The first measurement (3.2.2) demonstrates that the DNA sensor works properly with sensitivity of 0.13 mS/nM. However, the biomaterials are degraded over the time.
Therefore, we need to verify the reproducibility of the DNA sensor by measuring rematching process of that sensor after thermal denaturation process.
In this work, the DNA sensor used was immersed in a breaker at T>Tm (melting point of DNA double helix) and then quickly freezed in an ice bath for 2 minutes to obtain the single DNA strand.
Firstly, we need to determine the melting point of DNA double helix on the DNA sensor used.
i) The melting point of DNA double helix
The melting temperature of DNA probe depends on its length and can be calculated by the formula (4.1) discovered by Marmur and. Doty, 1962.
Tm = 69.3 + 0.41(G + C) (4.1)
Whereas:
G,C: the number of G-type and C-type nucleotide in DNA strand, respectively.
In this case, the DNA has 20 nucleotides (AACGCCGATACCATTACTTA), so G = 2, C = 6.
Substituted from (4.1), we have:
Tm (DNA probe) = 69.3 + 0.41×(2+6) = 72.58oC.
74
The theoretical melting temperature of DNA proble is 72.58oC, the point where the DNA double helix can splits into two DNA strands.
ii) Reproducibility of the DNA sensor
As calculated above, we determine Tm = 78.280C, theoretically. In our experiment, DNA sensor was immersed into double distilled water at 850C for 5 minutes (to get complete denaturation) and then quickly freezed in an ice bath for 2 minutes to obtain the single DNA strand. Afterwards, the DNA sensor was immersed into the cell containing the sample to detect the DNA target as the second time. The different output signal between the matching and rematching is illustrated in Fig 3.18.
Figure 3.18. The reproducibility of DNA sensor. C(probe)= 0.05M.
As presented in Fig 3.18, the output signal of the DNA sensor changes slightly compared with that before denaturation (Δδ= 5.3%).
75
To test the stability of fabrication technique, some measurements were carried out by using different sensors (prepared at the same condition) with the same DNA target concentration variation and DNA probe (0.05M) immobilized on the surface electrode. The calculated result indicated that the relative standard deviation of the output signal of these sensors was approximately 9%. This result recommends that the DNA sensor is reproducible and reusable.
76
CONCLUSION
Although there are numerous studies on PPy based DNA sensor, our study achieved some interesting results summerised in this section.
The synthesis of PPy nanowires was obtained by using potentiostat method in the presence of gelatin. In which:
The polymerization potential is 0.75V; the supporting electrolyte used was LiClO4 0.1M (PBS, pH =7); the proper synthesis condition was established with 0.5 mL pyrrole monomer; 0.08% wt gelatin; 400 seconds of reaction time.
The morphologies, chemical composition and functional groups were studied based on SEM, FI-IR and Surface Enhanced Raman Spectroscopy (SERS) technique. It supposes that gelatin incorporated as “soft template” for PPy nanowire growth. As the result, the N-H bond was orientated upward Platinum electrode surface which is believed an advantage for the DNA probe immobilization.
The Ppy nanowires are 50 nm (diameter), very consistent, and suitable for DNA sensor application.
The immobilization of the DNA sequence on the surface of the sensor was carried out based on the linkage between NH–group of PPy conducting polymer and phosphate groups of probe DNA. The output signal of the hybridization DNA probe–DNA target was recorded by Lock-in Amplifier SR 830.
The response time of the DNA sensor is 10 seconds. The detection limit is as low as 0.1 nM of E.Coli bacteria DNA (20 bases) concentration at ambient temperature. The detection limit is better than that of our previous result (2nM) (1). The first experiments shows that the sensor has good reproducibility.
(1)P.D. Tam et al. / Materials Science and Engineering C 30 (2010) 1145–1150 RECOMMENDATIONS
77
The structures and hence the properties of the resulting polypyrrole are strongly influenced by a number of parameters that are not perfectly controlled. Besides pyrrole monomer, gelatin and reaction time, other work should study on effect of other factors (nature of electrode, temperature, component of couterion, ect.) on properties of PPy nanowires. Especially, PPy polymerization should be further investigated in the presence of dopants like Ag, Au, Ti which is expected to gain more interesting properties of PPy nanowires for various application. For DNA sensor, the reproducibility should be further conducted for statistic evaluation.
78
REFERENCES [1] A. Angeli (1916). Gazz. Chem. Ital. 42, 279.
[2] A. G. MacDiarmid et al (1983), Polarons and Soliton Model in doped polyacetylene, J. De Physique C3, 513.
[3] A. Moser, H. Neuebauer, K. Maurer, J. Theiner, A. Neckel(1992), Springer Series Solid State Sci, 107, 276.
[4] A.Ye. Pelekh, V.I.Krinichnyi et al (2003), An EPR study of the relaxation parameters in polyacetylene, Polymer Science U.S.S.R, Volume 33, Issue 8, 1991, 1615-1623.
[5] Aunar Kassim, H.N.M Ekarmul Mahmud et al.(2006), Electrochemical preparation and characterization of polypyrrole–polyethylene glycol conducting Polymer Composite Films, The Pacific Journal of Science and Technology, volume 7, 104-105.
[6] Baibarac, M.; Lapkowski, M.; Pron, A.; Lefrant, S.; Baltog (1998), I. J. Raman Spectrosc. , 29, 825.
[7] C.J. Zhong, Z.Q. Tang, Z.W. Tian (1990), J. Phys. Chem. 94, 2171.
[8] C.K. Chiang, C. R. Fischer, Y. W. Park, A. J. Heeger, H. Shirakawa, E. J. Louis, S.C. Gau, A. G. MacDiarmid (1977), Phys. Rev. Letters, 30, 1098.
