using session tracking in a soap based wcf web service

Báo cáo toán học: " On transmission performance of OFDM-based schemes using MMSE-FDE in a frequencyselective fading channel" pot

Báo cáo toán học: " On transmission performance of OFDM-based schemes using MMSE-FDE in a frequencyselective fading channel" pot

... sequence is interleaved before data modulation A block interleaver used as channel interleaver in the simulation is of size 2a and 2b block interleaver, where a and b are the maximum allowable integers ... September 2001) H Gacanin, S Takaoka, F Adachi, OFDM combined with TDM using frequency-domain equalization J Commun Netw 9(1), 34–42 (2007) H Gacanin, F Adachi, PAPR advantage of amplitude clipped ... 1} One-tap MMSE-FDE [3] is applied to R(n) as s(t) Frame generation Info data JNm-point IFFT Data modulation Gacanin and Adachi EURASIP Journal on Wireless Communications and Networking 2011,...

Ngày tải lên: 20/06/2014, 21:20

10 483 0
Tài liệu Báo cáo khoa học: "Multiple Default Inheritance in a Unification-Based" pdf

Tài liệu Báo cáo khoa học: "Multiple Default Inheritance in a Unification-Based" pdf

... Lexical entries are themselves classes, and any information they contain is standardly specific to an individual word; lexical and non-lexical classes differ in that analysis and generation take ... representing default information, which we refer to as the 'main' equation set These may be overridden by eontlleting information in a more specific class Each equation in a main set functions as an independent ... property m a y override another when assigned in a main equation set, but cause failure when assigned in a variant set Normally, variant sets are defined so as to be mutually exclusive; a FS that unifies...

Ngày tải lên: 20/02/2014, 21:20

7 372 0
Tài liệu Báo cáo khoa học: "An Alignment Algorithm using Belief Propagation and a Structure-Based Distortion Model" pdf

Tài liệu Báo cáo khoa học: "An Alignment Algorithm using Belief Propagation and a Structure-Based Distortion Model" pdf

... California K Yamada and K Knight 2001 A syntax -based statistical translation model Proceedings of ACL M Collins 2003 Head-driven statistical models for natural language parsing Computational Linguistics ... Using Parallel Texts: Data Driven Machine Translation and Beyond, pages 1–10, Edmonton, Alberta, Canada, May 31 Association for Computational Linguistics Kevin P Murphy, Yair Weiss, and Michael ... http://www.isi.edu/naturallanguage/download/hansard/ D Gildea 2003 Loosely tree -based alignment for machine translation Proceedings of ACL, T Heskes 2003 Stable fixed points of loopy belief propagation are minima...

Ngày tải lên: 22/02/2014, 02:20

9 457 0
A Practitioner’s Guide: To Economic Development Tools for Regional Competitiveness in a Knowledge-Based Economy pdf

A Practitioner’s Guide: To Economic Development Tools for Regional Competitiveness in a Knowledge-Based Economy pdf

... swift transformation taking place in the global economy makes occupation cluster analysis particularly valuable The global integration of markets has eliminated many regional competitive advantages ... coatings that provide wear-resistance and water-proofing for fabrics in apparel and textiles? Chances are, the people managing apparel and textile businesses in Brown County have no idea of what ... normally fail In contrast, public investments that are the product of open participation and strategic thinking can create sustainable transformations The Who: Building a Leadership Team Capable...

Ngày tải lên: 17/03/2014, 10:20

19 778 0
Pastured Poultry Raising Chickens in a Grass-Based System docx

Pastured Poultry Raising Chickens in a Grass-Based System docx

... trailers as their place to roost • Could not be herded into the trailers easily – had to walk up narrow, steep ramp to access trailer doors • Had to be individually caught and manually placed inside ... http://www.motherearthnews.com/Real-Food/2007-1001/Tests-Reveal-Healthier-Eggs.aspx#ixzz27LvkfgLn Other Benefits of Pastured Poultry • Ethical concerns • Appealing appearance of flock to customers You’re not just marketing a product, you are marketing a way of life! Pastured ... advanced feathering – use feathering as a guide for decreasing temperature as the amount of feathering a chick has will dictate its cold-tolerance Look for signs of stress in the chicks to make sure...

Ngày tải lên: 17/03/2014, 10:20

64 274 0
Báo cáo khoa học: "Performatives in a Rationally Based Speech Act Theory*" pptx

Báo cáo khoa học: "Performatives in a Rationally Based Speech Act Theory*" pptx

... the individual rational balance agents maintain among their beliefs, goals, intentions, commitments, and actions [2] As desiderata for the theory of performatives, we demonstrate that the analysis ... of declarative mood utterances, and then the illocutionary act definitions for requesting and asserting Finally, we combine the various analyses natural language processor's task by making explicit ... understanding, that is, to achieving a state of BMB that he is in a certain mental state Below is a definition of a speaker's requesting an addressee to achieve p Definition {REQUEST spkr addr...

Ngày tải lên: 17/03/2014, 20:20

10 293 0
Báo cáo khoa học: "Multiple Interpreters in a Principle-Based Model of Sentence Processing" potx

Báo cáo khoa học: "Multiple Interpreters in a Principle-Based Model of Sentence Processing" potx

... relevant features (such as L-marking, Case, and 0) If we adhere to the representational paradigm used above, we can define Chains in the following manner: Chain Schevaa Node: C-Node: {Cat,Level,Pos,ID,Ftrs} ... a particular representation provides a formal characterisation of locality Just as phrase structure is defined in terms of branches, we can define Chains as a sequence of links More specifically, ... structures are limited to some combination of binary (non-terminal) and unary (terminal) branches As discussed above, we can characterise the representational framework in terms of nodes and schemas:...

Ngày tải lên: 18/03/2014, 02:20

6 366 0
Báo cáo khoa học: "User Expertise Modelling and Adaptivity in a Speech-based E-mail System" doc

Báo cáo khoa học: "User Expertise Modelling and Adaptivity in a Speech-based E-mail System" doc

... Message length 24 lines U: Read Sakari Rantala's message S: Third message, from Sakari Rantala, about Re: Comments about the draft [reads the message] Message read You are in the first message ... Jaana Jaakkola, the third from Sakari Rantala If you want to select a message, say for example "second message" or "Eddie Everyman's message" U: First message S: First message, from Matti Hahtomaa, ... say 'what now' Example 2: Basic information about a message that the user has chosen from a listing of messages from a particular sender DASEX = 1: First message, about "reply: sample file" DASEX...

Ngày tải lên: 23/03/2014, 19:20

8 420 0
Báo cáo khoa học: "Modifying Beliefs in a Plan-Based Dialogue Model" ppt

Báo cáo khoa học: "Modifying Beliefs in a Plan-Based Dialogue Model" ppt

... listener can implicitly convey acceptance [2] by making an utterance which cannot be interpreted as initiating a negotiation dialogue Since both parties are engaged in a cooperative dialogue in which ... accept any claims that the speaker made or to initiate a negotiation dialogue Acceptance can be communicated in two ways Either the listener can explicitly indicate acceptance (e.g., "oh, alright"), ... unrelated to the original Obtain-Info-Ref, though still related to the problem-solving action of Instantiate-Var in order to build a plan to take CIS360 Since a new discourse plan is being pursued,...

Ngày tải lên: 23/03/2014, 20:20

2 299 0
Báo cáo khoa học: "Correcting Errors in a Treebank Based on Synchronous Tree Substitution Grammar" pot

Báo cáo khoa học: "Correcting Errors in a Treebank Based on Synchronous Tree Substitution Grammar" pot

... errors in a verb modality corpus for machine translation with a machine-learning method ACM Transactions on Asian Language Information Processing, 4(1):18–37 Tetsuji Nakagawa and Yuji Matsumoto ... 1993 Building a large annotated corpus of English: the Penn Treebank Computational Linguistics, 19(2):310–330 Masaki Murata, Masao Utiyama, Kiyotaka Uchimoto, Hitoshi Isahara, and Qing Ma 2005 Correction ... translation In Proceedings of the 41st Annual Meeting of the Association for Computational Linguistics, Companion Volume, pages 205–208 Eleazar Eskin 2000 Detecting errors within a corpus using anomaly...

Ngày tải lên: 30/03/2014, 21:20

6 369 0
báo cáo hóa học:" Determinants of Treatment Access in a Population-based Cohort of HIV-positive Men and Women Living in Argentina" pdf

báo cáo hóa học:" Determinants of Treatment Access in a Population-based Cohort of HIV-positive Men and Women Living in Argentina" pdf

... (indinavir, saquinavir, lopinavir, atazanavir, or fosamprenavir) Statistical Analysis The first analysis evaluated participant characteristics associated with initiation of HAART Baseline variables ... randomized, doubleblind trial comparing combinations of nevirapine, didanosine, and zidovudine for HIV-infected patients: the INCAS Trial Italy, The Netherlands, Canada and Australia Study JAMA 1998, 279:930-937 ... initiate HAART at baseline are summarized in Table Compared with individuals who remained HAART-naive at baseline, those who initiated therapy were more likely to be older (P < 0001), have an...

Ngày tải lên: 20/06/2014, 08:20

7 398 0
Critical Inquiry in a Text-Based Environment: Computer Conferencing in Higher Education pdf

Critical Inquiry in a Text-Based Environment: Computer Conferencing in Higher Education pdf

... below, and in much more detail in Archer, Garrison, and Anderson (199 9a) Oral and Text -based Communication Traditionally, educational interactions have been based upon oral communications between and ... willingness to maintain and prolong contact, and tacitly indicate interpersonal support, encouragement, and acceptance of the initiator This type of interactive behavior is realized in CMC by using ... of a community of inquiry such that coherence and meaning are apparent As essential as cognitive presence is in an educational transaction, individuals must feel comfortable in relating to each...

Ngày tải lên: 28/06/2014, 23:20

19 316 0
Modelling Load Shifting Using Electric Vehicles in a Smart Grid Environment pdf

Modelling Load Shifting Using Electric Vehicles in a Smart Grid Environment pdf

... predictable and can be estimated from traffic and road-use data Figure indicates a typical daily travelling pattern of gasoline-driven cars in Japan It shows that 50% of gasoline-fuelled cars travel ... at: shinichi.inage.wk@hitachi.com or David Elzinga at david.elzinga@iea.org International Energy Agency Shin-ichi Inage WO R K I N G PA P E R Modelling Load Shifting Using Electric Vehicles in ... than 30 km per day, and that 30% of gasoline-fuelled cars travel less than 15 km per day Figure 5: Typical daily travelling patterns of gasoline-fuelled cars in Japan Source: Sagawa and Skaguchi,...

Ngày tải lên: 28/06/2014, 23:20

76 184 0
Báo cáo y học: "Association of MICA with rheumatoid arthritis independent of known HLA-DRB1 risk alleles in a family-based and a case control study" pps

Báo cáo y học: "Association of MICA with rheumatoid arthritis independent of known HLA-DRB1 risk alleles in a family-based and a case control study" pps

... MICA-250: AAGGTGATGGGTTCGGGAA, TCTAGCAGAATTGGAGGGAG [21], and bioCTCAGGAC(L)ACGCCGGATT For the MICA250 assay, a genotyping primer bioCTCCAGAG [L]TCAGACCTTGGC, differentiating between a paralogue ... MICA-210: CCTTTTTTTCAGGGAAAGTGC, CCTTACCATCTCCAGAAACTGC [22], and bioCCATGTTTCTGCTG(L)TGCTGCT; MICA-300: GGAAGGCTGTGCAGTAATCTAGG, TCCCTTTTCCAGCCTGCC, and bioCTGTGCAGT(L)ATCTAGGCTGAAGG; and MICA-250: ... no association of MICA-250, a two-marker haplotype consisting of MICA-25 0A and a certain HLA-DRB1 allele should have the same transmission rate as a two-marker haplotype consisting of MICA-250G...

Ngày tải lên: 09/08/2014, 14:20

11 460 0
Prevalence of severe mental distress and its correlates in a population-based study in rural south-west Uganda doc

Prevalence of severe mental distress and its correlates in a population-based study in rural south-west Uganda doc

... smoking for males and females Missing data on age at first sex for male and females Missing data on partners in past year for males and females Missing data on consulting a traditional healer ... (67.5%) Missing marital status for male and female Missing data on education for males and females Missing SES index for 45 males and 69 females Missing data on current smoking for males, and on ever ... literacy are low and the main income-earning activities are growing bananas, coffee and beans, and trading fish [18] HIV seroprevalence reported in this study is a representation of the national...

