... Hatayama, T (1999) Molecular cloning, expression and localization of human 105 kDa heat shock protein, Hsp105 Biochim Biophys Acta 1444, 138–142 16 Yasuda, K., Nakai, A. , Hatayama, T & Nagata, ... such as Hsp10 5a and Hsp70 in various mammalian cells Enhancement of thermoresistance of cells by SA Upon exposure to a sublethal heat treatment, mammalian cells acquire transient resistance to a ... neutral red, and fixed with 1% formaldehyde containing 1% CaCl2 for The dye incorporated into viable cells was extracted with 50% ethanol containing 1% acetic acid, and absorbance at 540 nm was measured...
Ngày tải lên: 17/03/2014, 10:20
... Lexical Chain Features Chain starts and ends We follow (Chan et al 2007) to model the lexical chain starts and ends at a story boundary with a statistical distribution We apply a window around ... approach in (Chan et al 2007) based on the training data The optimal value is found to be 130.9sec for long programs We make use of three lexical chain features: chain starts, continuations and ... We have presented a Bayesian decision framework that performs automatic story segmentation based on statistical modeling of one or more lexical chain features, including lexical chain starts,...
Ngày tải lên: 23/03/2014, 17:20
Vector sum phase shifter using a quadrature magic t for application in polarization control
... a linearly polarized horn antenna, Fig 1-2 shows a dual linear polarization horn antenna, Fig 1-3 shows a circularly polarized spiral antenna, and Fig 1-4 shows a dual linearly polarized array, ... polarization spiral antenna Fig 1-4: Dual linear polarization array taken from [7] It is important to note that the dual linear polarization antenna can also be converted into a circular polarized ... communication or radar is transmitted through an antenna The polarization of the EM wave is dependent on the polarization of the antenna Antenna polarization is a characteristic of the antenna and...
Ngày tải lên: 30/09/2015, 10:11
Báo cáo khoa học: "Two years experience with quality assurance protocol for patient related Rapid Arc treatment plan verification using a two dimensional ionization chamber array" docx
... movie images and interpolation algorithm was set as described above The analysis was made using gamma evaluation method [37] to compare measured and calculated dose distribution The gamma evaluation ... chamber array consists of a 32 × 32 matrix of 1024 parallel plate ionization chambers The ionization chambers are arranged in a square of 24 cm × 24 cm as active measuring area Each chamber has 0.4 ... criteria were 3% and mm, no threshold, 2D global gamma index For the analysis of the gamma evaluation result the histogram of the gamma evaluation was displayed The histogram of the gamma evaluation...
Ngày tải lên: 09/08/2014, 09:20
Báo cáo y học: "Are chest compressions safe for the patient reconstructed with sternal plates? Evaluating the safety of cardiopulmonary resuscitation using a human cadaveric model" docx
... Control lateral, xyphoid Cadaver 1 inferolateral Cadaver 2 lateral, xyphoid Cadaver lateral Cadaver lateral Cadaver lateral Figure Elevation and examination of deep sternal cortex and viscera McKay ... events is a complicated science Patient risk estimates are based on a number of known risk factors Cardiac and major vascular surgery places a patient at a higher risk for perioperative cardiac events ... each plate was disassembled Each screw, pin and plate was examined for damage or failure Results The plating mechanism was visually evaluated for damage and checked for functional compromise No...
Ngày tải lên: 10/08/2014, 09:22
DSpace at VNU: Possibility of using a lithotrophic iron-oxidizing microbial fuel cell as a biosensor for detecting iron and manganese in water samples
... inoculated with a bacterial source (an inoculum) from natural mud taken from a brownish water stream at a depth of 20 cm underneath the stream bottom in Ung Hoa, Hanoi, Vietnam Inoculation was carried ... anode and the cathode of each MFC Electrical parameters (current I (A) , voltage U (V), charge Q (C) and resistance R (U)) were measured and/or calculated according to Aelterman et al (2006) and ... assembled A cm  cm Naon 117 membrane (Du Pont, USA) was used to separate the two compartments of each reactor Each reactor was assembled using nuts and bolts penetrating holes at corners of each large...
Ngày tải lên: 16/12/2017, 11:35
Báo cáo y học: "Sustained High Quality of Life in a 5-Year Long Term Follow-up after Successful Ablation for Supra-Ventricular Tachycardia. Results from a large Retrospective Patient Cohort"
... (Years) All patients AVNRT AVRT EAT From symptom to ablation (Years) All patients AVNRT AVRT EAT RF-Applications (Number) All patients AVNRT AVRT EAT Examination time (Minutes) All patients AVNRT ... O´Callaghan PA, Meara M, Kongsgaard E, Poloniecki J, Luddington L, Foran J, Camm AJ, Rawland E, Ward DE Symptomatic improvement after radiofrequency catheter ablation for typical atrial flutter Heart ... transvenous cryoablation of supraventricular tachycardia (atrial fibrillation, atrial flutter, Wolff-Parkinson-White syndrome, atrioventricular nodal reentry tachycardia) Journal of cardiovascular electrophysiology...
