... promote the sale of a product Claims about nutrition or fitness Images, messages and partnerships with sport organizations are used to associate a product with health and fitness Clubs A brand or ... commercial message multiple times Spokes-characters Animated brand characters created by companies to build product awareness and brand loyalty Sweepstakes Contests that offer the chance to win toys or ... restaurants (nine instances), chips (three instances), dairy products (three instances), other (two instances) and sweet snacks (one instance) Marketers also use social networking Web sites such...
Ngày tải lên: 07/03/2014, 10:20
... instance? In this paper, we address this question by systematically training the graph-based REG algorithm on a number of “semantically transparent” data sets of various sizes and evaluating on a held-out ... training data will be smaller, which may lead to more consistent results across training sets Conclusion Our experiment has shown that with 20 or less training instances, acceptable attribute selection ... different sized training sets, and evaluated them on our test data For this experiment, we only used English data 3.1 Materials As training sets, we used randomly selected subsets of the full English...
Ngày tải lên: 07/03/2014, 22:20
Báo cáo hóa học: " Homologous recombination is unlikely to play a major role in influenza B virus evolution" doc
... Meanwhile, topological shifts for each of the recombinants have strong bootstrap support (data not shown) However, large influenza viral genes in the databases may actually represent assembled artifactual ... individuals [22] Conclusion To sum up, our analysis showed that homologous recombination in influenza B viruses was very rare or absent and could not confer a substantial fitness advantage Therefore, ... Influenza Virus Resource [11] and then aligned using Clustal X [12] To gain an initial insight into possible recombination events, each of the eight data sets was analyzed respectively using the 3SEQ...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo khoa học: " Biological impact of geometric uncertainties: what margin is needed for intra-hepatic tumors" ppsx
... %(ΔEUD) increase as the margin decreases The box plot also shows how %(ΔEUD) changes as survival rates (SF2) change There is no significant change as SF2 increases for both of CTV and CTVa The geometric ... uncertainties are traditionally overcome by adding adequate margin to CTV to ensure target dose coverage and normal tissue sparing ICRU (International Commission on Radiation Units and Measurements) report ... impact was largest when there were no motion and setup margins at all (i.e when CTV = PTV) To establish if the results from figures &3 are statistically significant, a paired sample t test was...
Ngày tải lên: 09/08/2014, 09:20
Báo cáo y học: " Harmonization of monographic standards is needed to ensure the quality of Chinese medicinal materials" docx
... Materia Medica Standards Japanese Pharmacopoeia Thai Herbal Pharmacopoeia British Pharmacopoeia American Herbal Pharmacopoeia (AHP) World Health Organization State Food and Drugs Administration, ... residues and mycotoxins across all monographs (Table 2) All analytical methods and parameters under the HKCMMS were advised by the International Advisory Board (IAB) after considering all the data ... CMMs in various countries and regions Each individual regulation system focuses on specific issues In the United Sates, regulation places its emphasis on source herbal materials In the European...
Ngày tải lên: 13/08/2014, 15:21
HPLC made to measure a practical handbook for optimization
... cornerstone of many academic careers in analytical and other fields of chemistry Annual, dedicated meetings, as well as major parts of ACS, ASMS, AAPS and AAAS meetings, are routinely devoted to talks ... That is to say, what relevant information about the analytical purpose and the samples is available? • How should I it? Do I have all what I need, and is what I want to really possible? At first ... Africa, maximizing profits among marketing strategists, new discoveries among scientists This principle is of course also valid in chemistry and in analytics This book deals exclusively with the subject...
Ngày tải lên: 06/10/2016, 09:35
WIN! A Leader''''s Guide to Building a Winning TeamLeader''''s Workbook ppt
... free to use this or to create your own Our Professionalism Manifesto Maintaining a strong brand helps us compete against our competition in the marketplace, increases our customer base, and improves ... member 's weaknesses In the book, Chase and Coach Billings discuss why this approach is outdated, and why you should instead focus on developing the team member 's strengths Winning Team Leaders focus ... team 's chances of winning The book discusses why businesses should also be using this type of philosophy According to the book, what are three negative impacts to an organization or team when a...
Ngày tải lên: 27/06/2014, 23:20
From projects to programs a project manager’s journey
... numerous project management publications A passionate speaker, he has presented internationally across the United States, Asia, Canada, and Africa Penkar has a Bachelor of Engineering in Electronics ... you know what s up with Barbara?” Harvey asks as we parted “She was awfully quiet today, not a word I wonder why?” What a great observation; I had completely missed that Barbara was unusually quiet ... plant has a senior program manager assigned; there are so many moving parts you see.” Andy works for a large multinational that produces biodegradable stuff, such as spoons, plates, and napkins...
Ngày tải lên: 25/10/2016, 18:46
What it is to be a leader by geoffrey byruch
... journey is the first step in creating a successful business But what happens when you hit a bump in the road and morale is down? What if money is tight and the stress levels are at an all time ... emotional decisions Regardless of what happens, you need to own it • The best leaders are those that are able to control their emotions and make their decisions with the utmost reason and purpose ... between asking and telling someone to something Make sure that you are asking Asking shows trust and understanding Telling shows micromanagement and devaluation A LEADER NEEDS TO BE CONFIDENT • Part...
Ngày tải lên: 30/11/2015, 10:43
What is a GAP YEAR why do people take a GAP YEAR how to take a GAP YEAR
... Financials of a Gap Year Tips for Making Your Gap Year a Success I What is a gap year? In its most basic form a gap year is a year taken off from traditional schooling between high school graduation ... MEMBERS OF GROUP OUTLINE What is a gap year? Why people take a gap year? Misconceptions About the Gap Year Misconceptions About the Gap Year Ways to spend your gap year Tips for choosing a gap year ... working abroad Often it means all three! Most students who choose to take a gap year follow a very similar path as those who decide to go directly into college, as the best way to take a gap year is...
Ngày tải lên: 21/12/2015, 09:57
What is and how to write a cover letter
... releases on various games, matches, and players, as well as contacted the proper media outlets to update them on scores and provide highlights of games These experiences have given me the background ... internships, and study abroad experience I am eager to meet with you to further discuss the attributes and passion I can bring to this position and look forward to hearing from you soon Sincerely, ... Your Name Address Address Phone ▫ email Date Name of Person Company Address Address Re: Community Advocate Position Dear Ms Name, I am very interested in your posting for a Community Advocate,...
Ngày tải lên: 03/09/2016, 20:16
Development of a method to measure consumer emotions associated with foods
... Warm Whole Active Affectionate Calm Carefree Irresistible Satiating Secure Angry Annoyed Bad Cruel Disagreeable Discouraged Disgusted Irritated Lonely Mean Miserable Nauseated Rejected Sad Suffering ... Zuckerman, 1997) The MAACL in its revised form (MAACL-R) contains five categories or scales with a total of 66 adjectives This is a checklist and the terms are not scaled The questionnaire can be ... instrument to measure emotion works within the laboratory (CLT) and also internet testing Thomson (2008) has also argued that concepts such as satisfaction are more appropriate than simple acceptance...
Ngày tải lên: 03/04/2013, 21:07
Tài liệu HOW TO MEASURE THE IMPACT OF A CRM STRATEGY ON THE FIRM PERFORMANCE doc
... relationships since firms have the help of sophisticated information systems and data warehouses been able to manage a great deal of data The challenge is to capture and measure soft and qualitative ... nonfinancial measures and gives the adequate importance to human relationships and intangible assets This cross-functional approach should establish linkages among the metrics, shaping a network ... non-financial metrics show that there is a strong association between non-financial performance measures such as customer and employee satisfaction, customer and employee retention and quality measures...
Ngày tải lên: 20/12/2013, 17:15
Tài liệu What it is and How to Prepare pdf
... and many businesses such as banks, post offices, restaurants and stores may close or have fewer workers • Buses may be stopped and gasoline may be limited • People may be told not to attend group ... employees about it Test and revise your plan as needed Decide which employees and supplies are needed to maintain the business Provide infection control supplies such as hand sanitizer, tissues and ... cough or sneeze Throw the tissue away and wash your hands If you not have a tissue, cough or sneeze into your shoulder or arm • Clean surfaces such as countertops, sinks, faucets, doorknobs, telephones...
Ngày tải lên: 20/12/2013, 23:15
Tài liệu What Is Micromanagement? And What You Can Do To Avoid It. docx
... result is stress, and stress can lead to sick-days or turnover In fact, the number one reasons most employees leave a workplace is because of bad management—notably, they feel their managers ... Knowledge 's Management and Leadership Skills for New Managers, Advanced Management and Leadership Skills, and Negotiation and Communication Skills courses Steve has taught more than 2,500 custom and public ... may need to know all the details in case the staff member is absent Sometimes these managerial responsibilities can appear intrusive or controlling to staff – particularly to those who are under-performing...
Ngày tải lên: 24/01/2014, 09:20
Tài liệu Báo cáo khoa học: Stimulation of poly(A) synthesis by Escherichia coli poly(A)polymerase I is correlated with Hfq binding to poly(A) tails ppt
... Reverse Forward Reverse 5¢-TAATTAACCCTCACTAAAGGGGTGCTCGGCATAAG 5¢-GCCATGAATATCTCCAACGAG 5¢-CATCCAAAATACGCCATGAATATC 5¢-TAATACGACTCACTATAGGGGCCGCTTAACGTCGCG 5¢-GCTTCAGTACTTAGAGAC 5¢-TAATACGACTCACTATAGGGAGACGTAGCACGTTACACC ... 5¢-TAATACGACTCACTATAGGGAGACGTAGCACGTTACACC 5¢-GAAAAAAGGGGCCACTCAGG 5¢-T(18)GAAAAAAGGGGCCACTCAGG 5¢GCGTCGCTAATTCTTGCGAGA18TTTCAGAAAAGGGCTG 5¢-C(18)GAAAAAAGGGGCCACTCAGG 5¢-G(18)GAAAAAAGGGGCCACTCAGG 5¢-GAATTGCTGCCGTCAGCTTGA ... et al ATPase activity and to affect polyadenylation of bacterial RNAs [25–27] Polyadenylation is ubiquitous in all organisms but has opposite effects on mRNA stability in prokaryotes and eukaryotes...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: Novel aggregate formation of a frame-shift mutant protein of tissue-nonspecific alkaline phosphatase is ascribed to three cysteine residues in the C-terminal extension pdf
... M, Shima M, Nakajima S, Mushiake S, Okada S & Ozono K (1998) Analysis of localization of mutated tissue-nonspecific alkaline phosphatase proteins associated with neonatal hypophosphatasia using ... childhood, adult and odontohypophosphatasia The disease is caused by various mutations in the TNSALP gene, which is located on chromosome 1p-36.1–34, and is transmitted in an autosomal recessive or a ... Hayashi Z, Watanabe A & Hirayama T (1994) Shimada T Novel missense and frameshift mutations in the tissue-nonspecific alkaline phosphatase gene in a Japanese patient with hypophosphatasia Hum Mol Genet...
Ngày tải lên: 19/02/2014, 17:20