... different ways, as follows: ¾ The shapes can be drawn on slides where they may be used, and then manually assign the action setting ¾ The shapes can be copied and pasted on as many slides as may be ... presentation In order to resume the presentation where the class left off last time, you can use a reminder note that you might lose or, alternatively, you can use a macro to mark the spot Trang ... To make this code more secure, use a Scenario: Each day, you are required send an e-mail to a particular person Today you forgot, and now you’re over at a friend’s house To send this daily...
Ngày tải lên: 14/08/2014, 09:22
... misleading statements that cause you to believe there's a chance, when, in fact, there's not. 40. A good way to end a call where you don't accomplish your primary objection (and ... that you accomplish something on each call, and you can hold your head high with a sense of achievement. Remember, a decision of any type is better than shadow-chasing someone who will waste your ... detailing the quantity price breaks. What you'll do is compare that to what you're getting now, and if we're within 5%, you'll agree to a trial order on our next call, is that...
Ngày tải lên: 20/10/2013, 06:15
Báo cáo hóa học: "Dynamics of a two-dimensional system of rational difference equations of Leslie–Gower type" doc
... global stable manifold W s(E3) that separates the positive quadrant so that all orbits below this manifold are attracted to the equilibrium point E1, and all orbits above this manifold are attracted ... the basin of attraction of E All orbits that start below this curve are attracted to E1 All orbits that start above this curve are attracted to E (A1 − A2 − β1 + γ2 ) 4B2 R13 A1 = β1 , A1 + A2 ... formula for the global stable manifold Mathematics Subject Classification (2000) Primary: 39A10, 39A11 Secondary: 37E99, 37D10 Keywords: Basin of attraction, Competitive map, Global stable manifold,...
Ngày tải lên: 21/06/2014, 00:20
Báo cáo toán học: "A two-dimensional pictorial presentation of Berele’s insertion algorithm for symplectic tableaux" doc
... we call the symbol λ/µ a skew partition and the set Dλ \ Dµ the diagram of λ/µ The diagram of a skew partition is also called a skew (Young) diagram A skew Young diagram is called a horizontal ... for multiset permutations takes w to a pair (P, Q) where P is a semistandard tableau of the same weight as w, and Q is a standard tableau of the same shape as P The standardization w = w1 w2 · ... both the standardized and ˜ unstandardized cases Suppose the intermediate tableau T of the standard case at this point is obtained from the intermediate tableau T of the unstandardized case by modified...
Ngày tải lên: 07/08/2014, 08:22
402Part II: SQL and SQL*PlusWithin the into table clause, you can use the recnum keyword to pps
... view, you can reference tables in a remote database via a database link The account that the database link uses in the remote database must have access to the tables and views used by the database ... local database For information about the available storage parameters, see the “Storage” entry in the Alphabetical Reference If the data has already been replicated to a local table, you can use ... is available to all users in a database By contrast, a private database link is only available to the user who created it It is not possible for one user to grant access on a private database...
Ngày tải lên: 07/08/2014, 14:20
Office VBA Macros You Can Use Today phần 1 docx
... runs a macro to do it for you Take Advantage of UserForms VBA can provide UserForms If you have ever used a wizard in a software application, then you have used a UserForm If you have ... VBA & Macros for Microsoft Excel Office VBA: Macros You Can Use Today page a Foreword This page intentionally left blank page b Office VBA: Macros You Can Use Today ... to provide an easy user interface, to restrict entry of data to valid values, and to allow the application to work behind the scenes Office VBA: Macros You Can Use Today page 1 Int...
Ngày tải lên: 14/08/2014, 09:21
Office VBA Macros You Can Use Today phần 2 ppsx
... check if a file exists in order to display an error message and cancel or exit the macro in a user-friendly manner Trang 6Exl In the macro TestFileExists, you can change the Path variable to ... macros run automatically as long as macros are enabled in the workbook Providing a Calendar to Choose Dates for Input Use this procedure to facilitate the entry of dates by displaying a calendar ... ByVal sum_range As Range) As Variant¶ 'Limit the range to the used range¶ 'Intersect method takes cells common to both Range and¶ 'Range.Worksheet.UsedRange¶ Set Range = Intersect(Range, Range.Worksheet.UsedRange)¶...
