... merging potential players in Asian countries, such as China, Japan, Singapore, Malaysia, Taiwan and South Korea are noted (Lasanowski, 2009) In Taiwan, there has been significant increase in the ... participants was the lack of English version on the library’s database With a few complaints, Linh described what he expe-rienced in using online database He says, I think database resources in ... experiences regarding using langua-ges in a non-English-speaking Asian country like Taiwan were also examined Participation in the research was voluntary The participants were selected from a Taiwan university
Ngày tải lên: 28/07/2017, 21:41
... illiteracy was the basis for arguing that slaves were subhuman, since man's capacity for reason (as reflected in literacy) was the ultimate means of differentiating him from the beasts For slaves ... "resulted in the voluntary emancipation of the slave by his master" (279) and a speech by Sheridan about Catholic emancipation which was "a bold denunciation of slavery and a powerful vindication ... slave As Douglass later says in My Bondage and My Freedom, "slaves sing more to make themselves happy than to express their happiness" (100), indicating that the process of singing the
Ngày tải lên: 17/10/2022, 22:39
Experimental Research on the Effect of Self-monitoring Technique on Improving Writing Skill among English-major Freshmen at a University in Hanoi
... IMPROVING WRITING SKILL AMONG ENGLISH-MAJOR FRESHMEN AT A UNIVERSITY IN HANOI Trang 3DECLARATION I hereby state that I, Mac Thi Huyen, being a candidate for the degree of Master of Arts (TEFL) accept ... methods and the design of the study 1 Rationale Writing is considered a complicated and multifaceted task Good writing involves thinking that may lead the writer to express himself/herself in a ... among many researchers As a matter of fact, there exists some research on self-monitoring in teaching However, little attention has been paid to self-monitoring in writing teaching In Vietnam,
Ngày tải lên: 11/01/2017, 21:41
Experimental research on the effect of self monitoring technique on improving writing skill among english major freshmen at a university in hanoi
... diagram: grammar, syntax and organization Teachers give students writing tasks that lead them to pay attention to organization while they also work on the necessary grammar and syntax For instance, ... of writing into six types, namely: (i) The Controlled-to-Free Approach, (ii)The Free-Writing Approach, (iii) The Paragraph-Pattern Approach, (iv) The Grammar-Syntax-Organization Approach, (v) The ... follow a neat sequence of planning, organizing, writing and then revising At any point in the preparation of a text, they can loop backwards or forwards to whichever of the activities involved in
Ngày tải lên: 09/03/2020, 22:53
An investigation into the use of english collocations in writing essays by second year students at a university in hanoi
... (1999b) classification This classification includes cognitive strategies such as intralingual and interlingual transfer, as well as communication strategies like word coinage and approximation.The ... validate the data, the researcher collaborated with a fellow writing instructor from the same institution and a native English teacher from a Hanoi language center Their insights and assistance ... create sentences based on grammatical and semantic rules In contrast, the IP pertains to the use of conventional socio-lexical combinations, demonstrating that certain phrases are both grammatically
Ngày tải lên: 29/08/2021, 09:28
e use of scaffolding in teaching writing in the english 10 textbook (10 year program) at vietnam’s upper secondary schools a case study
... both advantages and disadvantages For instance, they can enhance access to information and facilitate interactive learning experiences, making education more engaging However, they may also lead ... establishment in the late 1960s All students at School A successfully pass the National University Entrance Examination, with many achieving outstanding academic records, including high awards in international ... students in the classroom.Data sources and focus of data collection and analysis are shown in the table 3.2 Data sources Focus of data collection analysis Preliminary interviews with individual teacher
Ngày tải lên: 08/09/2021, 15:39
An Investigation Into The Use Of English Collocations In Writing Essays By Second Year Students At A University In Hanoi.pdf
... those collocational errors? This study focuses on analyzing the use of lexical collocations in written materials, emphasizing qualitative data rather than numerical analysis The research aims to ... (1986) classification system The classification and encoding process are demonstrated in the accompanying table, illustrating how the data were organized for analysis. Table 4.Coding strategy ... make an unreasonable assessment that they cannot pass the exam Some students make an unreasonable assumption that they cannot pass the exam Therefore cannot afford to raise their qualifications
Ngày tải lên: 03/12/2023, 13:57
Using mind mapping strategies to enhance english vocabulary for the seventh grade students at a secondary school in bac ninh
... conceptualization, visualization, organization, and categorization A data visualization shows the relationships and associations between different data points Murley (2007) says that mind-mapping ... assert that visual representation is a method for facilitating the comprehension of complex information and insights as well as an instrument capable of translating abstract data into solid information ... center, and the peripheral ideas radiate outward from there in a logical fashion Having information neatly filed away and related in a logical approach aids recall When you think of one thing, your
Ngày tải lên: 04/11/2023, 09:30
The effect of e portfolios on writing learning outcomes of 10th graders at a mountainous high school in duc linh
... grammatical accuracy, while the teaching approach becomes increasingly test-oriented (Lan, 2017) Because of the demands of the national examinations, teachers in these areas mainly teach grammar ... precisely, writing in a foreign language is the capacity to use capitalization and punctuation, grammar, vocabulary, pronunciation, lexical objects, and their traditional representation in daily writing, ... effective writing instruction and feedback in the process writing approach 2.1.1.1 Writing accuracy Trang 25Writing accuracy is a crucial aspect of effective writing According to Silva and Matsuda (2011),
Ngày tải lên: 27/02/2024, 16:42
A double blind randomized placebo controlled clinical trial on the supplementation of probiotics in the first six months of life in asian infants at risk of allergic diseases effe
... blood Singapore Clinical Research Institute clinical research coordinators, Anushia P Lingham, Namratha N Pai, Dr Pavithra Chollate and biostatistician, Wong Hwee Bee, who inculcated in me the importance ... and an increasing problem not only in the West but also in an Asian population By comparing the data from phase I and phase III of the ISAAC surveys conducted in Singapore seven years later in ... earlier studies as well as to provide data in an Asian population Attenuated immune function in atopic infants may also include reduced capacity to respond to vaccines [9-12] and increase susceptibility
Ngày tải lên: 11/09/2015, 21:39
Báo cáo y học: "Trauma admissions to the Intensive Care Unit at a reference Hospital in Northwestern Tanzania" ppsx
... from six regions namely Mwanza, Kagera, Mara, Shinyanga, Kigoma and Tabora The hospital has a 12-bed adult and 10-bed paediatric multi-disciplinary Intensive Care Unit (ICU) which is headed by a ... motorization, civil violence, wars and criminal activities [3] In these countries, major trauma remains a major cause of hospitalization and intensive care utilization and consumes a significant amount ... Gilyoma (drgilyoma2@yahoo.com) Ramesh M Dass (dassramesh@hotmail.com) Mabula D Mchembe (mabula.mchembe067@gmail.com) Michael Matasha (mmatasha@yahoo.com) Joseph B Mabula (drjbmabula@yahoo.com) Nkinda
Ngày tải lên: 13/08/2014, 23:20
Some effective activities applied to teach writing in the pre writing stage to the 11th grade students at nguyen duc thuan high school
... in the pre-writing stage including oral group or individual brainstorming and dictation (asking questions), cubing (describing, comparing, analyzing…), interviewing and reading Apart from that, ... language writing (http://writingskill.mihanblog.com/post/tag/the+paragraph+pattern+approach) “The genre approach” is similar to the Paragraph-Pattern Approach The goal of the genre approach ... reinforce the grammar and vocabulary they are learning in class Discussing over the matter of writing’s importance in the learning of English, Mark, J.K states in one of his article named “Writing in
Ngày tải lên: 16/07/2015, 08:42
DSpace at VNU: Obstacles to Scholarly Publishing in the Social Sciences and Humanities: A Case Study of Vietnamese Scholars
... poor statistical techniques and writing skills Whereas Alzahrani [13] reported the main problem that academic staff across various disciplines in Saudi Arabia faced in publishing in Saudi and international ... experience in searching for the information that they need 3.2.3 Reading in a Foreign Language Reading in a foreign language represented the least obstacle to both local and international publication ... with finding resources/accessing databases, difficulty in reading materials written in a foreign language (FL), difficulty in writing in a foreign language (for international publication), lack
