra...

Ngày tải lên: 17/10/2013, 17:15