[9] Charles M. Jenden, Richard G. Davidson and Terrence G. Turner, A Fourier transform – Raman spectroscopic study of electrochemical polypyrrole film, Australia, 3032.
[10] Dall’olio, Y. Dascola and G. P. Grandini (1969), C.R. Acad. Sci. 267, 4336.
[11] Dongtao Ge, Jing Mu, Sanquing Huang et al (2010), Electrochemical synthesis of polypyrrole nanowires in the presence of gelatin. Synthetic Metal, 11, 016.
[12] D.G. Shchukin, K. Kohler, H. Mohwald(2006), J. Am. Chem.. Soc. 128, 4560.
[13] E. Noelting (1989), Scientific and Industrial History of Anilin black, J.
Matheson, New York.
[14] G. Natta, G. Mazzanti (1958), P. Corradini, Atti Accad. Lincei Cl. Sci. Fis. Mat.
Nat. Rend, 25, 3.
79
[15] G.P. Gardini (1973), Adv. Heterocycl. Chem. 15, 67.
[16] H. Shirakawa, F. J. Louis, A. G. MacDiarmid, C. K. Chiang, A. J. Heeger (1977), J. Chem. Soc., Chem. Commun. 578.
[17] Hesse, E. (1999); Creighton, J. A. Langmuir, 15, 3545.
[18] Hui Peng, Lijuan, Christian Soeller, Jadranka Travas-Sejdic, Conducting polymers for electrochemical DNA sensing, Biomaterials 30 (2009), 2132-2148.
[19] Joji J Anchanattu (1994), Preparation of Certain conducting polypyrroles and Study on their Physical Properties, Mahatma Gandhi University, 9-13.
[20] J. L. Breadas, B. Themans and J.M. Andre (1984), The role of mobile organic radicals and ions in the transport properties of doped conjugated polymers, Synthetic Metals, 9, 265-274.
[21] J.W. Goodwin, G.M. Markham, B. Vinent(1997), J. Phys. Chem. B 101 1961.
[22] L. Letheby (1862), J.Chem. Soc. 15, 161.
[23] Lam T. D, Binh N.H, Thinh N. N, Hien L. T, Chie. N. D (2004), Fabrication and characterization of microscale DNA sensor, the Second International Workshop on Nanophysics and Nanotechnology (IWONN’04), Ha Noi, 22-23, p177-180.
[24] Liver, N.; Nitzan, A.; Gersten (1984), J. Chem, Phys. Lett, 111, 449.
[25] M.D. Ingram, H. Staesche, K.S. Ryder (2004), J Power Source 129, 107.
[26] M.Fleischman, P.J.Hendra, A. McQuillan(1974), J. Chem. Phys. Lett. 26, 123.
[27] Metin ak, Synthesis of polythiophene and polypyrrole derivatives and their application in electrochromatic devices, doctoral thesis in physics, (2006) 10.
[28] Nathalie K. Guimard et al (2007), Conducting polymers in biomedical engineering, Sci.
[29] Nguyễn Đình Triệu (2000), Các phương pháp phân tích vật lý và hoá lý, tập I, Khoa học kỹ thuật.
[30] Ramanavicius A, Ramanaviciene A, Malinauskas A (2006), Electrochemical sensors based on conducting polymer-pyrrole. Electrochem Acta; 51(27): 287- 93.
80
[31] Reza Ansari (2006), Polypyrrole Conducting electroactive Polymers: Synthesis and Stability Studies, E-Journal of Chemistry, vol.3, 186-201.
[32] S. Cosnier, R. E. Ionescu, S. Herrmann, L. Bouffier, M. Demeunynck, R. S.
Marks (2006), Anal. Chem. 78, 7054.
[33] S.M.Sze(1986), Semiconductor sensor, John Wiley&sons
[34] S. SChantz, L.M. Torell (1988), J.R. Stevens. Appl. Phys. 64, 2038.
[35] Standford Research System (1999), Manual book of Lock-in Amplifier-model SR830.
[36] Sunjie, Li Fang, Xutang Oing and Yun Lu (2010), Surface-enhanced Raman scattering study of Ag@PPy nanoparticles, Journal of Raman Spectroscopy, 41, 119-1123.
[37] Syritski V, Idla K, Opik A (2004) Synthesis and redox behavior of PEDOT/PSS and PPy/DBS structures. Synthetic Metals, 144: 235-239.
[38] Thevenot, D.R; Toth; Durst, R.A.; Wilson (1999), G.S. Electrochemical biosensors; Recommended definitions and classification, Pure Appl. Chem, 71, 2333-2348.
[39] Tian, G. Zebri (1990), J. Chem. Phys. 92, 3892.
[40] Walt R J and Bargon J (1984), Tedrahedron, 40 (20), 3963-3970.
[41] Wenqin Wang et al (2010), Controlled fabrication of surface-enhanced-Raman scattering-active silver nanostructures on polypyrrole films, Materials Chemistry and Physics 124, 385-388.
[42] William Andrew (1989), Inherently conducting polymers: processing, fabrication, applications and limitations, doping of conjugated polymers, 40-42.
[43] Xiuhua Wang, Mingwang Shao, Guang Shao, Yan Fu, Shaowu Wang (2009), Reversible and efficient photocurrent switching of ultra-long polypyrrole nanowires, Synthetic Metals 159, 273-276.
[44] Y.C. Liu (2004), J. Electroanal. Chem. 571, 255.
[45] Yu-Chuan Liu, Bing-Joe Hwang, Wen-Jie Jian, Raman Santhanam (2000), In stitu cyclic voltammetry-surface-enhanced Raman spectroscopy, Thin Solid Films 374, 85-91.