using isa server as a firewall

Experimental investigation on a flat plate solar collector using al2o3 nanofluid as a heat transfer agent

Experimental investigation on a flat plate solar collector using al2o3 nanofluid as a heat transfer agent

... Al2O3 Nanofluid as a heat transfer agent Abbas Sahi Shareef, Mohammed Hassan Abbod, Sura Qahtan Kadhim Department of Mechanical Engineering, Karbala University, Karbala, Iraq Abstract This work ... temperature stopped increasing and decreased so the temperature difference reached from max value to 4.8 ̊ C and increased again as solar irradiance reaches about 847 W/m2 An infrared image shown ... outlet and all temperatures were measured every five seconds Whereas the value of the solar radiation intensity was recorded as an average over 5 minutes intervals, the ambient temperature was with

Ngày tải lên: 09/09/2015, 10:06

14 313 0
Stimulating denitrifcation in a marine recirculating aquaculture system bioflter using granular starch as a carbon source

Stimulating denitrifcation in a marine recirculating aquaculture system bioflter using granular starch as a carbon source

... was maintained with a salinity of 17 ppt and was operated as described previously (Tal et al 2003) Low organic load filter beads were collected from a separate nitrification MBB unit that was ... nitrate-removing activity), beads were distributed equally into roller tubes and nitrate removal was measured after addition of acetate, soluble starch, and granular corn, wheat and rice starches ... found that granular starches (corn, wheat, and rice) were as effective in supporting denitrification as glucose and acetate, and furthermore, maintained significant potential for nitrate removal long

Ngày tải lên: 27/09/2019, 10:31

19 102 0
Using the pond as a biofilter review of theory and practice

Using the pond as a biofilter review of theory and practice

... investment and in operation As an example, we can compare wastewater treatment plants' required biofiltration capacity Taking an average chemical oxygen demand (COD) in raw municipal wastewater as 600 ... 600 mg/I and wastewater production of 300 l/capita x day, we get a COD release of 180g/capita x day A town of 10,000 inhabitants has to treat 1800 kg COD/day In an equivalent fish farm, about 20kg ... the standards and demands in fish water treatment are generally higher than in wastewater treatment The latter releases treated water having more than 10 mg total ammonia nitrogen (TAN) per liter,

Ngày tải lên: 27/09/2019, 10:32

12 61 0
Using mind mapping as a transition from receptive to productive skills for second degree learners

Using mind mapping as a transition from receptive to productive skills for second degree learners

... individual ideas can be supported logically and adequately, their ideas will be chosen As can be seen from the example above, a mind map maker can also make use of smart arts which are already available ... They are always organized around a single central idea.” (Guerro & Ramos, 2015: 3) Then, a mind map can also be simply defined as a diagram created in the mind mapping process Please have a ... inputting language items would mainly serve as a recap and checking organization tool, and from the organization of the ideas of the input language, learners would aim at the next stage of integrated

Ngày tải lên: 17/01/2020, 15:05

19 44 0
Using narrative inquiry as a research method patricie mertova, leonard webaster, routledge, 2020 scan

Using narrative inquiry as a research method patricie mertova, leonard webaster, routledge, 2020 scan

... contribution as an educational research method and its application across nar-a bronar-ad rnar-ange of nar-acnar-ademic disciplines Finnar-ally, the fourth question – ‘Does nnar-arrnar-a-tive provide a ... Education. USING NARRATIVE INQUIRY AS A RESEARCH METHOD Trang 4Patricie Mertova and Leonard WebsterUSING NARRATIVE INQUIRY AS A RESEARCH METHOD An Introduction to Critical Event Narrative Analysis ... potential pitfalls Narrative as an alternative approach to research: contemporary research issues By proposing narrative inquiry as an alternative research method, we are by no means attempting

Ngày tải lên: 28/07/2020, 00:21

155 26 0
Sustainable biofuel production using lignocellulosic biomass as a raw material

Sustainable biofuel production using lignocellulosic biomass as a raw material

... several environmental issues as well as lowering of fuel prices Generally rice, wheat, corn straws as well as sugarcane bagasse considered as a major agro-waste feedstock for biofuel production Agricultural ... because they are adaptable for the dry areas and this is the main advantage These plants will not cover those land areas which can be used for basic agricultural production (Gheewala et al., 2012) ... Petroleum and Minerals, Dhahran, Saudi Arabia Handbook of MTBE and Other Gasoline Oxygenates, 16 Amin, S (2009) Review on biofuel oil and gas management, 50(7), 1834-1840 Ananda, N., Vadlani, P V., &

Ngày tải lên: 20/09/2020, 20:16

12 35 0
Toxicity assessment of small molecules using the zebrafish as a model system sinh học

Toxicity assessment of small molecules using the zebrafish as a model system sinh học

... - actin Housekeeping gene CAGACATCAGGGAGTGATGG ATGGGGTATTTGAGGGTCAG ef1α Housekeeping gene ACATGCTGGAGGCCAGCTC TACCCTCCTTGCGCTCAATC hsp70 Stress indicator CCGAAGAGAAGCGACTTGAC GCGATTCCTTTTGGAGAAGAC ... CCGAAGAGAAGCGACTTGAC GCGATTCCTTTTGGAGAAGAC foxd3 Autonomic nervous mbpa Myelin sheath CCGTCGTGGAGACGTCAA CGAGGAGAGGACACAAAGCT vegfr2 Blood vasculature Subsequently, cDNA was amplified using the SensiMix ... scientific and legal attention Its advantages including rapid development, high availability, and easy observation have made the model amenable to high-throughput assays Moreover, as a complex and independent

Ngày tải lên: 17/03/2021, 19:00

58 7 0
Using mind mapping as a transition from receptive to productive skills for second degree learners

Using mind mapping as a transition from receptive to productive skills for second degree learners

... individual ideas can be supported logically and adequately, their ideas will be chosen As can be seen from the example above, a mind map maker can also make use of smart arts which are already available ... They are always organized around a single central idea.” (Guerro & Ramos, 2015: 3) Then, a mind map can also be simply defined as a diagram created in the mind mapping process Please have a ... inputting language items would mainly serve as a recap and checking organization tool, and from the organization of the ideas of the input language, learners would aim at the next stage of integrated

Ngày tải lên: 18/03/2021, 08:07

19 8 0
Using mind-mapping as a transition from receptive to productive skills for second-degree learners

Using mind-mapping as a transition from receptive to productive skills for second-degree learners

... individual ideas can be supported logically and adequately, their ideas will be chosen As can be seen from the example above, a mind map maker can also make use of smart arts which are already available ... They are always organized around a single central idea.” (Guerro & Ramos, 2015: 3) Then, a mind map can also be simply defined as a diagram created in the mind mapping process Please have a ... inputting language items would mainly serve as a recap and checking organization tool, and from the organization of the ideas of the input language, learners would aim at the next stage of integrated

Ngày tải lên: 14/05/2021, 07:43

19 12 0
Using partners talks as a kind of homework to perform communicative tasks for 10 graders

Using partners talks as a kind of homework to perform communicative tasks for 10 graders

... do the task - Teacher sets the deadline for the whole class Model: An roleplay between Dat and Mai Anh class 10A1: ( At the school gate) Dat: Hey, Mai Anh! Mai Anh: Hi! Dat: Where are you ... homework after lesson A Reading. Aim: Help students have chance to improve communicative skills and understand more about a typical day in the life of a partner’s parents Preparation: Teacher prepares ... her? Dat: Uhmm She really likes hand bags Mai Anh: Ah, I know a shop which has just been opened It has many kinds of new hand bags Dat: Wonderful! Let’s go! Example 2: Unit 4: SPECIAL EDUCATION

Ngày tải lên: 21/05/2021, 22:12

34 1 0
Using mind mapping as a tool to systematically revise english grammar for the 12th form students in cam ba thuoc high school

Using mind mapping as a tool to systematically revise english grammar for the 12th form students in cam ba thuoc high school

... The reality of teaching grammar in every high school. In the course of a traditional high school English grammar class, teachers always play as the main speaker explaining the grammatical rules ... aims It is advisable that grammar should be taught in some main parts of grammatical items such as: tense, passive voice, reported speech….so that the students can have easier revision of what ... potential A Mind map is a diagram which is used to visually organize information It is often created around a single concept, drawn as an image in the center of a blank page, related to representations

Ngày tải lên: 21/05/2021, 22:30

17 9 0
SKKN using partners talks as a kind of homework to perform communicative tasks for 10 graders

SKKN using partners talks as a kind of homework to perform communicative tasks for 10 graders

... do the task - Teacher sets the deadline for the whole class Model: An roleplay between Dat and Mai Anh class 10A1: ( At the school gate) Dat: Hey, Mai Anh! Mai Anh: Hi! Dat: Where are you ... homework after lesson A Reading. Aim: Help students have chance to improve communicative skills and understand more about a typical day in the life of a partner’s parents Preparation: Teacher prepares ... her? Dat: Uhmm She really likes hand bags Mai Anh: Ah, I know a shop which has just been opened It has many kinds of new hand bags Dat: Wonderful! Let’s go! Example 2: Unit 4: SPECIAL EDUCATION

Ngày tải lên: 24/05/2021, 18:12

34 4 0
Tài liệu Module 4: Configuring ISA Server as a Firewall ppt

Tài liệu Module 4: Configuring ISA Server as a Firewall ppt

... Overview Using ISA Server as a Firewall Examining Perimeter Networks and Templates Configuring System Policies Configuring Intrusion Detection and IP Preferences Lesson: Using ISA Server as a Firewall ... Implementing ISA Server 2004 as a Firewall What Is a TCP/IP Packet? Network Interface Layer Internet Layer Transport Layer Application Layer Destination Address: 0003FFD329B0 Source Address: 0003FFFDFFFF ... What Is System Policy? System policy is: A default set of access rules applied to the ISA Server to enable management of the server A set of predefined rules that you can enable or disable as...

Ngày tải lên: 27/02/2014, 05:20

31 471 0
Configuring a gateway to gateway VPN is easy using ISA Server

Configuring a gateway to gateway VPN is easy using ISA Server

... interface to obtain a certificate for the remote ISA/ VPN server because the remote ISA/ VPN server is not a member of the domain The remote ISA/ VPN server in this lab is configured as a standalone server ... of the Certificate Server Click Next On the Data Storage Location page, accept the defaults for where you want to put the Certificate database and Certificate Database Log You have the option ... server that is a member of a workgroup Note that it is not required that the remote ISA/ VPN server be a standalone server that is a member of a workgroup and obtain a machine certificate later We...

Ngày tải lên: 18/10/2013, 14:15

38 373 0
Windows as a Firewall

Windows as a Firewall

... password attacks against a Windows NT server at a rate of one password attempt per second (and at about 50 per second on a workstation) Assume that a hacker actually wanted to compromise the administrative ... implementations attach to each message a time stamp that must be valid to within a few minutes or the message is assumed to be an attempt at a replay attack Kerberos also allows authentication to take ... per−interface basis Network load balancing allows a group of servers to provide services using the same public IP address and share the load on a fair share basis You can assign various load weights...

Ngày tải lên: 29/09/2013, 13:20

15 335 0
Configuring Ubuntu Server As a Mail Server

Configuring Ubuntu Server As a Mail Server

... The advantage of Postfix being a modular mail server is that it is easier for the C HA P TER 10 CONFIGURING UBUNTU SERVER AS A MAIL SERVER administrator to manage all individual programs that comprise ... Postfix mail server The disadvantage is that, as an administrator, you need to know how all these separate programs function Wietse Venema originally developed Postfix as a mail server that would ... to your mailbox Summary This chapter explained the basics of how to set up Ubuntu Server as a mail server You learned how to configure Postfix as an easy-to-maintain MTA that exchanges mail with...

Ngày tải lên: 19/10/2013, 02:20

32 384 0
Configuring Ubuntu Server As a VPN Server

Configuring Ubuntu Server As a VPN Server

... vars Makes Passing the Appropriate Parameters Easier when Generating the CA C HA P TER 12 CONFIGURING UBUNTU SERVER AS A VPN SERVER After making sure that the file contains the appropriate parameters, ... commands Listing 12-2 Generating the Certificate Authority with the easy-rsa Scripts Creating Server Keys At this point the CA is available and you can generate keys The following command creates ... can start it using its script: After a successful start, you now have a interface at the client as well By monitoring this interface, you can get more details about the VPN connection, such as...

Ngày tải lên: 19/10/2013, 02:20

18 442 0
Using eliciting question as a technique to teach english to 11th form pupils

Using eliciting question as a technique to teach english to 11th form pupils

... their own ideas, their information, their available knowledge and basing on that the learners can understand the lesson and practice using the language better 1.3 Summary This chapter has been concerned ... understand the whole text such as a funny story Example: A tourist visiting a pub was fascinated by a stuffed lions head mounted on a mahogany plaque above a door behind the bar Is there a story ... attractive and more interesting and make pupils more motivated Eliciting questions are also a mean to check up and to give teachersnecessaryinformation such as: which parts pupils have already...

Ngày tải lên: 27/12/2013, 20:26

36 644 0
Tài liệu Configuring ISA Server 2000 Building Firewalls for Windows 2000 docx

Tài liệu Configuring ISA Server 2000 Building Firewalls for Windows 2000 docx

... certification ISA Server achieved the ICSA Labs Certification in January of 2001.The speed at which Microsoft was able to achieve ICSA certification was unusually fast As a result of the ICSA certification ... to an Array Member: A Walkthrough Performing the Enterprise Initialization Backing Up a Configuration and Promoting a Standalone Server to an Array Member Changes Made After ISA Server Installation ... on same machine Internal Network IDs and the Local Address Table ISA Server Features Installation Performing the Installation Installing ISA Server: A Walkthrough Upgrading a Standalone Server...

Ngày tải lên: 24/01/2014, 10:20

961 401 0
Báo cáo khoa học nông nghiệp " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " pptx

Báo cáo khoa học nông nghiệp " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " pptx

... plot, and the small black ant, Tapinoma melanocephalum that was abundant on the remaining trees of the plot The Crematogaster ants were nesting on cashew tree branches and the small black ant were ... draft training program was revised and finalised accordingly GAP Workshop in Binh Thuan (21-22/7/2008) Baseline survey Farmers’ opinion towards the cashew IPM program using weaver ants as a major ... of ants Examination of the ant nests the next day showed that almost all the crematogaster ants were dead in their nests, including queen ants, and that the small black ant activity was greatly...

Ngày tải lên: 21/06/2014, 05:20

10 553 1
w