Ngày tải lên: 11/08/2014, 15:22

9 253 0
Báo cáo y học: "Does an increase in body mass index over 10 years affect knee structure in a population-based cohort study of adult women" pot

Báo cáo y học: "Does an increase in body mass index over 10 years affect knee structure in a population-based cohort study of adult women" pot

... identification and time sequence Medial and lateral tibial plateau bone area was summed to obtain tibial plateau bone area CV have been assessed for the medial and lateral tibial plateau, and found ... increase in BMI adjusted for age, tibial plateau area Odds of tibiofemoral cartilage defects per unit increase in BMI adjusted for age, tibial plateau area, and baseline BMI Odds of bone marrow ... 3220, Australia Authors’ contributions SLB, FMC and AEW conceived and designed the study SLB, MJH, JAP, MAK, GCN and AEW had the major role in analysis and interpretation of the data and in drafting...

Ngày tải lên: 12/08/2014, 14:22

7 255 0
Báo cáo y học: " Associations between respiratory symptoms, lung function and gastro-oesophageal reflux symptoms in a population-based birth cohort" docx

Báo cáo y học: " Associations between respiratory symptoms, lung function and gastro-oesophageal reflux symptoms in a population-based birth cohort" docx

... written informed consent was obtained at each assessment The association between gastro-oesophageal reflux and asthma could have several explanations [4] Reflux may precipitate asthma, either via a ... 13, 15 and 21 years using a Godart water-sealed spirometer At age 18 years spirometry was performed before and after nebulised salbutamol using a Morgan rolling seal spirometer At age 26 years, ... methacholine challenge was not undertaken (at ages 18 and 26), or if a low FEV1 precluded testing at other ages for safety reasons, an increase in FEV1 of 10% or greater after inhaling salbutamol...

Ngày tải lên: 12/08/2014, 16:20

9 217 0
SKKN using teaching aids in a language class

SKKN using teaching aids in a language class

... are teaching aids ? Definition: According to Peter Wingard in Teaching English as an international Language – A Practical Guide – teaching aids are any thing from a detailed syllabus, a text ... convinient and effective use in a language class Tæ KHXH – English Group Using teaching aids in a language class – By Truong Quang Khanh  Audio-visual aids: Audio visual aids are the combination ... Now say “walking“ Tæ KHXH – English Group Using teaching aids in a language class – By Truong Quang Khanh Sts: Walking, walking T: Are you walking now ? Sts: No, we aren’t We are sitting at the...

Ngày tải lên: 04/12/2014, 12:26

11 421 0
Entrepreneurial universities in a knowledge based economy the case of national university of singapore

Entrepreneurial universities in a knowledge based economy the case of national university of singapore

... chemical base pairs that make up human DNA and storing this information in databases perhaps only at the conceptual stage, as well as numerous opportunities for income in various areas such as medicine, ... importance and rapid pace of innovation, traditional forms of academiaindustrial relations, such as consulting and liaison programs, have taken on a more intensive, formal institutional ties such as ... firms are an important source of innovation and even have an advantage over large established firms in emerging areas where demand patterns are unclear, risks are large, and the technology base has...

Ngày tải lên: 05/10/2015, 21:24

179 554 0
Road detection using intrinsic colors in a stereo vision system

Road detection using intrinsic colors in a stereo vision system

... while some fast classification methods are used to remove vegetation in the training area 4.3.1 Training area The training area is a small area defined in the image Since road color samples will ... function A crucial parameter of this method is the angle of invariance θ Originally, this angle was obtained via a calibration procedure, involving using the calibrated camera to capture images in ... Brightness-invariant feature [20] Remarks Invariant to brightness Invariant to brightness Invariant to brightness Not invariant to intra-image changes, e.g shadows Not invariant to intra-image changes,...

Ngày tải lên: 16/10/2015, 15:38

98 496 0
w