working with a single protein sequence

Báo cáo Y học: LRP130, a protein containing nine pentatricopeptide repeat motifs, interacts with a single-stranded cytosine-rich sequence of mouse hypervariable minisatellite Pc-1 docx

Báo cáo Y học: LRP130, a protein containing nine pentatricopeptide repeat motifs, interacts with a single-stranded cytosine-rich sequence of mouse hypervariable minisatellite Pc-1 docx

... transcriptase (Takara Biomedicals) at 45 °C for 60 Partial cDNA fragments for the mLRP130 were amplified with a set of degenerated primers, 5¢-TAT/CTTT/CCAT/CCAA/GT/ CTNC/AGNGA-3¢ and 5¢-GCA/GTCNGCNCG/TT/CT ... respectively a- tubulin was used as a marker for cytoplasmic extraction The same membrane was used for immunoblot analysis with aF-N, aF-C and anti- (a- tubulin) Ig Lanes and 4, whole cell lysate; lanes and ... accordance with the embryonal develop- Nuclear and cytoplasmic fractions were prepared from NIH3T3 cells and analyzed by immunoblot analysis As shown in Fig 3A, a major band with a molecular mass...

Ngày tải lên: 31/03/2014, 23:20

7 307 0
Báo cáo khoa học: Fast set-up of doxycycline-inducible protein expression in human cell lines with a single plasmid based on Epstein– Barr virus replication and the simple tetracycline repressor ppt

Báo cáo khoa học: Fast set-up of doxycycline-inducible protein expression in human cell lines with a single plasmid based on Epstein– Barr virus replication and the simple tetracycline repressor ppt

... successively analyzed with a transporter probe and with a GAPDH probe (cf Fig 2) Relative background transcription was calculated from the ratios of signals for transporter mRNA and GAPDH mRNA With OCT1, ... OCT2, and CAT4 both vectors were analyzed alongside on a single blot OCT, organic cation transporter; CAT, cationic amino acid transporter Transporter cDNA (human) Transporter mRNA ⁄ GAPDH mRNA Vector ... graded transactivation potential Nucleic Acids Res 25, 2723–2729 13 Akagi K, Kanai M, Saya H, Kozu T & Berns A (2001) A novel tetracycline-dependent transactivator with E2F4 transcriptional activation...

Ngày tải lên: 23/03/2014, 09:21

8 331 0
Working with a Study Buddy

Working with a Study Buddy

... talk in everyday conversation Have an instant buddy session with a classmate (Maybe you’re doing this already!) After class, begin a reflective discussion Ask somebody that you’re comfortable with ... film, she could have asked, “What was it about? What was useful about it?” and so on Then Jack would have had to think carefully and explain it to her in detail 132 WORKING WITH A STUDY BUDDY GROUND ... separately 128 WORKING WITH A STUDY BUDDY GETTING STARTED You may not be aware of it, but you already know how to work with a study buddy Whenever you discuss a film, newspaper or magazine article,...

Ngày tải lên: 02/11/2013, 18:20

10 427 0
Báo cáo khoa học: Dynamin-like protein-dependent formation of Woronin bodies in Saccharomyces cerevisiae upon heterologous expression of a single protein pdf

Báo cáo khoa học: Dynamin-like protein-dependent formation of Woronin bodies in Saccharomyces cerevisiae upon heterologous expression of a single protein pdf

... USA) Plasmids and cloning procedures For heterologous expression in yeast, N crassa HEX1 was amplified from a N crassa cDNA library using PCR with primer pair RE951 (AAGAATTCATGGGCTACTACGA CGAC) ... secondary antibodies applied were obtained from Molecular Probes (Alexa Fluor 594 goat anti-rabbit IgG and Alexa Fluor 488 goat anti-mouse IgG) Acknowledgements We thank F Nargang for the N crassa ... against GFP combined with rabbit anti-HEX1 serum The secondary antibodies used were Alexa Fluor 488-labeled antimouse IgG and Alexa Fluor 594-labeled anti-rabbit IgG Bar = lm B C D membrane and...

Ngày tải lên: 23/03/2014, 07:20

10 351 0
Báo cáo hóa học: " The product of the Herpes simplex virus 1 UL7 gene interacts with a mitochondrial protein, adenine nucleotide translocator 2" pot

Báo cáo hóa học: " The product of the Herpes simplex virus 1 UL7 gene interacts with a mitochondrial protein, adenine nucleotide translocator 2" pot

... 5'-AGGGCGGGGGCATCGGGCACCGGGATGGCCGCCGCGACGGCCGACGATG AGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCGACAGCAAGCGAACCGGAAT-3' GAAGTTCCTATACTTTCTAGAGAATAGGAACTTCCGGAAATGTTGAATACTCA TACTCTTCCTTTTTC-3' The linear PCR-generated ... (5'gatttcgcgcaggtgatgag-3') for UL8; and 18S rRNA-f (5'-actcaacacgggaaacctca-3') and 18S rRNA-r (5'-aaccagacaaatcgctccac-3') for 18S rRNA Reactions were performed using SYBER Premix Ex Taq II (Takara) with ... Real-time PCR amplifications were performed with primers UL6-f (5'-aaattctgtgtcaccgcaacaac-3') and UL6-r (5'-gcccgaagcactgactcaa-3') for UL6; UL8-f (5'-cttgctggacgcagagcacta-3') and UL8-r (5'gatttcgcgcaggtgatgag-3')...

Ngày tải lên: 20/06/2014, 01:20

13 463 0
Báo cáo toán học: "The maximum number of perfect matchings in graphs with a given degree sequence" docx

Báo cáo toán học: "The maximum number of perfect matchings in graphs with a given degree sequence" docx

... (2.1), and no ri is zero Therefore, after permuting the rows and columns of the adjacency matrix of G it is a block diagonal matrix in which every block is an all-1 square matrix, and as our graph ... states n perm A ≤ (ri !) ri , (2.1) i=1 where equality holds (if no ri is zero) iff up to permutation of rows and columns A is a block diagonal matrix in which each block is a square all-1 matrix ... of H with more than vertices, (as there are ways to orient each such cycle as a directed cycle and get a contribution to the permanent) Thus the square of the number of perfect matchings is at...

Ngày tải lên: 07/08/2014, 15:22

2 369 0
Working with a study budy 2 pps

Working with a study budy 2 pps

... had a hard day I wish you could take the day off tomorrow; you’ll look into arranging for that soon, if you can In the meantime, is there some way you can treat yourself, maybe take a short walk ... a different situation.’ I it every time!” Tim has a problem coming up with the right names, and Tameka has a problem when answer choices are very similar What Tim needs to is learn to associate ... for a specific reason: to learn! 143 CHAPTER In this chapter, you’ll be using what you’ve learned about reading closely, keeping calm, and using your learning styles to deal with tests that are...

Ngày tải lên: 07/08/2014, 22:20

6 333 0
Working with a study budy 3 pdf

Working with a study budy 3 pdf

... take the real test TESTING WITH A PARTNER If you’re studying with a partner, make up a test for each other Be sure to make up answer sheets on separate paper and have proof for every correct answer ... using images: Draw any images that you associate with the information on each card Use your imagination! • If you learn best by seeing: Tape up your index cards in places you can’t miss, for example, ... create at first Follow this formula for choices: make up four possible answers for each question a correct answer, a nearly correct answer, an answer loosely associated with the right answer, and...

Ngày tải lên: 07/08/2014, 22:20

6 216 0
Working with a study budy 4 pps

Working with a study budy 4 pps

... important in a particular sentence Create an association with that word, something that will help the word stick with you Practicing in everyday situations will make coming up with associations easier; ... each have an answer sheet that includes page numbers that indicate where the answers can be found in your class material TIME MANAGEMENT You want to make the most of the time allotted for taking ... best with order as a sequential learner to become a sequential writer GETTING READY A good way to prepare yourself for an essay question is to write a mock test ahead of time By acting (creating...

Ngày tải lên: 07/08/2014, 22:20

6 308 0
Working with a study budy 5 pot

Working with a study budy 5 pot

... at all a newspaper or magazine article, a short story, a book Maybe you just finished reading it Maybe you read it last year Write in your notebook what it was and why you liked it Now think about ... why you had that feeling COMING UP WITH THE ANSWER GETTING THE IDEA An advantage of an essay test is that extended writing actually gets you to think more clearly than just writing a one- or ... YOUR LEARNING STYLE TO CLARIFY YOUR ANSWER The way you plan what you’re going to say depends on what works best for you For any learning style, you want to have a clear idea of the whole answer—your...

Ngày tải lên: 07/08/2014, 22:20

6 167 0
Báo cáo y học: "Identification of a SmD3 epitope with a single symmetrical dimethylation of an arginine residue as a specific target of a subpopulation of anti-Sm antibodies" ppsx

Báo cáo y học: "Identification of a SmD3 epitope with a single symmetrical dimethylation of an arginine residue as a specific target of a subpopulation of anti-Sm antibodies" ppsx

... with an offset of two amino acids (13 amino acid overlap) Each arginine-containing peptide was synthesized as three variants, one with natural arginine, one with sDMA and one with asymmetrical ... containing dimethylated arginine residues for epitopes assay Assay performance characteristics of the anti-SmD3 peptide (SMP) assay (a) Intra-assay and interassay variability, (b) linearity, and (c) receiver ... 41.3 and 13.9 units, respectively R24 Correlation with racial and clinical parameters When correlating autoantibody specificities with race, there was a statistically significant association of autoantibodies...

Ngày tải lên: 09/08/2014, 06:22

11 595 0
Báo cáo y học: "Phase delaying the human circadian clock with a single light pulse and moderate delay of the sleep/dark episode: no influence of iris color" potx

Báo cáo y học: "Phase delaying the human circadian clock with a single light pulse and moderate delay of the sleep/dark episode: no influence of iris color" potx

... African Americans had larger phase advances than Caucasians Because we found that African Americans had a shorter tau than Caucasians, which would augment phase advances relative to the Caucasians ... manuscript we also re-analyzed data from our previous phase-advancing study with daily light pulses [42] that included both light and dark-eyed Caucasians as well as dark-eyed African Americans, and thus ... circadian adaptation J Biol Rhythms 1997, 12:5-15 Yang CM, Spielman AJ, D'Ambrosio P, Serizawa S, Nunes J, Birnbaum J: A single dose of melatonin prevents the phase delay associated with a delayed...

Ngày tải lên: 10/08/2014, 09:20

7 316 0
báo cáo khoa học: " Primary care provider preferences for working with a collaborative support team" potx

báo cáo khoa học: " Primary care provider preferences for working with a collaborative support team" potx

... implementation phase of care management was positively associated with subsequent attitudes and participation in care management activities [12,21] However, this study also indicated that active participation ... clinician attitudes and satisfaction regarding disease management and collaborative care approaches, they not specifically report on how PCPs prefer to communicate or interact with members of collaborative ... Disease Management Within an Academic Health System Dis Manag Clin Outcomes 2000, 7:21-37 Bero LA, Grilli R, Grimshaw JM, Harvey E, Oxman AD, Thomson MA: Closing the gap between research and practice:...

Ngày tải lên: 11/08/2014, 05:22

6 273 0
application of real coded genetic algorithm for ship hull surface fitting with a single non-uniform b-spline surface

application of real coded genetic algorithm for ship hull surface fitting with a single non-uniform b-spline surface

... Chiyokura and Kimura (1984) As a result, boundary interpolating patch has several drawbacks for modification a large number of small surfaces that are bonded together to create a larger surface 2.2 ... rectangular patches and triangular patches A flexible CAD system should perform a good quality of shape and an interactive manipulation The B-spline vertex point modification actually works with ... tolerance Fitting process is also expected that the surface is obtained in a reasonable way with high quality of shape Many previous researches approached to automated B-spline surface modeling mathematically...

Ngày tải lên: 13/11/2014, 08:18

113 521 1
Narrowband photon pairs from a cold atomic vapour for interfacing with a single atom

Narrowband photon pairs from a cold atomic vapour for interfacing with a single atom

... work with him and Sandako while doing HOM measurements Gleb, for always teasing me I still miss that Dzmitry, for his great ideas One can approach him anytime and any day and he is always ready ... available in the market 87 Rb is a naturally occurring isotope of Rubidium with atomic number 37 It has a natural abundance of 28%, mass of 86.9 amu with a nuclear spin I of 3/2 Rubidium has another ... with relevant transitions used for cooling the atoms is indicated (Right) Magneto-Optical Trap set up: a glass cuvette attached to a vacuum chamber, quadruple coils and circular polarized beams...

Ngày tải lên: 09/09/2015, 08:15

124 301 0
A simple introduction to working with LVM

A simple introduction to working with LVM

... hda1, hda2, and hda3 are all physical volumes We'll initialize hda3 as a physical volume: root@lappy:~# pvcreate /dev/hda3 If you wanted to combine several disks, or partitions you could the same ... that we have a volume group (called skx-vol) we can actually start using it Working with logical volumes What we really want to is create logical volumes which we can mount and actually use In ... that the test partition is full and we want to make it bigger First of all we can look at how big it is at the moment with lvdisplay: root@lappy:~# lvdisplay - Logical volume LV Name VG Name...

Ngày tải lên: 18/09/2012, 10:12

7 676 0

Bạn có muốn tìm thêm với từ khóa:

w