... 72 19 and is presented in a socio-technical model called The access rainbow’75 This sociotechnical architecture expands the concept of access beyond mere physical connectivity to embrace internet-based ... practices are: accountability, accessibility and participation These themes recur in the public discussion of time; in order to restructure services and citizenship in line with the aim to achieve ... democracy and public influence and how these are enacted in the development of public services, places me within the research field which is concerned with the development of eGovernment, which...
Ngày tải lên: 04/11/2013, 20:15
... TestKPolicyLibrary.dll is written in Visual Basic 6.0 The class that performs the calculations is named cPolicyActions The CalculateRenewal function of cPolicyActions accepts a policy identification ... Click the Project menu and select Add Reference In the Add Reference window, click the COM tab Scroll down the list of components and select the one you want to reference, such as Microsoft CDO ... by calling a stored procedure You set the CommandType property of the SqlCommand object to CommandType.StoredProcedure You set the CommandText property of the object to procProductList Your code...
Ngày tải lên: 24/01/2014, 09:20
Báo cáo khoa học: Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes pdf
... PCR using speci c primer sets, namely, Hi_pDEDF (5¢-ACGCGTCGACGTCGGA AATGGAGGAGTGACGG-3¢), Hi_pDEDR (5¢-CG GGATCCCGTTAATAAAAGCCTGTTGCTGGTT-3¢), Hi_Nterm F (5¢-ACGCGTCGACGTCATGACTGCTGCT CTGGCCGT-3¢), ... CATGTATTT (P 4C) , CATGGCTTT (P 5C) , CATCTCTTT (P 6C) , CAGGTCTTT (P 7C) , CGTGTCTTT (P 8C) , and TATGTCTTT (P 9C) , were also synthesized chemically The underlined sequences are changes from the original ... sequence of the caspase-1 gene was introduced using speci c primers (forward, 5¢-CCTGATGCAGGCTA CAGTTCT-3¢; and reverse, 5¢-GCATATGCATGTATT TATTTTTCTTC-3¢) and standard procedures The speci c mutation...
Ngày tải lên: 07/03/2014, 10:20
Báo cáo khoa học: The 3¢-UTR of the mRNA coding for the major protein kinase C substrate MARCKS contains a novel CU-rich element interacting with the mRNA stabilizing factors HuD and HuR ppt
... synthetic oligonucleotides (sense: 5¢-CCC CGG GCC CGA ATT CCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT TTT TTT TTC TCG AGC CCC-3¢; antisense: 5¢-GGG GCT CGA GAA AAA AAA AAA GAA AGA AAG ... C and the supernatants were removed and stored at )20 C For fractionation into nuclear and cytosolic extracts the cells were rinsed once with ice-cold NaCl/Pi, scraped off the dish in mL NaCl/Pi ... hypodermic needle and the extract was centrifuged for with 14 000 r.p.m at C (Eppendorf centrifuge 5417R) The supernatant containing the cytosolic fraction was collected and kept on ice The nuclear...
Ngày tải lên: 08/03/2014, 08:20
C++ CLI The Visual C++ Language NET
... You could compile the class unchanged in C+ +/CLI with the following command line: cl /clr atom.cpp and it would be a valid C+ +/CLI program That’s because C+ +/CLI is a superset of C+ +, so any C+ + ... to machine code being executed by the processor The real benefits of the managed world come not with recompiling your existing classic C+ + code, but by using the C+ +/CLI constructs that constitute ... adding to the semantics of an existing C+ + construct, is liable to interfere with C+ +0x evolution by accidentally constraining it For another example, consider C+ +/CLI’s decision to add the gcnew...
Ngày tải lên: 20/08/2012, 12:00
The Visual Studio 2005 IDE
... you create different clients using the IDE, the menu will dynamically change according to the client selection Like menus, toolbars have a dynamic nature—they also change according to the choice ... customizing the IDE, working with addins, and accessing macros The Window menu gives you the facility to manage the various windows in the IDE The Community and Help menus are there to help you with ... s THE VISUAL STUDIO 2005 IDE The View menu has the choices to manage the presentation of various components of the IDE For example, you can hide or unhide a window You can also have the choice...
Ngày tải lên: 05/10/2013, 08:48
Coming to terms with the past in postwar literature and philosophy
... who embrace only the aesthetic side of the modernist project They counter the instrumental rationality of science by recourse to spontaneity, the archaic, the anarchic, the emotional and the irrational ... three-volume Asthetik des Widerstands (–; Aesthetics of resistance), a novel about working- class resistance, participation in the Spanish civil war and the Second World War, and the place of art ... start with testimony on the ramp and the physical Robert C Holub structure of the camps, proceed through accounts of various persons, procedures, and instruments of death and end with the crematorium...
Ngày tải lên: 01/11/2013, 09:20
Tài liệu Module 7: Working with the Microsoft Outlook 2000 Object Model pptx
... use the FindControl method on the CommandBars collection to find and execute the Choose Form command Sub cmdChooseForm_Click Application.ActiveExplorer.CommandBars.FindControl(,1910).Execute ... time The only object you can create in the Outlook object model is the Application object This object resides at the top of the object model Using the Application Object from Within a Form From within ... send the item successfully The following code checks to see whether a user added a subject and a category to the message before the item is sent The code is written in Visual Basic for Applications...
Ngày tải lên: 10/12/2013, 16:15
Tài liệu LINQ for Visual C# 2008 pdf
... have to store the SQL in a Command object, associate the Command with a Connection object and execute it on that Connection object, then use a DataReader or other object to retrieve the result set ... example, the following code is necessary to retrieve the single row accessed in the pseudocode presented earlier // Specify the connection to the DB SqlConnection c = new SqlConnection(…); // Open the ... DataAdapter contains four Command objects, one for each database operation—SELECT, DELETE, INSERT, and UPDATE and we have fill the correct one with the appropriate SQL code .NET can also handle XML and...
Ngày tải lên: 10/12/2013, 23:15
Tài liệu Chapter 10: Working With the BEx Browser pptx
... Chapter 10: Working With the BEx Browser Creating and Populating a Cluster In the Channels section, choose the SAP Demo Channel Right-click the SD DemoCube Workbook in the SAP Demo Channel on the right ... in the BEx Browser A new Internet workbook is now in the Favorites channel Right-click the Welcome to mySAP.com Internet workbook and choose Execute to access the mySAP.com Web site Right-click ... From the BEx Browser you can preview workbook queries before executing them Choose the SAP Demo Channel Choose the SD DemoCube Workbook 3 Right-click and choose Preview From the popup window, choose...
Ngày tải lên: 11/12/2013, 14:15
Tài liệu Working with the ADO Recordset Object pdf
... handy for checking out data Editing and Updating Records You can use several methods to perform editing and updating of records in code Unlike the last section in which you could open the recordset ... one from the Orders table, and one from a file created from the Orders table called OrdersForDate.rst The code, shown in Listing A.6, opens the Orders table for a specific date and uses the GetString ... method to stash the contents to the results text box The routine then saves that recordset using the Save method, and passes the adPersistADTG format enumerator You could save the recordset as XML...
Ngày tải lên: 24/12/2013, 06:17
Tài liệu Module 18: Case Study Working with the Foodmart Database ppt
... server, click Restore Database, click the Look in list, click the file C: \Moc\2074A\Labfiles\L18\Answers\Module 18A.CAB, click Open, click the Restore button, and then click Close Expand the Module ... click Open, click the Restore button, and then click Close Expand the Module 1 8C database, double-click the Data Sources folder, right-click the FoodMart 2000 data source, and then click Edit Verify ... click Open, click the Restore button, and then click Close Expand the Module 18B database, double-click the Data Sources folder, right-click the FoodMart 2000 data source, and then click Edit Verify...
Ngày tải lên: 24/01/2014, 19:20
Tài liệu Beginning Programming with the Visual Studio 2005 Environment pdf
... bar at the top of the screen provides access to the features you'll use in the programming environment You can use the keyboard or the mouse to access the menus and commands exactly as you can in ... exist, Visual Studio 2005 creates it for you In the Name field, type TextHello Ensure that the Create Directory for Solution check box is checked and then click OK The new project opens The menu ... displays the contents of source files In a multi-file project, each source file has its own tab labeled with the name of the source file You can click the tab once to bring the named source file to the...