Ngày tải lên: 14/08/2014, 09:21
Office VBA Macros You Can Use Today phần 3 ppt
... changing of variables because the variables are changed through an input box provided to the user. Converting Data to a Tabular Format With this macro, you can convert data into a format that ... good layout for data entry might be a bad one for analyzing data. A survey is a typical example, presented to the participant looking like this: Excel Procedures Office VBA: Macros You Can Use ... Procedures page 76 Office VBA: Macros You Can Use Today Exl 'Did the user cancel?¶ If TypeName(sReplace) = "Boolean" Then Exit Sub¶ 'Turn off screen updating¶ Application.ScreenUpdating...
Ngày tải lên: 14/08/2014, 09:21
Office VBA Macros You Can Use Today phần 4 pot
... Consider what to place as a separator between the number and the paragraph text By default, the macro uses a point (period,... way to dynamically display or bring data into Word, thus saving the user ... page 126 Office VBA: Macros You Can Use Today Wrd ' * * * * *¶ Function DoubleBackslashes(s As String) As String¶ 'Variable declaration¶ Dim newString As String, startPos As ... Office VBA: Macros You Can Use Today page 123 Wrd 'Debug.Print FilePath, LinkPath¶ 'Suppress screen flicker as much as possible¶ Application.ScreenUpdating = False¶ 'Save...
Ngày tải lên: 14/08/2014, 09:21
Office VBA Macros You Can Use Today phần 5 ppsx
... particular page Graphical objects formatted with text wrap are always anchored to a paragraph They always appear on the same page as that paragraph So even if an object has been positioned relative ... original field names¶ 'in an array so that we can check against it¶ 'for the field names used in any calculations¶ 'Add the increment to the field names, and to¶ 'the field names in any calculation¶ ... original field names¶ 'in an array so checking against the array¶ 'for the field names used in any calculations¶ Trang 15Wrd 'Add the increment to the field names, and to¶ 'the field names in any...
Ngày tải lên: 14/08/2014, 09:21
Office VBA Macros You Can Use Today phần 6 doc
... string into a table b The record separator must always be a paragraph mark; the field separator can be any character Choose one that is not present in the data 2 Prepare the mail merge main document ... ProcessPieChart(ByRef ds As Graph.DataSheet, _¶ tbl As Word.Table, ByVal nrDataCols As Long)¶ 'Variable declaration¶ Dim rwData As Word.Row¶ Dim datavalue As Double¶ Dim rwLabels As Word.Row¶ ... MailMergeData, MailMergePieChartLetter, MailMergePieChartData, MailMergeColChartLetter, and MailMergeColChartData There are four basic ways to accomplish this; all of these methods require a macro...
Ngày tải lên: 14/08/2014, 09:22
Office VBA Macros You Can Use Today phần 7 pdf
... BookmarkName As String) As String¶ 'Variable declaration¶ Dim var As Word.Variable¶ If varExists(doc, varDuplicateName) = False Then¶ ActiveDocument.Variables.Add _¶ Name:=varDuplicateName, ... 'Calculate that name¶ BookmarkName = "txt" & var.Value¶ var.Value = CStr(CLng(var.Value) + 1)¶ 'Alternately, a prompt can be displayed¶ 'to ask the user ... & var.Value¶ var.Value = CStr(CLng(var.Value) + 1)¶ 'Alternately, a prompt can be displayed¶ 'to ask the user for the name¶ 'Uncomment the next two lines to use that...
Ngày tải lên: 14/08/2014, 09:22
macromedia flash mx advanced for windows and macintosh
... Pearson Education Macromedia is a registered trademark, and Macromedia Flash and Flash are trademarks of Macromedia, Inc Throughout this book trademarked names are used Rather than put a trademark symbol ... promote theatrical releases with Flash animations; and online gaming and educational sites provide rich user experiences with Flash interactivity As a vector-based animation and authoring application, ... is a technique for interpolating amorphous changes that can t be accomplished with instance transformations such as rotation, scale, and skew Fill, outline, gradient, and alpha are all shape attributes...
Ngày tải lên: 03/06/2014, 02:04
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf
... d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) following the manufacturer’s ... Monod, Paris, France) as template DNA MnSOD was cloned using the primers ECM-5¢ d(5¢-AGCTATACCCTGCCATCCCTG) and ECM-3¢ d(5¢-TTATTTTTTCGCCGCAAAACGTG) and E coli genomic DNA as template PCR was carried ... simultaneously after inoculation of media with cultures grown to exponential phase in the absence of paraquat and IPTG (Materials and methods [24]) The final concentration of paraquat and IPTG used...