Ngày tải lên: 03/11/2012, 11:44
STRATEGIC PLANNING FOR PROJECT MANAGEMENT USING a PROJECT MANAGEMENT
... individuals are not only af- 9755.ch01 10/31/00 9:42 AM Page 5 Gap Analysis fected by the organization’s performance, but may even have a claim on its performance As an example, unions can have a strong ... Responsibility Evaluation of Information Managerial Values of Management Strategy Evaluation Strategy Selection Strategy Implementation FIGURE 2–1 Basic strategic planning Corporate Strategic Plan Strategic ... critical success factors: qualitative factors, organizational factors, and quantitative factors To take advantage of the economic outlook, whatever it happened to be at a given time, senior managers...
Ngày tải lên: 14/08/2013, 13:47
Optimal placement of horizontal - and vertical - axis wind turbines in a wind farm for maximum power generation using a genetic algorithm
... pp.927-938 935 (a) Best, mean and median objective valuses for Case I (b) Standard deviations for Case I (c) Best, mean and median objective values for Case II (d) Standard deviations for Case II Figure ... optimization for VAWT wind farm The results are given in Table The optimal layout is the same as that of a HAWT as shown in Figure Table Optimization results for VAWT wind farm Optimization Objective ... Table Case III has been taken from the paper of Yan et al [12] and Case III has a double rotor radius compared to Case IV so that the tip-speed ratio also doubles Again, the size of the farm is...
Ngày tải lên: 05/09/2013, 17:03
Tài liệu Module 3: Using a Conceptual Design for Data Requirements docx
... reasons for gathering and analyzing data, as well as the formulation of this data into use cases Use cases will be the foundation for determining data requirements for the system Module 3: Using ... skills and experience necessary to perform a task • Collect artifacts, such as printed documentation and manuals 50 Module 3: Using a Conceptual Design for Data Requirements Analyzing Information ... important to superfluous Validation Information provided is not always accurate, so it is important for the team to validate the information gathered One method of validating information is to gather...
Ngày tải lên: 10/12/2013, 17:15
Using compensation strategies in listening for 10th form students a case study at the high school for gifted students of vinh university
... there are two influential views: traditional view and alternative view They thought that traditional view was inappropriate and inadequate because the listener was regarded as a tape-recorder and ... vocabulary, grammar, or other target language elements Language based clues may come from aspect of the target language that the learner already knows, from the learners’ own language, or from another ... verification, asking for clarification of a confusing point, asking for help in doing a language task, talking with a native-speaking conversation partner, and exploring cultural and social norms)...
Ngày tải lên: 27/12/2013, 20:26
Tài liệu Instructor Notes Module 3: Using a Conceptual Design for Data Requirements pdf
... be able to: • Discuss use cases, data requirements, and requirements validation as they relate to conceptual design for data systems ! To prepare for the activity • Review the activity and anticipate ... Module 3: Using a Conceptual Design for Data Requirements Activities Activity 3.1: Identifying Data-Related Use Cases and Data Requirements In this activity, students will determine data requirements, ... Many students with database backgrounds will want to think and work in the physical data model Remind them that, at this point, the work is still in the conceptual phase THIS PAGE INTENTIONALLY...
Ngày tải lên: 17/01/2014, 09:20
Tài liệu Create a Point-and-Click Query Tool for Users Using a Web Form pptx
... string is passed to a DataAdapter control, filling a data table From there, the data is displayed when the data source of the DataGrid control is set to the data table Users can change the sort ... Specified Data Private Sub btnView_Click(ByVal sender As System.Object, _ ByVal e As System.EventArgs) Handles btnView.Click Dim odaDisplay As OleDb.OleDbDataAdapter Dim dtDisplay As New DataTable() ... buttonface Label Name Label1 Text Tables Name Label2 Text Columns Name Label3 Text SQL String Name Label4 Text Data Display Name lstTables AutoPostback True Name lstColumns SelectionMode Multiple AutoPostback...
Ngày tải lên: 26/01/2014, 11:20
Tài liệu Create a Point-and-Click SQL Server Query Tool for Users Using a Windows Form doc
... create a data table; then set the ' data source of the data grid odaDisplay = New OleDb.OleDbDataAdapter(Me.txtSQLString.Text, mcnn) odaDisplay.Fill(dtDisplay) Me.dgDisplay.DataSource = dtDisplay ... btnView_Click(ByVal sender As System.Object, _ ByVal e As System.EventArgs) Handles btnView.Click Dim odaDisplay As OleDb.OleDbDataAdapter Dim dtDisplay As New DataTable() Try ' Take the txtSQLString text and ... multiple tables and automatically create the join Add a list of columns for the user to choose to use for criteria, and allow the user to input the criteria Use this tool as a base for editing...