Ngày tải lên: 26/01/2014, 13:20
Báo cáo khoa học: Interaction of the general transcription factor TnrA with the PII-like protein GlnK and glutamine synthetase in Bacillus subtilis potx
... and 35 amino acids from the C- terminus, TnrA20 (5¢-TCC AGC GGA TCC TTC CGC ACT TAC GGA TC-3¢) and TnrA35 (5¢-TTC TTT GGA TCC CAT ATC CTT TTA AAT CTC TGC-3¢) oligonucleotides were used, respectively, ... amino acids from C- terminus was obtained with primers TnrAN (5¢-GCT CGA GGA TCC GAT GAC CAC AGA AGA TCA TTC TT-3¢) and TnrA6 (5¢-TTA ACG GGA TCC GTA CCG TTA GTG AGC ATT AAG3¢) The PCR products were ... of the 1782 Fig Influence of various effector molecules on the interaction of GlnK with the His6-TnrA surface GlnK was preincubated with effector molecules at the concentrations indicated, and...
Ngày tải lên: 06/03/2014, 00:21
C++ AMP: Accelerated Massive Parallelism with Microsoft Visual C++ potx
... bill Then there is the matter of the memory accessed by these cores Cache size can outweigh clock speed when it comes to compute speed, so the CPU has a large cache to make sure that there is ... parallelism and supports multiple accelerators Chapter 11 Graphics Interop Using C+ + AMP in conjunction with DirectX Chapter 12 Tips, Tricks, and Best Practices Instructions on how to deal with less common ... in the calculations without the calculations taking longer This generally means that the results will be more accurate or that end users of the application can have more confidence in their decisions...
Ngày tải lên: 06/03/2014, 20:21
Báo cáo khoa học: UXT interacts with the transcriptional repressor protein EVI1 and suppresses cell transformation ppt
... CCAGATGTCACATGACAGTGGAAAGCACTA; HME2 CCGGGTTGGCATGACTCATATTAACCATGG; UXT 5¢-GACAAGGTATATGAGCAGCTG; UXT 3¢-TTG ATATTCATGGAGTCCTTG; Gapdh5 ACCACAGTCCA TGCCATCAC; Gapdh3 TCCACCACCCTGTTGCTGTA PCR products were resolved ... inserting EcoRI ⁄ NotI-digested PCR fragments generated using the following 5¢-oligonucleotide (E634) AGCTGAAATTCCCCTTCTTCATGGACCCCATT and 3¢-oligonucleotides (N724) AATTGCGGCCGCTCAGTA GCGCTCTTTCCCCTT ... pGBT9RpD706–707 was created by site-directed mutagenesis (QuickChange XL system, Stratagene, La Jolla, CA) of pGBT9Rp [14] with oligonucleotides 5¢-CCCTCCATGTT CAGCTTCCCTCCCAACACCCTGCC and 3¢-GGCAG GGTGTTGGGAGGGAAGCTGAACATGGAGGG...
Ngày tải lên: 16/03/2014, 11:20
Ivor horton beginning visual c++ 2008
... Types C+ +/CLI Output to the Command Line C+ +/CLI Specific — Formatting the Output C+ +/CLI Input from the Keyboard Using safe_cast C+ +/CLI Enumerations Summary Exercises Chapter 3: Decisions and ... Improving the View The MFC Collection Classes 909 909 Types of Collection The Type-Safe Collection Classes Collections of Objects The Typed Pointer Collections 910 911 911 920 Using the CList Template ... CList Template Class 923 Drawing a Curve Defining the CCurve Class Implementing the CCurve Class Exercising the CCurve Class 924 925 927 929 Creating the Sketch Document 929 Using a CTypedPtrList...
Ngày tải lên: 19/03/2014, 14:09
Hướng dẫn từng bước tự học và thực hành Visual C++ 2008 pdf
Ngày tải lên: 23/03/2014, 05:25
Báo cáo khoa học: The potyviral virus genome-linked protein VPg forms a ternary complex with the eukaryotic initiation factors eIF4E and eIF4G and reduces eIF4E affinity for a mRNA cap analogue ppt
... ½Etot C Kc þ C ð4Þ The experimental procedures used in this work not allow direct determination of bound and free ligand concentrations without access to [Ec] and [C] eIF4E fluorescence decreases ... us consider the simple bimolecular association between eIF4E and one ligand: E C ! EC Kc According to this scheme, the saturation function of eIF4E with its ligand follows an hyperbola: ½EC ... another 45 The lysate was sonicated in ice for (1 s cycles) The crude extract was centrifuged at 20 000 g, C for 30 The supernatant was recovered and centrifuged at 100 000 g, C for 45 The clarified...
Ngày tải lên: 23/03/2014, 10:21