Ngày tải lên: 21/02/2014, 01:21
Báo cáo toán học: "The Quantum Double of a Dual Andruskiewitsch-Schneider Algebra Is a Tame Algebra" pdf
... know that the most typical examples of basic Hopf algebras of finite representation type are Taft algebras and the dual of A( n, d, μ, q), which as an associative algebra is generated by two elements ... generally tame Hopf algebras, we need more examples of tame Hopf algebras The Andruskiewitsch-Schneider algebra is a kind of generalization of generalized Taft algebra and of course Taft algebra Therefore, ... Therefore, it is natural to ask the following question: whether is the quantum double of dual AndruskiewitschSchneider algebra a tame algebra? In this paper, we give an a rmative answer As a consequence,...
Ngày tải lên: 06/08/2014, 05:20
Báo cáo sinh học: "The genetic control of ovariole in Sitophilus oryzae L is temperature sensitive" pptx
... 1970; Ganesalingam, 1974) At the anterior tip of each ovariole, a bacteriome containing intracellular bacteria is formed (Mansour, 1930; Nardon, 1971) This apical bacteriome disappears in the absence ... Temperature-sensitive gaster IV A mutation affecting Nat Acad Sci USA 67, 738-745 eye facet mutations in arrangement in a Drosophila melanopolarized manner Proc Ganesalingam VK (1974) Morphological ... type at 29°C and mutant type at 21°C, Foster and Suzuki, 1970); and in a homeotic mutation affecting imaginal discs, giving normal arista segment of the antennal complex at 29°C and a tarsus at...
Ngày tải lên: 09/08/2014, 18:21
Báo cáo y học: "Gene Therapy: The Potential Applicability of Gene Transfer Technology to the Human Germline"
... promoters and enhancers (etc) can be included in MACs Preliminary research indicates that MACs can be used, via pronuclear microinjection, to create transgenic animals in which the MACs are maintained ... does appear to be somewhat better than that of pronuclear microinjection The available experimental data on standard human ICSI (i.e not involving genetic modification) indicate that: (a) the majority ... Hirabayashi M, Takahashi R, Ito K, et al A comparative study on the integration of exogenous DNA into mouse, rat, rabbit, and pig genomes Exp Anim 2001; 50(2):125-131 Bishop JO Transgenic Mammals...
Ngày tải lên: 03/11/2012, 10:01
Báo cáo y học: "The primary prevention of birth defects: Multivitamins or folic acid"
... (0.01-0.47) * Anencephaly 2, Anencephaly +spina bifida (lumbal, thoracolumbal) 2, Spina bifida 2, thoracolumbal 1, lumbosacral ** Anencephaly ***Anencephaly 1, Spina bifida 8, thoracolumbal 1, lumbal 4, ... and other candidate CAs [14] On the other hand the large population-based dataset of the Hungarian Case-Control Surveillance of Congenital Abnormalities (HCCSCA) [17] can provide a chance for ... acid As far as I know the Hungarian data sets are unique to answer these questions On the one hand now the results of the two Hungarian intervention trials are available and their pooled data...
Ngày tải lên: 03/11/2012, 10:05
Báo cáo y học: "Study of the early steps of the Hepatitis B Virus life cycle"
... Hepatitis B Foundation of America; an Appropriation from the Commonwealth of Pennsylvania USA, Nucleonic Inc (PA USA) Drs Satishchandran C and Cathy Pachuk (Nucleonics Inc, PA, USA), Baohua Gao ... hepatitis B virus envelope are virus neutralizing Vaccine 1986 4(1): 35-7 34 Machida A, Kishimoto S, Ohnuma H, Miyamoto H, Baba K, Oda K, Nakamura T, Miyakawa Y, Mayumi M A hepatitis B surface antigen ... C, Ruvoletto MG, De Falco S, Marino M, Valente M, Nitti D, Gatta A, Fassina G Overexpression of squamous cell carcinoma antigen variants in hepatocellular carcinoma Br J Cancer 2004 90 (4): 833-837...
Ngày tải lên: 03/11/2012, 10:09