Ngày tải lên: 26/01/2014, 11:20
Tài liệu Báo cáo khoa học: "Using Multiple Sources to Construct a Sentiment Sensitive Thesaurus for Cross-Domain Sentiment Classification" doc
... negative sentiment) given a small set of labeled data for the source domain, and unlabeled data for both source and target domains In particular, no labeled data is provided for the target domain ... techniques In EMNLP 2002, pages 79– 86 Patrick Pantel and Deepak Ravichandran 2004 Automatically labeling semantic classes In NAACLHLT’04, pages 321 – 328 Sunita Sarawagi and Alok Kirpal 2004 Efficient ... to train a binary classifier SFA is the spectral feature alignment technique of Pan et al (2010) Both the LSA and FALSA techniques are based on latent semantic analysis (Pan et al., 2010) For the...
Ngày tải lên: 20/02/2014, 04:20
Tài liệu Báo cáo khoa học: "Refined Lexicon Models for Statistical Machine Translation using a Maximum Entropy Approach" pptx
... References Yaser Al-Onaizan, Jan Curin, Michael Jahr, Kevin Knight, John Lafferty, Dan Melamed, David Purdy, Franz J Och, Noah A Smith, and David Yarowsky 1999 Statistical machine translation, final report, ... 36th Annual Meeting of the Association for Computational Linguistics and 17th Int Conf on Computational Linguistics, pages 960–967, Montreal, Canada, August Franz J Och and Hermann Ney 200 0a Giza++: ... 1997 A DP-based search using monotone alignments in statistical translation In Proc 35th Annual Conf of the Association for Computational Linguistics, pages 289–296, Madrid, Spain, July K .A Papineni,...
Ngày tải lên: 20/02/2014, 18:20
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf
... TTTTCTCGAGAAAGATGCCGATTTGGGCGC GGGGCTCGAGGTTTTATATTTGTTGTAAAA ATATTATATATATATATAGGGTCGTATATA AAATTATAGAAAGCAGTAGA TAAAACAATG CTTCGAAGAATATACTAAAAAATGAGCAGG CAAGATAAACGAAGGCAAAGTTCAATTCA TCATTTTTTTTTTATTCTTTT ... CCCGCTCGAGTCTTAGAATTATTGAGAACG GCCCGGATCCTGATAGTAATAGAATCCAAA CCCCGAATTCAAATTATAGAAAGCAGTAGA AAGGCTCGAGAGATCTGTTTAGCTTGCCTC AAAAGTCGACGAGCTCGTTTTCGACACTGG TTTTGTCGACATGGCGCAACACGATGAAGC CGTAGACAAC GGGGGGATCCTTACATAAGCGTACAACAAA ... GGGGGGATCCTTACATAAGCGTACAACAAA CACTATTTGATTTCGGCGCCTGAGCATCA TTTAGCTTTTT ATCCAAAGTTTAGCCGATGACCCAAGCCAA TTGGCTTGGGTCATCGGCTAAACTTTGGAT AAACGCCTTCGCCCAAAGTTTAAAAGATGA TCATCTTTTAAACTTTGGGCGAAGGCGTTT...
Ngày tải lên: 16/03/2014, 01:20
Báo cáo khoa học: "Evaluating Centering-based metrics of coherence for text structuring using a reliably annotated corpus" doc
... Research, 17:35–55 Susan E Brennan, Marilyn A Friedman [Walker], and Carl J Pollard 1987 A centering approach to pronouns In Proceedings of ACL 1987, pages 155–162, Stanford, California Barbara ... Italian In Walker et al (Walker et al., 1998b), pages 115–137 Aggeliki Dimitromanolaki and Ion Androutsopoulos 2003 Learning to order facts for discourse planning in natural language generation ... Experiments using stochastic search for text planning In Proceedings of the 9th International Workshop on NLG, pages 98–107, Niagara-on-theLake, Ontario, Canada Eleni Miltsakaki 2002 Towards an aposynthesis...
Ngày tải lên: 17/03/2014, 06:20
Báo cáo khoa học: "A Part of Speech Estimation Method for Japanese Unknown Words using a Statistical Model of Morphology and Context" pptx
... Table 2: Character type configuration of infrequent words in the E D R corpus character type sequence kanji katakana katakana-kanji kanji-hiragana hiragana kanji-katakana kat akana-symbol-katakana ... play an important role in tagging part of words and Japanese words semantically equivalent speech Table shows examples of common charto Chinese characters Hiragana and katakana are acter bigrams ... the kanji-hiragana and Chinese character is too difficult to read, it is transliterated hiragana-kanji sequences are morphemes and others in hiragana This results in either hiragana-kanji or kanjiare...
Ngày tải lên: 23/03/2014, 19:20