germ cell protocols, volume 1
... and Sardet, C. (19 81) Sperm chemotaxis in siphonophores. Biol. Cell 40, 11 9 12 8. 13 . Maier, I. and Müller, D. G. (19 86) Sexual pheromones in algae. Biol. Bull. 17 0, 14 5 17 5. 14 . Olson, J. H., ... Schatten Germ Cell Protocols Volume 1: Sperm and Oocyte Analysis Volume 253 METHODS IN MOLECULAR BIOLOGY TM METHODS IN MOLECULAR BIOLOGY TM Edited by Heide Schatten Germ C...
Ngày tải lên: 11/04/2014, 09:43
germ cell protocols, volume 2
... midgestation of putative germ cell- derived clones, we hypothesize that either gonadal cells other than germ cells may have been picked instead of true germ cells or that a subset of germ cells may not have undergone ... Gonadal cells, including donor germ cells, are mechanically isolated from (B6OG2)F1 fetuses at 13 .5 16 .5 dpc and used fresh within 3 h. Germ cells are selecte...
Ngày tải lên: 11/04/2014, 09:43
calcium binding protein protocols volume 1
... Smillie 16 1 10 Purification of Recombinant Calbindin D 9k Eva Thulin 17 5 ix 11 S100 Proteins: From Purification to Functions Jean Christophe Deloulme, Gaëlh Ouengue Mbele, and Jacques Baudier 18 5 12 ... Baudier 18 5 12 Cadherins Jean-René Alattia, Kit I. Tong, Masatoshi Takeichi, and Mitsuhiko Ikura 19 9 13 α-Lactalbumin and (Calcium-Binding) Lysozyme Katsutoshi Nitta 211...
Ngày tải lên: 11/04/2014, 00:24
... AATTTATGCCTACAGCCTCC 10 . 16 78 + ACCAGCACCATGCAACTTTT 11 . 16 83 a (T) 15 GCTGG 12 . 17 52 + GTGCCTTGGGTGGCTTTAGGGCATGGACAT 13 . 18 06 a (T) 15 AGCTC 14 . 18 08 a (T) 15 GAAGC 15 . 18 24 − AGAGAGTAACTCCACAGAAG a Oligonucleotides ... no. 11 750 41) . 10 . Taq DNA polymerase (Invitrogen, cat. no. 18 038- 018 ). 11 .Titan One Tube RT/PCR System (Roche, cat. no. 18 55476)....
Ngày tải lên: 11/04/2014, 09:45
... proportion (4, 5 in the argument 3–7; 12 , 13 in the argument 10 15 ; 16 , 18 in the argument 15 19 ). In Steps 3–7, both ratios are substituted. In 10 15 and 15 19 , only one 90 on the sphere and the ... Elements V .18 . 19 3 Interlude, recalling Elements XII .14 . 19 4 Elements V.9. 19 5 SC I .15 . 19 6 Elements VI.4. 88 on the sphere and the cylinder i The answer may be the fol...
Ngày tải lên: 21/09/2012, 11:00
SIEMENS WINCC CONFIGURATION MANUAL VOLUME 1
... Configuration Manual 4-35 C79000-G8276-C139- 01 Part of a program to explain pointers { int number1; int *pointer1; number1 = 12 3; pointer1 = &number1; } This example is the best way of explaining ... a,b,c; int result1,result2,result3,result4,result5; a=3; // binary 011 b=5; // binary 10 1 result1=a&b; // AND result2=a|b; // inclusive OR result3=a^b; // exclusive OR result4=a&...
Ngày tải lên: 02/11/2013, 14:36
Tài liệu Building Scalable Cisco Internetworks - Volume 1 docx
... ID (19 2 .16 8 .1. 67) (Process ID 10 ) Router Link States (Area 1) Link ID ADV Router Age Seq# Checksum Link count 19 2 .16 8 .1. 67 19 2 .16 8 .1. 67 48 0x80000008 0xB 112 2 19 2 .16 8.2 .13 0 19 2 .16 8.2 .13 0 212 0x80000006 ... reserved. BSCI v3.0—3 -11 debug ip ospf packet R1#debug ip ospf packet OSPF packet debugging is on R1# *Feb 16 11 :03: 51. 206: OSPF: rcv. v:2 t :1 l:4...
Ngày tải lên: 13/12/2013, 10:15