writing functions that return a value

Procedural Abstraction and Functions That Return a Value

Procedural Abstraction and Functions That Return a Value

... parameter names may or may not match variable names used in the main part of the program  It does not matter if formal parameter names match other variable names in the program  Remember that only ... the calculation or  expression is a variable containing the calculated value Example: return subtotal + subtotal * TAX_RATE; Copyright © 2007 Pearson Education, Inc Publishing as Pearson Addison-Wesley ... the formal parameter names  Formal parameters are like placeholders for the actual arguments used when the function is called  Formal parameter names can be any valid identifier Example: double...

Ngày tải lên: 12/09/2012, 22:48

94 542 0
Using Local Variables and Creating Functions that Return Results

Using Local Variables and Creating Functions that Return Results

... particular values (19, "Friday") to the function causes myVariable to evaluate to a value of false Because the last line of code in our function says return myVariable;, the value of myVariable ... currentDay:String):Boolean{ var myVariable:Boolean; if(currentDay != "Sunday" && availableFunds >= 20){ myVariable = true; }else{ myVariable = false; } return myVariable; } The values of two parameters—availableFunds ... second After a value has been assigned, the value of idealCircumstances can be used in the rest of the script, as our example demonstrates TIP You can use the return action to return any data types,...

Ngày tải lên: 07/11/2013, 15:15

10 329 0
STUDY, ASSESSEMENT OF BIOCLIMATIC RESOURCES IN THE NORTHEAST REGION OF VIETNAM FOR DEVELOPMENT OF a FEW AGRICULTURAL CROPS AND FOREST TREES THAT HAVE ECONOMIC VALUE

STUDY, ASSESSEMENT OF BIOCLIMATIC RESOURCES IN THE NORTHEAST REGION OF VIETNAM FOR DEVELOPMENT OF a FEW AGRICULTURAL CROPS AND FOREST TREES THAT HAVE ECONOMIC VALUE

... number of agricultural crops and forest trees with economic value in Northeast region ( Acacia hybrid -3tree, midland tea plant, star anise and black cardamom);orientation of spatial rational use ... several years, the area has always been regarded as a rich potential for developing agro- forestry and areas specializing in the growing of special crops with high economic value Agricultural and ... units that contained a limiting factor for the tea plant and classified them into unfavorable levels The graduate student evaluateed 25 -20bioclimate natural resources based on formula for calculating...

Ngày tải lên: 29/08/2014, 15:53

28 384 0
Writing in 15 Mins a Day

Writing in 15 Mins a Day

... organizational patterns (chronological, cause-and-effect, spatial, general-to-specific) Lesson 15: Additional Organizational Strategies 115 • Explanation and samples of additional organizational ... Organize and Outline 109 • • • • Explanation of importance of preplanning Explanation and sample of an informal outline Explanation and sample of a formal outline Explanation and samples of various ... faster d knowing will help you establish your point of view 18 All essays should contain a at least three paragraphs b five paragraphs c as many as the writer determines is appropriate d as many...

Ngày tải lên: 18/03/2013, 01:45

240 446 9
Convex sets and convex functions taking the infinity value

Convex sets and convex functions taking the infinity value

... is a scalar (2) Half-space : S = {x|p T x ≤ α}, where p is a nonzero vector in IRn , and α is a scalar (3) Open half-space : S = {x|p T x < α}, where p is a nonzero vector in IRn and α is a scalar ... Optimization / 108 Chapter Convex sets and convex functions taking the infinity value Examples of convex sets (5) Polyhedral cone : S = {x|Ax ≤ 0}, where A is an m × n matrix (6) Cone spanned by a ... Convex Optimization / 108 Chapter Convex sets and convex functions taking the infinity value Convex combination and convex hull of a set Definition x is said to be a convex combination of x , ...

Ngày tải lên: 23/10/2013, 15:20

22 443 1
Vocabulary list 10 - Short Words That Mean a Lot

Vocabulary list 10 - Short Words That Mean a Lot

... sham ( sham) (noun) something false or empty that is said to be genuine; one who assumes a false character; an impostor After a year of marriage, he recognized his wife as a and sadly saw that ... extreme or unsalvageable because the narrator says that there was no way to get his money back at that point The last sentence describes the narrator’s “so-called friend” as a miserable bane of his ... refer back to Words in Context The narrator begins to explain his situation by saying that he can cite, by way of an example, that he is one of the biggest dupes that ever lived We may infer that...

Ngày tải lên: 25/10/2013, 17:20

14 866 1
Tài liệu 18 Web-Marketing Concepts That Make a Difference pptx

Tài liệu 18 Web-Marketing Concepts That Make a Difference pptx

... to have an identity, a personality, an image—and there is no better way to create that identity than with a video of a real person delivering your marketing message in an entertaining, memorable ... John, Paul, George, or Ringo confused with Steve Jobs Amazing! Worry just a little less about all that small-print stuff and more on building a memorable brand that people will remember, and that ... businesses can't stand to make a definitive statement about who they are and what they Why is that? Afraid they'll lose a customer, I guess; but if people don't understand exactly what you do, and why...

Ngày tải lên: 20/12/2013, 17:15

6 471 0
Tài liệu Adviceguide Advice that makes a difference pptx

Tài liệu Adviceguide Advice that makes a difference pptx

... have the right to appeal against a decision about the amount of an overpayment You can also appeal against any penalty which HMRC have asked you to pay in connection with your tax credits claim ... circumstances, you may be able to make an appeal after that You should make your appeal to the Tax Credit Office (see under Further help for details) Problems with paying back your overpayment ... Citizens Advice, an operating name of The National Association of Citizens Advice Bureaux It is intended to provide general information only and should not be taken as a full statement of the law The...

Ngày tải lên: 15/02/2014, 13:20

4 268 0
Tài liệu Báo cáo Y học: A novel meta-cleavage dioxygenase that cleaves a carboxyl-groupsubstituted 2-aminophenol Purification and characterization of 4-amino-3-hydroxybenzoate 2,3-dioxygenase from Bordetella sp. strain 10d doc

Tài liệu Báo cáo Y học: A novel meta-cleavage dioxygenase that cleaves a carboxyl-groupsubstituted 2-aminophenol Purification and characterization of 4-amino-3-hydroxybenzoate 2,3-dioxygenase from Bordetella sp. strain 10d doc

... Morphological and phenotypic characterization Physiological and biochemical parameters, such as Gram reaction, flagella type, catalase activity, oxidase activity and OF test, were determined using classical ... sucrose Alkali was produced from L-asparagine, citrate, galactarate and tartrate The nucleotide sequence (1457 bp) of the 16S rRNA gene of strain 10d was 96.7% identical with that of Bordetella avium ... REFERENCES Fujisawa, H & Hayaishi, O (1968) Protocatechuate 3,4-dioxygenase I Crystallization and characterization J Biol Chem 243, 2673–2681 Murakami, S., Nakanishi, Y., Kodama, N., Takenaka, S., Shinke,...

Ngày tải lên: 21/02/2014, 01:21

7 492 0
Peptidylarginine deiminase (PAD) is a mouse cortical granule protein that plays a role in preimplantation embryonic development docx

Peptidylarginine deiminase (PAD) is a mouse cortical granule protein that plays a role in preimplantation embryonic development docx

... the ABL2 antibody and that PAD (ABL2 antigen, p75) is present in the cortical granules of mouse oocytes Localization of PAD (p75) after artificial activation and fertilization To demonstrate that ... Laboratories (Burlingame, CA) SYTOX orange nucleic acid stain and Alexa-488 conjugated to goat anti-rabbit IgG were obtained from Molecular Probes (Eugene, OR) PAD V (N) antibody was made against ... (SignalP V2.0 and TargetP V1.0) [35-37] were used to determine that a putative signal peptide and a cleavage site exist in ePAD and AAH53724 (an egg and embryo abundant peptidylarginine deiminase),...

Ngày tải lên: 05/03/2014, 17:20

22 522 0
Adviceguide Advice that makes a difference pptx

Adviceguide Advice that makes a difference pptx

... signing any document that states that you have examined the car and found it satisfactory in all respects Guarantee or extended warranty If the car was sold with a guarantee or an extended warranty, ... going back to the dealer  contact the dealer and the finance company (if applicable) as soon as you discover the fault Take the car back, and ask to speak to a manager or the owner Alternatively, ... you may have additional rights The guarantee or warranty cannot take away your statutory rights You should check the small print on your warranty Many have exclusions such as wear and tear If...

Ngày tải lên: 07/03/2014, 11:20

7 369 0
Báo cáo " Student writing process, perceptions, problems, and strategies in writing academic essays in a second language: A case study " docx

Báo cáo " Student writing process, perceptions, problems, and strategies in writing academic essays in a second language: A case study " docx

... it and explain what it means So I cannot have direct translation, it’s very hard So I put the Japanese, how to read it in alphabet and explain what it means” 1 1 This extract showed that to deal ... writing and I don’t know that I’m writing And at the end oh that s interesting that s the issue that I write I want to write about So at last I found out what I want to write and I changedt” It can ... choose that particular city as the capital city because it is ideal city, ideal capital and I want to find out what is the reason behind” “Actually when I read the topics I just didn’t know what...

Ngày tải lên: 22/03/2014, 10:20

14 589 0
Báo cáo khoa học: A designed curved DNA segment that is a remarkable activator of eukaryotic transcription potx

Báo cáo khoa học: A designed curved DNA segment that is a remarkable activator of eukaryotic transcription potx

... TTTTTCAGTCAGTTTTTCAGTCAGTTTTTCAC-3¢ and 5¢-GTGAAAAACTGACTGAAAAACTGACTGAAAAAC TGACTGAAAAACTGA-3¢ were annealed to generate a dsDNA fragment, which we named T4-R¢¢ T4-R¢¢ was inserted into the PmaCI site ... obtained by annealing oligonucleotides 5¢-GTTTTTCATG TTTTTCATGTTTTTCATGTTTTTCAC-3¢ and 5¢-GTG AAAAACATGAAAAACATGAAAAACATGAAAAAC-3¢, Synthetic oligonucleotides 5¢-TCAGTTTTTCAGTCAG TTTTTCAGTCAGTTTTTCAGTCAGTTTTTCAC-3¢ ... Designed DNA as an activator of transcription N Sumida et al transient transfection assay system, at a specific rotational phase and distance between T4 and the promoter [12] We concluded that T4 formed...

Ngày tải lên: 23/03/2014, 10:20

12 399 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...

Ngày tải lên: 23/03/2014, 13:20

11 680 0
Báo cáo khoa học: Nuclear aggregates of polyamines are supramolecular structures that play a crucial role in genomic DNA protection and conformation potx

Báo cáo khoa học: Nuclear aggregates of polyamines are supramolecular structures that play a crucial role in genomic DNA protection and conformation potx

... cycle, particularly the S-phase [21] Temperature is an additional factor capable of affecting DNA conformation It has been reported that (a) an increase of a few °C is associated with a reduction ... Saminathan M, Thomas T, Shirahata A, Pillai KS & Thomas TJ (2002) Polyamine structural effects on the induction and stabilization of liquid crystalline DNA, potential applications to DNA packaging, ... Luccia A (2002) Polyamines interact with DNA as molecular aggregates Eur J Biochem 269, 4317–4325 30 Saminathan M, Antony T, Shirahata A, Sigal LH, Thomas T & Thomas TJ (1999) Ionic and structural...

Ngày tải lên: 23/03/2014, 15:20

11 383 0
MẪU THÔNG TIN ĐĂNG KÝ THẤT NGHIỆP A. THÔNG TIN VỀ NGƯỜI LAO ĐỘNG ĐĂNG KÝ THẤT NGHIỆP docx

MẪU THÔNG TIN ĐĂNG KÝ THẤT NGHIỆP A. THÔNG TIN VỀ NGƯỜI LAO ĐỘNG ĐĂNG KÝ THẤT NGHIỆP docx

... ch a bệnh (kể trường hợp cai nghiện Trung tâm cai nghiện) chấp hành hình phạt tù không hưởng án treo theo mẫu số 21 ban hành kèm theo Thông tư số /201…/TT-BLĐTBXH ngày tháng………năm 201……… Bộ Lao ... quy định thời gian hưởng trợ cấp thất nghiệp Thông báo cho Trung tâm Giới thiệu việc làm nơi hưởng trợ cấp thất nghiệp có việc làm, nhận định hưởng lương hưu tháng, thực ngh a vụ quân sự, nước ... 1 Đăng ký thất nghiệp Trung tâm Giới thiệu việc làm thuộc Sở Lao động - Thương binh Xã hội việc chấm dứt hợp đồng lao động hợp đồng làm việc; nộp hồ sơ hưởng bảo hiểm thất nghiệp theo...

Ngày tải lên: 25/03/2014, 07:21

2 605 0
agile analytics a value-driven approach to business intelligence and data warehousing

agile analytics a value-driven approach to business intelligence and data warehousing

... Analysis Visualizaion Reports ETL OLAP Flat Files EII External Data Scorecards & Dashboards Data Marts Metadata Management Figure 1.1 Classical data warehouse architecture Data Mining 14 CHAPTER INTRODUCING ... reality the data model was a replication of parts of one of the legacy operational databases This replicated database did not include any data scrubbing and was wrapped in a significant amount of ... operational data store or an enterprise information integration (EII) repository that acts as a system of record for all relevant operational data The integration database is typically based on a...

Ngày tải lên: 29/05/2014, 13:56

366 1,1K 1
w