... argument made by Saraceni (2015) that takes a critical approach to World Englishes and the central dilemma of reconciling language as system with language as social practice Because the examination ... 34 Chapter 4: DATA ANALYSIS 35 4.1 Analysis and results of learners’ data 35 4.2 Analysis and results of teachers’ data 43 4.3 Analysis and results of administrators’ ... overseas for some time Q13 Ok, thank you What you think about Vietnamese training programs for ELT teachers to teach pronunciation? LT8 As far as I know, this kind of programs are not popular in
Ngày tải lên: 23/05/2019, 09:08
... from a mile away and can portray an initial first impression of being lazy, having a lack of initiative and professionalism One size fits all approach: If you have applied for multiple jobs using ... Time To Find A New Job Gavin F Redelman, RedStarResume Download free books at Gavin F Redelman, RedStarResume Time To Find A New Job Download free eBooks at bookboon.com Time To Find A New Job ... “Additional Work Experience” below that to account for large gaps of time • Leave out irrelevant jobs Your resume is essentially a marketing tool to demonstrate your qualifications for a particular
Ngày tải lên: 28/02/2018, 11:46
The IT professionals guide to researching a new industry get to know your industry for a happy and successful career
... Looking at annual reports can be a quick way to get accurate information, as well as a smart way to get access to data that may require subscribing to a paid service 18< Finding the Right Information ... the average for all industries Thus, when you are looking at a company, compare its net profit margin to the average, which will give you an idea of how well the company is performing against its ... official off-screen Academy Awards events for the Oscar-nominated cinematographers Information about Keyboard Wizardis at broadway-performance-systems.com Paul currently works for the U.S Department
Ngày tải lên: 05/03/2019, 08:48
Thuyết trình tiếng anh Skill you need for a future job
... become more and more important in most workplaces Computer skill Computer skill Make a plan Do presentation Language skill The ability to speak a second language is a great skill in a globalized economy ... SKILLS YOU NEED FOR A FUTURE JOB Nguyen Thi Bich Trang_DC009 SUMMARY: I Neccesary skills Computer skill Language skill Soft skill II Conclusion I NECCESARY SKILLS Computer skill ... Language skill The ability to speak a second language is a great skill in a globalized economy 2 Language skill w Soft skill Soft skill Soft skill Soft skill II CONCLUSION [...]...3 Soft skill 3
Ngày tải lên: 03/11/2015, 10:53
Báo cáo khoa học: Inhibition kinetics of catabolic dehydrogenases by elevated moieties of ATP and ADP – implication for a new regulation mechanism in Lactococcus lactis potx
... catabolic dehydrogenases by elevated moieties of ATP and ADP – implication for a new regulation mechanism in Lactococcus lactis Rong Cao, Ahmad A. Zeidan, Peter Ra ˚ dstro ¨ m and Ed W. J. van ... I 1 and I 2 , respectively. Data fitting and statistical analysis Parameter estimation and statistical analysis were carried out using the Surface Fitting Tool (sftool)inmatlab (R2009a). The parametric ... 6149–6156. 16 Avigad G (1966) Inhibition of glucose 6-phosphate dehydrogenase by adenosine 5¢-triphosphate. Proc Natl Acad Sci USA 56, 1543–1547. 17 Nakamura M, Fujiwara A, Yasumasu I, Okinaga S & Arai
Ngày tải lên: 29/03/2014, 08:20
context-aware pervasive systems architectures for a new breed of applications
... can perhaps happen when one starts to ask, “What if X is an aware system?” — whatever X may be — and ask this question often enough A context-aware X can also be contextaware in different ways, ... organization that provides licenses and registration for a variety of users For organizations that have been granted a photocopy license by the CCC, a separate system of payment has been arranged ... 162–163 Automotive applications, 17 Autonomic Communication project, 132 Autonomic computing, Availability of information, 162 Avatars, 176, 177 Aware objects, 75–81, See also Contextaware artifacts;
Ngày tải lên: 01/06/2014, 00:18
uninhibited robust and wide-open a free press for a new century jan 2010
... Don Graham, Kent Greenawalt, Miklos Haraszti, David Ignatius, Merit Janow, Nicholas Lemann, Menachern Mautner, Navanethem (Navi) Pillay, Jeff Sachs, Karl Sauvant, Joseph Sax, Joel Simon, Paul Steiger, ... that actual damage to a [ 14 ]... differential taxation.”16 Similarly, in Arkansas Writers’ Project, Inc v Ragland (1987), the Court held unconstitutional a state statute imposing a sales ... Relations Act (NLRA) when it discharged an employee for engaging in union-organizing activities.10 The AP at the time was a cooperative organization of the press that gathered news and disseminated
Ngày tải lên: 10/06/2014, 21:50
Báo cáo hóa học: " Research Article Strong Convergence Theorem for a New General System of Variational Inequalities in Banach Spaces" pdf
... System of Variational Inequalities in Banach Spaces S Imnang1, and S Suantai2, Department of Mathematics, Faculty of Science, Thaksin University, Phatthalung Campus, Phatthalung 93110, Thailand Centre ... classical variational inequality VI C, A In 2006, Aoyama et al first considered the following generalized variational inequality problem in Banach spaces Let A : C → X be an accretive operator ... Yao, M A Noor, K Inayat Noor, Y.-C Liou, and H Yaqoob, “Modified extragradient methods for a system of variational inequalities in Banach spaces,” Acta Applicandae Mathematicae, vol 110, no 3,
Ngày tải lên: 21/06/2014, 07:20
Báo cáo hóa học: "PROJECTION ITERATIVE APPROXIMATIONS FOR A NEW CLASS OF GENERAL RANDOM IMPLICIT QUASI-VARIATIONAL INEQUALITIES" pdf
... Nonlinear Functional Analysis and Applications 9 (2004), no 3, 451–465 [19] M A Noor and S A Elsanousi, Iterative algorithms for random variational inequalities, Panamerican Mathematical ... fascinating areas have been acce lerating the random v ari- ational and random quasi-variational inequality problems to be introduced and studied by Chang [4], Chang and Zhu [7],Choetal.[8], Ganguly and ... functionals, Applied Mathematics and Computation 122 (2001), no 3, 267–282 [11] A Ganguly and K Wadhwa, On random variational inequalities, Journal of Mathematical Analysis and Applications 206 (1997),
Ngày tải lên: 22/06/2014, 22:20
Báo cáo toán học: "Mixing time for a random walk on rooted trees" pot
... [9],[21] a Hopf algebra of Connes and Moscovici [10], and a Hopf algebra of Grossman and Larson [18]), and as a paper of Hoffman [19] makes clear, the combinatorics o f these Hopf algebras is very ... removing a single terminal vertex and reattaching it. There are several ways of quantifying the convergence rate of a Markov chain on a state space X to its stationary distribution; we use the maximal ... Mixing time for a random walk on rooted trees Jason Fulman Department of Mathematics University of Southern California, Los Angeles, CA, US A fulman@usc.edu Submitted: Aug 8, 2009; Accepted:
Ngày tải lên: 08/08/2014, 01:20
Báo cáo y học: "Expert consensus on hospitalization for assessment: a survey in Japan for a new forensic mental health system" pot
... Japan for a new forensic mental health system Akihiro Shiina1,2*†, Mihisa Fujisaki1,2†, Takako Nagata3†, Yasunori Oda4†, Masatoshi Suzuki5†, Masahiro Yoshizawa6†, Masaomi Iyo7† and Yoshito Igarashi2† ... Igarashi2† Abstract Background: In Japan, hospitalization for the assessment of mentally disordered offenders under the Act on Medical Care and Treatment for the Persons Who Had Caused Serious Cases ... equally Department of Psychiatry, Chiba University Hospital, Chiba, Japan Full list of author information is available at the end of the article serious criminal offense while in a state of insanity
Ngày tải lên: 09/08/2014, 01:21
Báo cáo y học: " Response of a simian immunodeficiency virus (SIVmac251) to raltegravir: a basis for a new treatment for simian AIDS and an animal model for studying lentiviral persistence during antiretroviral therapy" pptx
... Laboratory Animals, as well as according to animal care standards deemed acceptable by the Association for the Assessment and Accreditation of Laboratory Animal Care International ... pre- and post-raltegravir viral load measurements was done. Viral load values at Day 0, Day 7 and Day 10 were compared with viral loads at 27 and 166 days prior to treatment start. Significant ... Calif.) was used, which targets a conserved region of. .. used: SIV2-U 5’ AGTATGGGCAGCAAATGAAT 3’ (forward primer), SIV2-D 5’ GGCACTATTGGAGCTAAGAC 3’ (reverse primer), SIV-P 6FAM-AGATTTGGATTAGCAGAAAGCCTGTTGGA-TAMRA
Ngày tải lên: 12/08/2014, 23:23
Báo cáo y học: "Natural variation of HIV-1 group M integrase: Implications for a new class of antiretroviral inhibitors" pdf
... Shimura K, Kodama E, Sakagami Y, Matsuzaki Y, Watanabe W, Yama- taka K, Watanabe Y, Ohata Y, Doi S, Sato M, Kano M, Ikeda S, Mat- suoka M: Broad Anti-Retroviral Activity and Resistance Profile of a ... Y, Matsuzaki Y, Watanabe W, Yamataka K, Sato M, Kano M, Ikeda S, Matsuoka M: In vitro antiviral activity and resistance profile of a novel HIV integrase inhibitor JTK-303/GS-9137 ICAAC ... lated for each pair of mutations. J RAND was calculated as the mean Jaccard similarity coefficient after 2,000 random rearrangements of the X or Y vector (containing 0 or 1 for presence or absence
Ngày tải lên: 13/08/2014, 05:21
access 2010 design the tables for a new database
... repeated data, and you move it into a table all its own. Start with a plan Design the tables for a new database Save time and effort by making a plan. As part of that, you make sure each table ... database — a database you publish to a Microsoft® SharePoint® site. Design the tables for a new database Start with a plan Design the tables for a new database Save time and effort by making a ... related together in a way that lets you find information and extract meaning from your data. Start with a plan Design the tables for a new database Save time and effort by making a plan. That
Ngày tải lên: 24/10/2014, 15:09
korten - agenda for a new economy; from phantom wealth to real wealth (2009)
... Harvard’s middle management, MBA, and doctoral programs and served as Harvard’s adviser to the Central American Management Institute in Nicaragua He subsequently joined the staff of the Harvard ... the late 1970s, Korten left U.S academia and moved to Southeast Asia, where he lived for nearly fifteen years, serving first as a Ford Foundation project specialist and later as Asia regional adviser ... to formulate and advance a New Economy agenda Korten earned his MBA and PhD degrees at the Stanford University Graduate School of Business Trained in organization theory, business strategy, and
Ngày tải lên: 01/11/2014, 19:19
Tài liệu . . . And Communications For All A Policy Agenda for a New Administration ppt
... outreach to make more educators, librarians, and rural health care providers aware of the programs and for evaluation to update and analyze data on program utilization and to assess impacts of ... fall just as we learned that Barack Obama will lead the new administration. We believe that the challenges we identify and the route we each offer provide an essential roadmap for his new administration ... Implementation This chapter advocates an information age social contract that provides universal access to broadband. A social contract of this nature derives its le- gitimacy from the fundamental...
Ngày tải lên: 15/02/2014, 19:20
Tài liệu For a New LibertyThe Libertarian Manifesto Revised Editionby Murray N. RothbardCollier pdf
... Property and Exchange 35 has just transformed into a wheatfield—and vice versa of course for an Iowan baby and a Pakistani farm. Land in its original state is unused and unowned. Georgists and ... ideological spectrum. As late as 1848, such militant laissez-faire French liberals as Frederic Bastiat sat on the left in the national assembly. The classical liberals had begun as the radical, ... property has passed, by sale or by inheritance, from one 10 For a New Liberty militarism, mercantilist restrictions, and war for the advantage of the nation-state; and industry and manufacturing...
Ngày tải lên: 16/02/2014, 01:20
Tài liệu Education for a New Era docx
... Implementation Team mem- bers: Her Excellency Sheikha Ahmad Al Mahmoud, Sheikha Abdulla Al Misnad, Mohamed Fathy Saoud, Nasser Abdulghani, Abdul Jaleel Al Hamanat, Bader Al Qayed, and Eiman Al Ansari. • xxvii Student ... for International Student Assessment QEWC Qatar Electricity and Water Company QCEA Qatar Comprehensive Educational Assessment QNEDS Qatar National Education Data System QSAS Qatar Student Assessment ... it has a unique status in today’s world because of its oil and natural gas reserves, its strategic location, and its bold leadership. Bordered on the south by Saudi Arabia, Qatar has a flat,...
Ngày tải lên: 18/02/2014, 01:20
Tài liệu Education for a New Era, Executive Summary docx
... ﻡﺎﻴﻘﻟﺍ • iv Education for a New Era A research brief: A New System for K–12 Education in Qatar. is document is available in English as RAND RB-9248-QATAR and in Arabic as RAND RB-9248/1-QATAR. All three ... monograph: Education for a New Era: Design and Implementa- tion of K–12 Education Reform in Qatar. is document is avail- able in English as RAND MG-548-QATAR. An executive summary: Education for a ... State of Qatar. For more information about this monograph, contact Dr. Charles A. Goldman, Associate Director, RAND Education. He can be reached by email at charlesg@rand.org; by telephone at...
Ngày tải lên: 18/02/2014, 01:20
Bạn có muốn tìm thêm với từ khóa: