value mean value and the form factor of a complex wave

Báo cáo khoa học: Critical roles of Leu99 and Leu115 at the heme distal side in auto-oxidation and the redox potential of a hemeregulated phosphodiesterase from Escherichia coli pptx

Báo cáo khoa học: Critical roles of Leu99 and Leu115 at the heme distal side in auto-oxidation and the redox potential of a hemeregulated phosphodiesterase from Escherichia coli pptx

... 5¢-gatgagtcgggagTTTcag ctggagaaaaaag-3¢, 5¢-ggacccgttttgcgACCtcgaaagtgagc-3¢, and 5¢-ggacccgttttgcgTTTtcgaaagtgagc-3¢ Preparation of Ec DosH The (His)6-tagged Ec DosH proteins (wild-type and ... states of Leu mutants of Ec DOS N Yokota et al Sato A, Sasakura Y, Sugiyama S, Sagami I, Shimizu T, Mizutani Y & Kitagawa T (2002) Stationary and timeresolved resonance Raman spectra of His77 and ... whereas Ala and Asn substitutions at Asp40, an amino-acid residue that interacts via two water molecules with the proximal ligand His77, markedly increased the rate of auto-oxidation [13] (Table...

Ngày tải lên: 16/03/2014, 13:20

14 392 0
Internal Audit 2012*: A study examining the future of internal auditing and the potential decline of a controls-centric approach docx

Internal Audit 2012*: A study examining the future of internal auditing and the potential decline of a controls-centric approach docx

... States, the internationalization of accounting standards may lead to a change in the language of accounting • The growth of outsourcing and an upsurge in the offshoring of services and manufacturing ... risk assurance and thus move up the vertical axis of the Internal Audit 2012 Value Model to demonstrate more value Some proactive internal audit groups have already taken the lead in the area of ... CAE of a global defense and aerospace company that buys parts from around the world said that vendor quality and standards are of primary concern to all global companies She said that when she assesses...

Ngày tải lên: 23/03/2014, 04:20

68 456 0
Báo cáo khoa học: A possible physiological function and the tertiary structure of a 4-kDa peptide in legumes potx

Báo cáo khoa học: A possible physiological function and the tertiary structure of a 4-kDa peptide in legumes potx

... the insulin pharmacophore, IleA2-ValA3 at the A- chain N-terminus, TyrA19 at the A- chain C-terminus, and ValB12 and TyrB16 at the B-chain central helix assume essentially the same spatial arrangements ... studies revealed that a small amount of 4-kDa peptide is localized around the plasma membranes and cell walls [9] The subcellular localization of 4-kDa peptide is similar to that of the 43-kDa protein, ... 5¢-AAGAATTCTTATTATCCAGTTGGATGTATGCA GAA-3¢ The amplified sequence was cloned into the plasmid pKF18 via the EcoRI and SalI restriction sites in the multicloning site This plasmid was designated as...

Ngày tải lên: 31/03/2014, 07:20

8 389 0
EFFECTIVE THERMAL INSULATION – THE OPERATIVE FACTOR OF A PASSIVE BUILDING MODEL ppt

EFFECTIVE THERMAL INSULATION – THE OPERATIVE FACTOR OF A PASSIVE BUILDING MODEL ppt

... Thermal Insulation Improvement of Thermal Insulation by Environmental Means Amjad Almusaed and Asaad Almssad Passive and Low Energy Housing by Optimization Amjad Almusaed and Asaad Almssad 23 Energy ... Amjad Almusaed Archcrea Institute, Aarhus Denmark Part Passive Building Model and Thermal Insulation Improvement of Thermal Insulation by Environmental Means Amjad Almusaed1 and Asaad Almssad2 ... 20% of the area needs high thermal care 80% of the area needs low and middle thermal care Bath room 80% of the area needs high thermal care 20% of the area needs middle thermal care Table The...

Ngày tải lên: 28/06/2014, 17:20

112 450 0
Báo cáo khoa học: " Risk Factors for High Endoparasitic Burden and the Efficiency of a Single Anthelmintic Treatment of Danish Horses" doc

Báo cáo khoa học: " Risk Factors for High Endoparasitic Burden and the Efficiency of a Single Anthelmintic Treatment of Danish Horses" doc

... the aim of validating the questionnaire (Lendal et al 1998) Data analysis Initially bivariate analyses were performed, and variables having p-values below 0.15 were included in the multivariate ... between the logarithm of EPG pretreatment and EPG post-treatment) with standard errors (SE) and P-values from bivariate and multivariate analysis are listed Risk factors (levels) N Bivariate analysis ... estimation The confidence interval of the estimates was based on Wald’s statistics Efficiency of a single anthelmintic treatment The bivariate and the multivariate regression analyses were based...

Ngày tải lên: 12/08/2014, 15:20

8 294 0
RAMIFICATION OF THE GAUSS MAP AND THE TOTAL CURVATURE OF A COMPLETE MINIMAL SURFACE

RAMIFICATION OF THE GAUSS MAP AND THE TOTAL CURVATURE OF A COMPLETE MINIMAL SURFACE

... Jin and M Ru,Algebraic curves and the Gauss map of algebraic minimal surfaces, Differential Geom Appl., 25 (2007), 701-712 [12] Y Kawakami, R Kobayashi, and R Miyaoka, The Gauss map of pseudoalgebraic ... Dethloff and P H Ha, Ramification of the Gauss map of complete minimal surfaces in R3 and R4 on annular ends, Ann Fac Sci Toulouse Math., 23 (2014), 829-846 RAMIFICATION OF THE GAUSS MAP AND THE ... whether we may show a relation between of the ramification of the Gauss map and the total curvature of a complete minimal surface The main purpose of this article is to give an affirmative answer...

Ngày tải lên: 14/10/2015, 07:57

24 373 0
Báo cáo khoa học: The propeptide in the precursor form of carboxypeptidase Y ensures cooperative unfolding and the carbohydrate moiety exerts a protective effect against heat and pressure pot

Báo cáo khoa học: The propeptide in the precursor form of carboxypeptidase Y ensures cooperative unfolding and the carbohydrate moiety exerts a protective effect against heat and pressure pot

... proCPY The Pm value for CPY was higher than that of its unglycosylated form, though the DV and DGP values were almost the same The Pm value of proCPY was higher than that of its unglycosylated form ... In contrast, a DSC analysis of the mature form (CPY) revealed an apparently symmetrical single peak but the ratio of DHcal/ DHv was determined to be 1.74 (DHcal and DHv values were 765 and 440 ... Isolation and physicochemical properties of yeast proteinase A and C Agric Biol Chem 31, 357–367 Aibara, S., Hayashi, R & Hata, T (1971) Physical and chemical properties of yeast proteinase C Agric...

Ngày tải lên: 07/03/2014, 21:20

7 441 0
báo cáo hóa học: " The assessment of health-related quality of life in relation to the body mass index value in the urban population of Belgrade" potx

báo cáo hóa học: " The assessment of health-related quality of life in relation to the body mass index value in the urban population of Belgrade" potx

... concept and design SR participated in data integration and data analysis accuracy JM and NK were responsible for statistical analysis and data presentation MM completed the interpretation of data GSM ... consisted of a systematic sample (k BMI categorization Based on the reported data on body height and mass, BMI values were calculated as the ratio of body mass in kilograms and the square of height ... quality of life, and particularly the physical health of the individual, coincide with those of other authors who also found that overweight and obesity have a greater impact on physical rather...

Ngày tải lên: 18/06/2014, 19:20

10 536 0
báo cáo hóa học: " Factor structure and internal consistency of the 12-item General Health Questionnaire (GHQ-12) and the Subjective Vitality Scale (VS), and the relationship between them: a study from France" potx

báo cáo hóa học: " Factor structure and internal consistency of the 12-item General Health Questionnaire (GHQ-12) and the Subjective Vitality Scale (VS), and the relationship between them: a study from France" potx

... generalized to the whole elderly population of France MSY was the main investigator and analysed the data and wrote the first draft AI and CR contributed to the study design and the analysis AM ... Questionnaire (GHQ-12): translation and validation study of the Iranian version Health Qual Life Outcomes 2003, 1:66 Campbell A, Knowles S: A confirmatory factor analysis of the GHQ12 using a large Australian ... French and to examine its psychometric properties and factor structure (i.e one, two or three factors) in a sample of elderly French adults Translation and data collection The standard "forward-backward"...

Ngày tải lên: 18/06/2014, 19:20

6 531 0
Báo cáo hóa học: "INEQUALITIES INVOLVING THE MEAN AND THE STANDARD DEVIATION OF NONNEGATIVE REAL NUMBERS" doc

Báo cáo hóa học: "INEQUALITIES INVOLVING THE MEAN AND THE STANDARD DEVIATION OF NONNEGATIVE REAL NUMBERS" doc

... traces, Linear Algebra and Its Applications 29 (1980), 471–506 ´ Oscar Rojo: Departamento de Matem´ ticas, Universidad Catolica del Norte, Casilla 1280, a Antofagasta, Chile E-mail address: orojo@ucn.cl ... sequence of upper bounds on the largest Laplacian eigenvalue of a graph, Linear Algebra and Its Applications 381 (2004), 97–116 [3] H Wolkowicz and G P H Styan, Bounds for eigenvalues using traces, ... = i =1 are satisfied The convex constraints ϕi in the above necessary condition are said to be qualified if either all the functions ϕi are a ne and the set U is nonempty, or there exists a point...

Ngày tải lên: 22/06/2014, 21:20

15 322 0
Báo cáo y học: "Diagnostic value and clinical laboratory associations of antibodies against recombinant ribosomal P0, P1 and P2 proteins and their native heterocomplex in a Caucasian cohort with systemic lupus erythematosus" pot

Báo cáo y học: "Diagnostic value and clinical laboratory associations of antibodies against recombinant ribosomal P0, P1 and P2 proteins and their native heterocomplex in a Caucasian cohort with systemic lupus erythematosus" pot

... effects, hematologic malignancies and other factors Another remarkable, significant clinical laboratory association was that aRibPR1+ patients had an elevated GGT value The participation of aRibPs ... Barkhudarova et al.: Diagnostic value and clinical laboratory associations of antibodies against recombinant ribosomal P0, P1 and P2 proteins and their native heterocomplex in a Caucasian cohort ... EUROIMMIUN and were performed following the manufacturer’s instructions Statistical analysis Statistical analyses were performed using GraphPad Prism software (GraphPad Software, La Jolla, CA, USA) The...

Ngày tải lên: 12/08/2014, 15:22

11 417 0
Báo cáo y học: "HIV-1 subtype distribution in the Gambia and the significant presence of CRF49_cpx, a novel circulating recombinant form" pdf

Báo cáo y học: "HIV-1 subtype distribution in the Gambia and the significant presence of CRF49_cpx, a novel circulating recombinant form" pdf

... MO042 gag p24 OF- 1 890-909 TAGTATGGGCAAGCAGGGAG MO024 gag p24 OF- 2 508 - 527 AACCCACTGCTTAAGCCTCA MO044 gag p24 OR 2272-2252 TGCCAAAGAGTGATTTGAGGG MO043 gag p24 IF 1048-1067 TGYGTRCATCAAARGATAGA MO045 ... CAAGCATGKGTAGCCCAGAYATTATG MO188 p24 to env IF 2034 - 2060 ATGTGGGAARGARGGACACCAAATGAA MO189 p24 to env IR 6335 - 6360 TCCACACAGGTACCCCATAATAGACT MO191 5’ LTR to gag p24 OR 832 - 859 AATGCTGWRAACATGGGTATTACTTCTG ... Fajara, the Gambia, who had archived plasma samples available Patient selection was based on two criteria (see below) and PCR was attempted on a total of 53 patient samples: the first group of...

Ngày tải lên: 13/08/2014, 01:20

14 334 0
Báo cáo y học: "Parenteral versus enteral nutrition: effect on serum cytokines and the hepatic expression of mRNA of suppressor of cytokine signaling proteins, insulin-like growth factor-1 and the growth hormone receptor in rodent sepsis" pps

Báo cáo y học: "Parenteral versus enteral nutrition: effect on serum cytokines and the hepatic expression of mRNA of suppressor of cytokine signaling proteins, insulin-like growth factor-1 and the growth hormone receptor in rodent sepsis" pps

... carried out the immunoassays and AX performed the PCR studies MJO'L performed the statistical analysis MJO'L, AX and CJS helped to draft the manuscript All authors read and approved the final manuscript ... weight) (Ketalar; Parke Davis, Sydney, NSW, Australia) and sodium pentobarbitone (30 mg/kg body weight) (Nembutal; Rhone Merieux, Parramatta, NSW, Australia) and had a catheter aseptically implanted ... the lower limit of detection of the assay in all animals in the sham-operated groups and in all but one of the animals receiving EN following CLP, whereas all but one of the CLP-PN animals had...

Ngày tải lên: 13/08/2014, 08:20

8 321 0
Some register features in agreement between the united states of america and the socialist republic of vietnam on trade relations = một số đặc điểm ngữ vực trong hiệp định thương mại việt   mỹ

Some register features in agreement between the united states of america and the socialist republic of vietnam on trade relations = một số đặc điểm ngữ vực trong hiệp định thương mại việt mỹ

... affects and determines features of the language The aspect of the language used is at a degree of formality, accuracy, clearness and technicality of linguistics exchanges As the choice of vocabulary ... principles, and Result of the BTA; then this chapter makes an effort to analyze the variations of language in the BTA based on theoretical background of the former chapter This chapter also offers ... associated with the realization of ideational meanings; these ideational meanings are realized through the transitivity systems of the grammar  Mode: What role is language playing? The mode of a...

Ngày tải lên: 20/12/2013, 18:26

48 569 5
Tài liệu McGraw.Hill.Stock Options And The New Rules Of Corporate Accountability doc

Tài liệu McGraw.Hill.Stock Options And The New Rules Of Corporate Accountability doc

... shoulders I stand For his 35 years as an Arthur Andersen partner, which provided me with an example of life as a consultant and what it means to work for a meritocracy, and for his many, invaluable business ... Accounting Standards Board (IASB); Jon Najarian, options trader and principal of Mercury Trading and PTI Securities; Ronald Turner, Chairman, President and CEO of Ceridian Corp.; Nobel Laureate and economist ... that CEOs and CFOs sign off on their financial statements, making a public declaration that the facts and figures are legitimate and verified This particular requirement was passed because the...

Ngày tải lên: 21/12/2013, 01:19

225 602 2
w