within a worksheet and between workbooks

A panel project on purchasing power parity-mean reversion within and between countries

A panel project on purchasing power parity-mean reversion within and between countries

... rates and CPIs; non-parametric smoothers also shown) *Our STATA data set and programs are available upon receipt of two formatted highdensity 3.5 in diskettes and a self-addressed stamped mailer ... ciently small relative to the total variation in the data The reason is that the bias vanishes as data variation rises; see Davutyan and Pippenger (1985) As the descriptive statistics in Table show, ... Znternational Financial Statistics We use the CPI (IFS line 64) as the measure of prices, and the price of an American dollar (IFS line rf) as the exchange rate Both of these variables are standard

Ngày tải lên: 24/11/2016, 18:09

16 250 0
Distribution of Ki-67 values within HER2 & ER/PgR expression variants of ductal breast cancers as a potential link between IHC features and breast cancer biology

Distribution of Ki-67 values within HER2 & ER/PgR expression variants of ductal breast cancers as a potential link between IHC features and breast cancer biology

... two breast cancer types [4] It was also reported that accurate classification of breast cancer patients as Luminal A, or as Luminal B is important for determining effective adjuvant treatment ... highest value were discarded and the arithmetic mean of the remaining two values was used Kurbel et al BMC Cancer (2017) 17:231 Page of 13 Breast cancer types based on IHC features Statistical analysis ... al BMC Cancer (2017) 17:231 Background Despite many advances in cancer therapy, a majority of all drugs are of variable effectiveness in patients with a certain cancer type In rare occasions (i.e

Ngày tải lên: 19/09/2020, 21:37

13 13 0
Báo cáo khoa học: "Organic matter distribution and nutrient fluxes within a sweet chestnut (Castanea sativa Mill.) stand of the Sierra de Gata, Spain" pps

Báo cáo khoa học: "Organic matter distribution and nutrient fluxes within a sweet chestnut (Castanea sativa Mill.) stand of the Sierra de Gata, Spain" pps

... mean basal area is 28.58 m 2 ha –1 , and the L.A.I (leaf area index): 3.7 m 2 m –2 (table I). Table I. General characteristics of the studied chestnut stand. Parameters (Chestnut stand) San Martín ... Original article Organic matter distribution and nutrient fluxes within a sweet chestnut (Castanea sativa Mill.) stand of the Sierra de Gata, Spain Ignacio Santa Regina * IRNA-CSIC, Cordel ... litter-fall val- ues to determine the amount of nutrients in the biomass or litter on a surface area basis. 2.4. Statistical analysis Statistical analysis was performed by a one-way analysis of variance

Ngày tải lên: 08/08/2014, 14:22

10 350 0
Báo cáo khoa học: "Temporal and spatial variation in transpiration of Norway spruce stands within a forested catchment of the Fichtelgebirge, Germany" pdf

Báo cáo khoa học: "Temporal and spatial variation in transpiration of Norway spruce stands within a forested catchment of the Fichtelgebirge, Germany" pdf

... stand leaf area indices, 134 mm at the 40-year stand Weiden Brunnen and1 71 mm at the 40year NE stand Schanze T and, thus, max max D are consistently lower at Schanze as compared... ratio ... decreases in area index of the stands remain high and the needle area which must be supported by a particular sapwood area increases A similar effect of stand age on the leaf area/sapwood ... maintain a similar stand water balance as discussed by Miller et al [47] Seasonal canopy transpiration, even after adjusting for LAI and despite Transpiration of the oldest stand is

Ngày tải lên: 09/08/2014, 04:20

21 240 0
Báo cáo y học: "Direct electrochemical analyses of human cytochromes b5 with a mutated heme pocket showed a good correlation between their midpoint and half wave potentials" doc

Báo cáo y học: "Direct electrochemical analyses of human cytochromes b5 with a mutated heme pocket showed a good correlation between their midpoint and half wave potentials" doc

... T AACGTCACCTCCA GCTTG-3’) and A59V-F (5’-CAA GCTGGAGGTGAC GTTACTGAGAACTTTGAGG-3’); for A59 S, A59S-R (5’ -CAAGCTGGAGGTGAC TC- TACTGAGAACTTTGAGG-3’ )andA59S-F(5’ -CA AGCTGGAGGTGAC TCTACTGAGAACTTTGAGG- ... (5’-GGTGGGGAAGAAGTT ATCAGGGAA- CAAGCTGG-3’ ); for L51T, L51T-R (5’ -CCAGCTT GTTCCCT TGTAA CTTCT TCCCCACC-3’)andL51T-F (5’ -GGTGGGGAAGAAGTT ACAAGGGAACAAGCT GG-3’); for A59V, A59V-R (5’-CCTCAAAGTTCTCAG- ... TCTACTGAGAACTTTGAGG- 3’); for G67A, G67A-R(5’-GGCATCTGTAGAGTG CGC- GACATCCTCAAAGTTC-3’)andG67A-F(5’ -GAAC TTTGAGGATGTC GCGCACTCTACAGATGCC-3’ ); and for G67 S, G67S-R (5’ -GGCATCTGTAGAGTG C- GAGACATCCTCAAAGTTC-3’)andG67S-F(5’

Ngày tải lên: 10/08/2014, 05:21

15 479 0
Báo cáo y học: " Is there a linear relationship between the Brief Psychiatric Rating Scale and the Clinical Global Impression-Schizophrenia scale? " doc

Báo cáo y học: " Is there a linear relationship between the Brief Psychiatric Rating Scale and the Clinical Global Impression-Schizophrenia scale? " doc

... Research design All patients were evaluated and rated from their medical records using the BPRS and the CGI-SCH during the same session, but at initial consultation for Group A and at a random ... summarize and calculate an aver- age on items and point allocation. If these s cales are composed as a summary, they might be less problematic than that of our trials. However, even in such scales, ... Iowa; 1984. 6. Andreasen NC: Scale for the Assessment of Negative Symptoms (SANS) Iowa City: University of Iowa; 1983. 7. American Psychiatric Association: Diagnostic and Statistical Manual of

Ngày tải lên: 11/08/2014, 16:22

10 331 0
Báo cáo y học: "Host gene expression profiling in influenza A virus-infected lung epithelial (A549) cells: a comparative analysis between highly pathogenic and modified H5N1 viruses" ppt

Báo cáo y học: "Host gene expression profiling in influenza A virus-infected lung epithelial (A549) cells: a comparative analysis between highly pathogenic and modified H5N1 viruses" ppt

... CCATCCTTTGGTACAACATGC 3′; STAT1 RP 5′ TGCACATGGTGGAGTCAGG 3′; CXCL10 FP 5′ TTCAAGGAGTACCTCTCTCTAG 3′; CXCL10 RP 5′ CTGGATTCAGACATCTCTTCTC 3′; CCL5 FP 5′ TACCATGAAGGTCTCCGC 3′; CCL5 RP 5′GACAAAGACGACTGCTGG ... cells: a comparative analysis between highly pathogenic and modified H5N1 viruses Alok K Chakrabarti*, Veena C Vipat, Sanjay Mukherjee, Rashmi Singh, Shailesh D Pawar, Akhilesh C Mishra Abstract Background: ... Scan array express (PerkinElmer, Waltham, MI) Grid alignment was done using gene annotation files and raw data were extracted into MS EXCEL Data Analysis Data was analyzed using GENOWIZ Microarray

Ngày tải lên: 12/08/2014, 01:21

11 509 0
Báo cáo y học: " Multiple-infection and recombination in HIV-1 within a longitudinal cohort of women" potx

Báo cáo y học: " Multiple-infection and recombination in HIV-1 within a longitudinal cohort of women" potx