Ngày tải lên: 16/12/2017, 10:27
HOW TO MOTIVE STUDENTS AT LANG CHANH HIGH SCHOOL TO LEARN ENGLISH BY USING MUSIC IN THE LESSON UNIT 12 PART a READING ENGLISH 10 TEXTBOOK
... Trang 7Musical training helps develop language and reasoning: Students whohave early musical training will develop the areas of the brain related tolanguage and reasoning The left side of the ... Stough, 2008; Darling-Hammond & Baratz-Snowden, 2005).Organization is the foundation of any classroom and can be created andmaintained through effective classroom management strategies (Freiberg, ... implementation of innovation of teachingmethod in lang Chanh High school in general, in Foreign Language groupparticularly has initially gained encouraging results The majority of teachinglessons are
Ngày tải lên: 21/10/2019, 20:16
Applying portfolio to improve writing skills of 11th grade students at a high school in lang son province
... illustrate the idea, com-paring and contrasting, and showing data elaborat-2.2 Approaches to teaching writing Product approach to teaching writing skills appeared in the mid-1960s, ing to the final ... (2004) also says that 4 main stages are required in order to create a great writing: planning, drafting, editing and final ver-sion In the planning stage, writers think about the topic they are going ... simple as it is assumed In 2002, Richard and Renandya stated that writing is regarded as the most challenging skill compared to oth-ers in teaching and learning a language 2.1.2 Paragraph writing
Ngày tải lên: 26/08/2020, 23:07
A study on factors affecting listening comprehension of the eleventh grade students at a high school in bac ninh province
... acquiring the meaning of message by basing on the incoming language data from sounds, to words, to grammatical relationships, and ultimately to the meaning The meaning itself was derived as the last ... (2002) defined listening as a process of receiving what the speaker actually says, constructing and representing meaning, negotiating meaning with the speaker and responding, and creating meaning through ... participants, and data collection instruments consisting of questionnaire and interview, data collection procedures, and data analysis Trang 15Chapter 3: Data analysis and findings, the researcher
Ngày tải lên: 30/09/2020, 12:21
The Sector’s “Positives” at a glance 1992-2012 doc
... Technician Training in collaboration with Punjab Vocational Training Council (PVTC) Training course duration 30 days Practical training covered at Large Animal Slaughter House, Lahore. Training ... general. Baluchistan NWFP Punjab Sindh Lahore DRDF-USAID Project Office Chechavatni Zone Sarsabz Training Farm for farmer Sukheki Training Farm for Farmer Burj Attari AI Technicians Training Farm Multan AI Technician Training Farm Peer Mahal Zone Project ... Coverage Map Khanewal (Farmer trainings) Kamalia (Farmer training) Milk collection infrastructure Contd.’ Chilling set-up at a local farm at GOJRA Thank you Dairy Project – DRDF-USAID • A. I training...
Ngày tải lên: 24/03/2014, 04:20
Interactive Writing in the EFL Class.doc
... purpose and format. Besides this, they also involve the intuitive as well as the rational intellectual faculties in a recursive rather than a linear way: students are forced to examine different aspects ... conventions and constraints in the target culture: the key elements are a clearly defined content and the adequate rhetorical schemata . In all cases, the situation has to be made clear to the students, ... depending on the task and its complexity, so that along the drafting -writing- revision procedure, listening, speaking, reading and writing will overlap and intertwine, involving thinking, talking,...
Ngày tải lên: 06/09/2013, 05:10
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc
... TCTTTGACTTCTCAAACTGATCG RPE6 5a- His-Fwd NM_200751 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC RPE65c-His-Fwd NM_001113653 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTCTTGAACAC Y. Takahashi ... GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC RPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAG RPE65c-Fwd NM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC RPE65c-Rev AAGCTTCTAAGGTTTGTAGATGCCGTGGAG RPE6 5a GSP-Fwd NM_200751 TGGGGAGGACTTTTATGCTGT RPE6 5a ... expressing RPE65c was incubated with liposomes containing atRE, and the generated retinoids from the reaction were analyzed by HPLC. In the absence of a metal chelator, RPE65c cat- alyzed the production...
Ngày tải lên: 14/02/2014, 14:20
Bạn có muốn tìm thêm với từ khóa: