... killing or incarcerating offers the most promise.7 However, think next of the contrast between influencing bin Laden and influencing the wealthy Arabs who continue to finance his activities Bin ... Influence in Counterterrorism A Broad View of System Influences 13 Decomposing the System into Classes of Actors 14 Decomposing the System into Classes of Influence 16 Decomposing the System into ... by any electronic or mechanical means (including photocopying, recording, or information storage and retrieval) without permission in writing from RAND. Published 2002 by RAND 1700 Main Street,
Ngày tải lên: 15/03/2014, 21:20
... aspects of therole of users require further research inter-2.3 INCIDENCE OF TRAFFICKING CONCERNSAccording to a survey conducted for thisresearch in co-operation with UNICEF coun-try offices and in ... right for civil societygroups, which may in certain circumstancesinclude representatives of victims of traffick-ing to intervene as “partie civile” in criminalproceedings South Africa has developed ... UNICEF policies and programming on child trafficking FIGURES Figure 3 Countries of origin according to number of countries reached within Africa 13 Figure 5 Countries of destination, according to
Ngày tải lên: 22/03/2014, 15:20
ADVANCED TOPICS IN SCIENCE AND TECHNOLOGY IN CHINA ppt
... 2IN SCIENCE AND TECHNOLOGY IN CHINA Trang 3IN SCIENCE AND TECHNOLOGY IN CHINA Zhejiang University is one of the leading universities in China In Advanced Topics in Science and Technology in China, ... limited to, computer science, materials science, the life sciences, engineering, environmental sciences, mathematics, and physics Trang 5Prof Jianping Geng Clinical Research Institute, Second Affiliated ... 978-3-540-73764-3 Springer BerUn Heidelberg New York Series ISSN 1995-6819 Advanced topics in science and technology in China Series e-ISSN 1995-6827 Advanced topics in science and technology in China Library
Ngày tải lên: 22/03/2014, 22:20
A TUTORIAL ON POINTERS AND ARRAYS IN C
... 2PREFACE This document is intended to introduce pointers to beginning programmers in the C programming language Over several years of reading and contributing to various conferences on C including ... like: char *my_strcpy(char *destination, char *source) In this case, I have followed the practice used in the standard routine of returning a pointer to the destination Again, the function ... proper circumstances In Program 1.1 of Chapter 1 I cast the pointers to integers into void pointers to make them compatible with the %p conversion specification In later chapters other casts will
Ngày tải lên: 05/04/2014, 01:21
#9_Methods and Containment in Unions_17_v3.ppt
... boolean contains(CartesianPoint point) + Rectangle boundingBox() Trang 55Design 1CartesianPoint - int x - int y + int getX() + int getY() + double distanceToO() + double distanceTo(CartesianPoint ... according to the distance covered in each run, from the shortest to the longest distance • Q: Which class should this operation belong to? Trang 39sortByDistance() in ALogpublic abstract class ... contains(CartesianPoint point) opname() Rectangle boundingBox() double perimeter() Dot Square int size Circle int radius Rectangle int width int height double distanceTo(CartesianPoint that) void translate(int
Ngày tải lên: 16/07/2014, 04:00
The advantages and disadvantages in teaching ppt
... skills like reading, summarizing, identifying and applying formulae and information and such critical thinking skills as analyzing, synthesizing, hypothesizing, speculating, etc Moreover, they ... and resources for learning are just basic All this cannot of course supply students in general and adult students in particular with any intrinsic motivation, a crucial factor for successful language ... schools and centers may fall short of student expectations Some teachers are untrained or inexperienced, delivering boring or uninteresting lessons; the physical classroom Trang 12conditions and
Ngày tải lên: 21/07/2014, 20:20
Báo cáo y học: "Mesenchymal progenitor cell markers in human articular cartilage: normal distribution and changes in osteoarthritis" ppt
... fluorescence-activated cell sorter (FACS) analysis using a Becton Dickinson FACScan and Cell Quest software (Becton Dickinson, San Jose, CA, USA). The extent of positive staining was calculated ... Safranin O and Notch-1 staining in clusters (10× and 40×). (b) Safranin O and Stro-1 staining of OA cartilage sections (10× and 40×). (c) OA cartilage sections immunostained for VCAM-1 (10× and ... frequency of Hoechst nega- tive cells (SP cells) and to isolate SP and non-SP (NSP) chondrocytes. Sorted cells were placed in culture and expanded in DMEM supplemented with 10% CS and Penicil- lin-Streptomycin-Glutamine.
Ngày tải lên: 09/08/2014, 14:21
Báo cáo khoa hoc:" Detection of quantitative trait loci for growth and fatness in pigs" ppt
... is the vector containing the phenotypic data of F2 animals for a given trait, b is a vector containing fixed effects and covariables, p and a are vectors containing the random effects of common ... selection in Chinese × European synthetic lines, the choice of breeding animals in crossbreeding programs involving Chinese breeds or the introgression of high growth or leanness alleles in the Chinese ... markers were combined according to their size and amplification conditions and amplified by PCR in one or two multiplexes PCR products of to 12 markers were then combined on a single gel and analysed
Ngày tải lên: 09/08/2014, 18:21
báo cáo khoa học: "A microarray approach to identify genes involved in seed-pericarp cross-talk and development in peach" ppt
... putatively involved in seed-pericarp crosstalk Results indicated that auxin, cytokinins, and gibberellins are good candidates, acting either directly (auxin) or indirectly as signals during early ... molecules, playing either direct or indirect roles Concerning hormones, parthenocarpic fruit develop-ment in some species is induced by applications of auxin or cytokinins (CKs), or gibberellins ... RD22-like protein, ctg1751, coding for serine carboxypeptidase, ctg1823, coding for a senescent associated protein, and ctg57, coding for an AUX/IAA protein, have been selected as S1, S2, S3 and S4 markers,
Ngày tải lên: 11/08/2014, 11:21
Báo cáo y học: "Human T-cell leukemia virus type 2 post-transcriptional control protein p28 is required for viral infectivity and persistence in vivo" ppt
... determined its contribution to viral replication and viralinduced immortalization in cell culture as well as viral replication kinetics and persistence in inoculated rabbits Our findings indicate ... transcription or activity of numerous cellular genes involved in cell growth and differentiation, cell cycle control, and DNA repair [16-20] Compelling evidence indicates that the pleiotropic effects ... HTLV-1 and HTLV-2 have the capacity to promote T-lymphocyte growth both in cell culture and in infected individuals; however, the mechanism by which the virus persists in the infected individual,
Ngày tải lên: 13/08/2014, 05:20
Báo cáo y học: "Hemodynamic variables and mortality in cardiogenic shock: a retrospective cohort study" pot
... records and the institutional patient data management system data- base (Centricity Critical Care Clinisoft ® ; General Electrics, Helsinki, Finland). Routine data recording included demo- graphic and ... Lifesciences Inc., Irvine, CA, USA) with continuous cardiac output and mixed venous oxygen saturation measurement (Vigilance ® ; Edwards Lifesciences Inc., Irvine, CA, USA) were in place in 119 ... when car- diac index and cardiac power index dropped below 3 L/min/ m 2 and 0.8 W/m 2 , respectively, and substantially increased with cardiac index drops below 2 L/min/m 2 and cardiac power index
Ngày tải lên: 13/08/2014, 19:20
Slide môn học PHP session 2a using variables and expressions in PHP
... The product of two variables, num1 and num2 is calculated in the multiply() function This function executes when the PHP script calls the function using the function name Trang 22Global Variables ... for local variables - II Here, the variables, num1 and num2 are declared inside the function as the local variables of the function They are initialized and used inside the multiply() function ... are initialized outside the function and declared as global within the multiply() function The product of two variables, var1 and var2 is calculated in the multiply() function This function
Ngày tải lên: 30/11/2016, 22:11
Chapter 6: FUNCTIONS AND POINTERS IN C++
... Example: // Finding the maximum of three integers #include int maximum(int, int, int); // function prototype int main() { int a, b, c; cout > a >> b >> c; cout max ) max = y; the arguments in a if ... function prototype or function definition, we will receive an error at compile time The lines that compose a function within a C++ program are called a function definition The function definition ... function’s return value The function name Any parameters required by the function, contained within ( and ) The function’s statements enclosed in curly braces { } Example : int FindMax (int
Ngày tải lên: 29/03/2017, 18:16
hormetic heat stress and hsf 1 induce autophagy to improve survival and proteostasis in c elegans