... and ED31C (CCATTACACAGGCCTGTCCAAAG) and the second round primers used were DR7C (TCAACTCAACTGGTC- CAAAG) and DR8C (CACTTCTCCAATTGTCCCTCA) that yield data on 694 nucleotides in the aligned sequences. ... strata and ignoring the env sequence data strata In other cases, we form a subsample at random For example, to simulate what we have found if we only had cross-sectional data, we calculate ... at 4°C until it was har- vested and run on an 8% agarose gel. A band at the 1,617 base-pair size was extracted from the gel using the QIA Quik Gel Extraction Kit (Qiagen, Valencia, California,

Ngày tải lên: 12/08/2014, 23:21

12 332 0
Báo cáo y học: " Modification of a loop sequence between -helices 6 and 7 of virus capsid (CA) protein in a human " pot

Báo cáo y học: " Modification of a loop sequence between -helices 6 and 7 of virus capsid (CA) protein in a human " pot

... interests 14 Authors' contributions TS and EEN designed the research, AK, AS, YS, and EEN performed the research, TS, MN, AA, and EEN analyzed the data, and AA, HA, TS, and EEN wrote the paper 15 Acknowledgements ... Science, and Technology, and the Ministry of Health, Labour and Welfare, Japan 19 References 20 10 11 Shibata R, Sakai H, Kawamura M, Tokunaga K, Adachi A: Early replication block of human immunodeficiency ... Hirofumi Akari2 and Emi E Nakayama*1 Address: 1Department of Viral Infections, Research Institute for Microbial Diseases, Osaka University, Osaka 565-0871, Japan, 2Tsukuba Primate Research Center, National

Ngày tải lên: 12/08/2014, 23:21

11 237 0
Báo cáo y học: " A balanced transcription between telomerase and the telomeric DNA-binding proteins TRF1, TRF2 and Pot1 in resting, activated, HTLV-1-transformed and Tax-expressing human T lymphocytes" pot

Báo cáo y học: " A balanced transcription between telomerase and the telomeric DNA-binding proteins TRF1, TRF2 and Pot1 in resting, activated, HTLV-1-transformed and Tax-expressing human T lymphocytes" pot

... 5'-GTTCTTGGCTTTCAGGATGG-3', Pot1 sense, 5'- TGGGTATTGTACCCCTCCAA-3' and antisense, 5'-GAT- GAAGCATTCCAACCACGG-3'. TRF1 sense,5'-GCTGTTT- GTATGGAAAATGGC-3' ... GTATGGAAAATGGC-3' and antisense: 5'- CCGCTGCCTTCATTAGAAAG-3', TRF2 sense, 5'-GACCT- TCCAGCAGAAGATGC-3' and antisense, 5'-GTTGGAG- GATTCCGTAGCTG-3'. The thermal cycling ... H, Toyama T, Yamashita K, Maeda K, Ido A, Matsuoka H, Okayama A, Nakanishi T, et al.: Telomerase activ- ity and telomere length as prognostic factors of adult T-cell leukemia. Leuk Lymphoma 2005,

Ngày tải lên: 13/08/2014, 09:21

10 285 0
Báo cáo y học: " Evolution of the HIV-1 envelope glycoproteins with a disulfide bond between gp120 and gp41" pdf

Báo cáo y học: " Evolution of the HIV-1 envelope glycoproteins with a disulfide bond between gp120 and gp41" pdf

... regularly for the emergence of revertant viruses, using CA-p24 ELISA and/or the appearance of syncytia as indicators of virus replication. At regular inter- vals, cells and filtered supernatant ... coordination. All authors read and approved the final manuscript. Acknowledgments We thank Stephan Heynen for technical assistance. This work was spon- sored by the Dutch AIDS Fund (Amsterdam) and by ... pLAI as SalI-BamHI frag- ments. The numbering of individual amino-acids is based on the HIV-1 HXB2 gp160 sequence. Cells and transfection SupT1 T cells and C33A cervix carcinoma cells were main-

Ngày tải lên: 13/08/2014, 13:20

11 394 0
A COMPARATIVE STUDY BETWEEN THE LAWS OF THE EUROPEAN UNION AND VIETNAM

A COMPARATIVE STUDY BETWEEN THE LAWS OF THE EUROPEAN UNION AND VIETNAM

... Professor Lars Goran Malmberg, Professor Michael Bogdan, Professor Christian Hathen, Ms. Catarina Carlsson and Ms. Anna Wiberg. At the same time, I am also grateful to professors, colleagues and ... and services It tells them that that the trademark is made and designed by a particular producer and by no one else Thus, a brand itself is a seal of authenticity, a practical ... (WIPO), Geneva, Switzerland and Ms. Andrea Wechsler at the Max Planck Institute for Intellectual Property, Competition and Tax Law in Munich, Germany. I also thank so much Robert Schwartz and Phillip

Ngày tải lên: 15/07/2015, 10:58

218 472 0
Movement patterns and residence of adult winter flounder within a long island estuary

Movement patterns and residence of adult winter flounder within a long island estuary

... in a natural habitat Transactions... grypus, and harp seals Pagophilus groenlandica in the bay—particularly in the high-density area—between November and May (USFWS 1997) Thus, appearance ... of gilthead sea bream (Sparus aurata) in a coastal lagoon (Ria Formosa, Portugal) Estuarine Coastal and Shelf... Collie, L A E Kaplan, and J Crivello 2008 Winter flounder larval genetic ... movement patterns and quantify residency within a coastal bay of Long Island. METHODS Study site.—Shinnecock Bay is a barrier beach and lagoonal estuary located on the south shore of Long Island, approximately

Ngày tải lên: 04/09/2015, 17:09

13 451 0
A field and geochemical study of the boundary between the nanga parbat haramosh massif and the ladakh arc terrane, northern pakistan

A field and geochemical study of the boundary between the nanga parbat haramosh massif and the ladakh arc terrane, northern pakistan

... Between the Nanga Parbat-Haramosh Massif and the Ladakh Arc Terrane, Northern Pakistan Redacted for Privacy Abstract appro e Lawrence Snee The Nanga Parbat-Haramosh massif (NPHM) is a north-south ... limited available data to located approximately the is unmapped boundaries... Parbat Haramosh Massif Ladakh Arc Nanga Parbat Group Ikr Onla ahnou Onl Bar1urna Amphlbollt Fault Zone ... west of Skardu Indus... east and west lie the late Cretaceous Ladakh and Kohistan island arc terranes, and to the south lie Tethyan and cratonic sediments and associated plutons

Ngày tải lên: 11/11/2015, 23:01

146 348 0
A Poisson bridge between fractional Brownian motion and stable Levy motion

A Poisson bridge between fractional Brownian motion and stable Levy motion

... 2645, INRIA Available at http://www-syntim.inria.fr/fractales/ Pipiras, V and Taqqu, M S (2000) The limit of a renewal reward process with heavy-tailed rewards is not a linear fractional stable motion ... random variables, 1 ≤ r ≤ 2 Ann Math Statist, 36:299–303 Willinger, W., Paxson, V., Riedi, R H., and Taqqu, M S (2003) Longrange dependence and data network traffic... Gaigalas, R and Kaj, ... regarded as a “bridge” between fractional Brownian motion and stable L´evy motion and exhibits an intrinsic duality in its features 4.1 Locally and globally asymptotically self-similar processes A stochastic

Ngày tải lên: 14/11/2015, 08:03

17 407 0
A retrospective critic ReDebate on Stakeholders’ resistance checklist in software project management within multicultural, multiethnical and cosmopolitan society context: The Malaysian experience

A retrospective critic ReDebate on Stakeholders’ resistance checklist in software project management within multicultural, multiethnical and cosmopolitan society context: The Malaysian experience

... Kuala Lumpur, Malaysia Faculty of Business and Law, International University of Malaya and Wales, Kuala Lumpur, Malaysia Faculty of Built Environment, University of Malaya, Kuala Lumpur, Malaysia ... Preferences Japan, Taiwan and Brazil, Japan, Taiwan and Brazil Face-to-face, analytical at milestones Hungary and India Written status reports, fixed intervals Netherlands and Germany Detailed progress ... between analysts and stakeholders (Rahman, Haron, Sahibuddin, & Harun, 2014) The stakeholder management approach assists to integrate managerial concerns, such as strategic management, marketing and

Ngày tải lên: 25/04/2016, 07:38

14 354 0
Is the EU “Going Too Far”? Examining the divide between the legislator within the EU and members of the financial market

Is the EU “Going Too Far”? Examining the divide between the legislator within the EU and members of the financial market

... International Auditing and Assurance Standards Board (2011) Audit Quality: An IAASB Perspective New York International Auditing and Assurance Standards Board (2012a) International Standard on Auditing ... International Auditing and Assurance Standards Board (2012c) International Standard on Auditing 700 New York: International Federation of Accountants International Ethics Standards Board for Accountants ... International Federation of Accountants International Auditing and Assurance Standards Board (2012b) International Standard on Auditing 315 New York: International Federation of Accountants International

Ngày tải lên: 10/12/2016, 15:35

97 345 0
Power Relationships Within A Corporate Finance Department: A Foucauldian Approach To Corporate Hierarchies And Resistance

Power Relationships Within A Corporate Finance Department: A Foucauldian Approach To Corporate Hierarchies And Resistance

... DOCTORATE OF PHI LOSOPHY: A THESI S Angela Marie Garland 'Power relationships within a corporate finance department: a Foucauldian approach to corporate hierarchies and resistance’ SUBMI TTED FOR APPROVAL ... investigates power relationships within a corporate Finance Department employing a Foucauldian approach to explaining corporate hierarchies and resistance and the implications Research was conducted ... Ferreira, L & Merchant, K (1992) Field research in management accounting and control: a review and evaluation Accounting, Auditing and Accountability Journal, Vol 5, No 4, 1992, 3-34 Foucault,

Ngày tải lên: 10/12/2016, 17:14

201 336 0
Factors affecting customer satisfaction in public sector a comparative study between administrative service and transport service in dong nai province

Factors affecting customer satisfaction in public sector a comparative study between administrative service and transport service in dong nai province

... EIGENVALUES Component Total Variance Explained Extraction Sums of Squared Loadings Initial Eigenvalues Total % of Variance Cumulative % Total % of Variance Rotation Sums of Squared Loadings Cumulative ... public administrative service and public transport service in Dong Nai within the last years, a customer was randomly approached to complete a survey Firstly, the research proposed a model to analyze ... quality variables named as tangibility, reliability, competence, access and empathy The results indicated that tangible and competence have strong positive effect on customer satisfaction Finally,

Ngày tải lên: 03/08/2017, 21:25

103 295 0
A cause and effect relationship between foreign institutional investment flows and stock market returns  vietnam case study

A cause and effect relationship between foreign institutional investment flows and stock market returns vietnam case study

... enthusiasm ii ABSTRACT Many previous studies has investigated the relationship between Foreign Institution Investment (FII) and stock market return in emerging markets of Asia such as Taiwan, Thailand, ... setwd("c:/users/admin/desktop/data") > library(mgarch) Loading required package: tseries Loading required package: quadprog Loading required package: zoo Attaching package: ‘zoo’ The following object(s) are ... masked from ‘package:base’: as.Date, as.Date.numeric ‘tseries’ version: 0.10-27 ‘tseries’ is a package for time series analysis and computational finance See ‘library(help="tseries")’ for details

Ngày tải lên: 07/12/2018, 00:07

98 114 0
w