... disease-related factors such as PolyQ-containing proteins9, which can cause neurodegenerative disorders such as Huntington’s disease7 PolyQ proteins and metastable proteins Foci in seam cells Foci in muscle ... aggregation of PolyQ-containing proteins and other metastable proteins begins at the onset of adulthood3,5,9,10 In C elegans, this increase in proteotoxicity is accompanied by a decline in proteostasis ... eliminate background fluorescence For imaging of the nerve ring, Z-stack images were acquired at 0.6 mm slice intervals using an LSM Zeiss 710 scanning confocal microscope at 630 magnification
Ngày tải lên: 04/12/2022, 10:40
Ip 08 array of array and struct in c
... chươngchương trìnhtrình C C thaothao táctác họchọc sinhsinh nhưnhư sausau:: KhaiKhai báobáo kiểukiểu cấucấu trúctrúc họchọc sinhsinh ((nhưnhư bàibài họchọc).) NhậpNhập vàovào danhdanh sáchsách ... TínhTính tíchtích 2 ma 2 ma trậntrận vừavừa nhậpnhập b) b) TríchTrích rara danhdanh sáchsách cáccác sốsố xuấtxuất hiệnhiện ở ở cảcả 2 ma 2 ma trậntrận b) b) TríchTrích rara danhdanh sáchsách cáccác sốsố ... struct struct <<TênTên cấucấu trúctrúc>> {{ struct struct HocSinhHocSinh {{ char char hoten hoten[50]; [50]; Khai Khai báo báo biến biến cấu cấu trúc trúc:: < <Tên Tên cấu cấu
Ngày tải lên: 11/04/2023, 18:48
PROFESSIONALISM AND ETHICS IN TEACHING ppt
... teaching is a kind of science-based technology which would enable anyone to practise it,irrespective of personal characteristics or particular circumstances.But if teaching is not a science-based ... understanding of thenature of learning and pedagogy in meeting the particular and localneeds of individual children in particular educational circumstances ‘Extended professionals’, then, are inclined ... technical, aesthetic andmoral dimensions of the activity of teaching, the educational project inwhich teaching is implicated is clearly a complex matter which mightstand to be illuminated by cautious
Ngày tải lên: 30/03/2014, 02:20
Báo cáo khoa học: Amino acid limitation regulates the expression of genes involved in several specific biological processes through GCN2-dependent and GCN2-independent pathways ppt
... reverse, TTGCTCTCGTTCCAAAAGGA reverse, TACAGCTTCACCACCACAGC reverse, CCACCTGTAGGTCTGGCA reverse, CTTGTCTTCTGTGCCTGTGC reverse, TCTGTTGGAAAATCCCGTTC reverse, GAGGAACAGCAGAGAGCCTC Cxcl10 pre-mRNA ... forward, AGCAGAGGAAAATGCACCAG reverse, CACCTGGGTAAAGGGGAGTGA reverse, AGGTGCAGCAGCTTCAGTTT Dusp16 pre-mRNA forward, CAGTGCTGGAATTGTACGTGA reverse, AGTCCATGAGTTGGCCCATA reverse, AGGCCACTGACTAGGCTGAA ... GAGCAGGTCCAGGAACATTG reverse, GGGATAACTCGTCTCCACCA reverse, TGCCAATGACACTCTTGAGC reverse, TCGCCTGGGTTACTTAATGG Acknowledgements We thank Dr D Ron (New York University, NY, USA), for providing
Ngày tải lên: 07/03/2014, 03:20
Báo cáo khoa học: C-terminal truncated cannabinoid receptor 1 coexpressed with G protein trimer in Sf9 cells exists in a precoupled state and shows constitutive activity ppt
... bleaching When the acceptor protein was bleached, there was an increase in donor fluorescence The increase in donor fluorescence calculated for 10 cells was 7% ± 2% As a negative control CB1-CFP and ... Fluorescent Bodipy GTPcS binding assay (A) Specific increase in GTPcS binding to the G i1 (r) protein and not the G sL (j) protein in the presence of membranes containing the truncated cannabinoid ... Mitchell R (1995) Cannabinoids activate an inwardly rectifying potassium conductance and inhibit Q type calcium currents in AtT20 cells transfected with rat brain cannabinoid receptor J Neurosci
Ngày tải lên: 23/03/2014, 07:20
Questions to .NET and Programming in C#
... when the object is accessed. c) A static constructor can have public as a accessibility modifiers 74. class A { public static int X = B.Y + 1; } class B { public static int Y = A.X ... explicitly or implicitly. b) Static constructors can have accessibility modifiers. e) Static constructors are called when the class is loaded. c) Static constructors cannot be called ... error. c) Incompatible type for ’=’ can’t convert SubClass to SuperClass. b) No constructor matching SuperClass() found in class SuperClass d) Wrong number of arguments in constructor....
Ngày tải lên: 21/08/2012, 15:55
Question Bank Introduction to .NET and Programming in C#
... is called automatically when the object is accessed. c) A static constructor can have public as a accessibility modifiers 74. class A { public static int X = B.Y + 1; } class B { public static ... False 25. Access Modifiers for variables in C# can be the following (Select all that apply) [1.0] a) Public c) Private b) Protected d) Public protected 26. In C# , an underscore is allowed as an initial ... value c) get b) set d) find 100. public class A:B ,C, D{ } The above code represents ______ [0.5] a) multilevel interface c) multiple interface b) hierarchical interface d) multiple inheritance 101....
Ngày tải lên: 09/04/2013, 09:10
Bạn có muốn tìm thêm với từ khóa: