using an old iphone 3gs as a ipod touch

Using the National Collegiate Conference as a focal point for an AITP student chapter’s annual activities

Using the National Collegiate Conference as a focal point for an AITP student chapter’s annual activities

... because they do not understand what it is for Instead, the users select an index or a database and are taken to a data-base’s login page for which they do not have a username and password to gain ... Trang 1Using the National Collegiate Conference as a focal point for an AITP student chapter’s annual activities Johnny Snyder josnyder@mesastate.edu Gayla Jo Slauson gslauson@mesastate.edu ... There are many benefits to the establishment and explo-ration of an annual theme and the educa-tional component of AITP student chapter meetings The annual theme can revolve around issues and

Ngày tải lên: 17/10/2022, 23:59

21 6 0
Báo cáo khoa học: "An evaluation of decapitation as a method for selecting clonal Quercus petraea (Matt) Liebl with different branching intensities" ppt

Báo cáo khoa học: "An evaluation of decapitation as a method for selecting clonal Quercus petraea (Matt) Liebl with different branching intensities" ppt

... conditions, data for plants grown in the growth chambers, the nursery and the field have been analysed separately The effects of clones and treatments were investigated by analysis of vari-ance As previous ... with large branches is difficult to suppress whilst main-taining an acceptable combination of height and diameter growth An important part of our oak improvement programme aims to gain a better ... leader and the 4 major crown equiva-lent to those of the experimental plants, are also (fig 1). Statistical analysis and presentation of data Due to the large differences in experiment times and

Ngày tải lên: 08/08/2014, 19:21

14 240 0
Using the flipped classroom model as a vocabulary teaching aid for the new ‘tiếng anh 11’ to enhance EFL learning of students at a high school in ha noi

Using the flipped classroom model as a vocabulary teaching aid for the new ‘tiếng anh 11’ to enhance EFL learning of students at a high school in ha noi

... sources of vocabulary Vocabulary Trang 122 learning is an important and indispensable part of any language learning process Second or foreign language vocabulary acquisition has been an increasingly ... oral and print language and in productive and receptive forms Teaching language cannot be separated with teaching vocabulary Vocabulary is considered as an important component in English language ... enables language use and, conversely, language use leads to an increase in vocabulary knowledge In English as a second language (ESL) and English as a foreign language (EFL), learning vocabulary items

Ngày tải lên: 20/08/2020, 14:23

98 69 1
(LUẬN văn THẠC sĩ) using the flipped classroom model as a vocabulary teaching aid for the new ‘tiếng anh 11’ to enhance EFL learning of students at a high school in ha noi

(LUẬN văn THẠC sĩ) using the flipped classroom model as a vocabulary teaching aid for the new ‘tiếng anh 11’ to enhance EFL learning of students at a high school in ha noi

... responses across four key areas: Task Achievement, Coherence and Cohesion, Lexical Resource, and Grammatical Range and Accuracy These criteria serve as the foundation for assessing and marking students' ... Students watch vodcasts or listen to podcasts and then complete activities in class (24-27) Just as effective as traditional classrooms quantitatively and perhaps more effective based on anecdotal ... there is a complementary relationship between vocabulary knowledge and language use; understanding vocabulary enhances language application, while using the language helps expand vocabulary In

Ngày tải lên: 28/06/2022, 10:00

98 12 0
using-the-e-in-stem-as-a-catalyst-for-science-and-mathematics-curriculum-reform-in-a-large-school-district

using-the-e-in-stem-as-a-catalyst-for-science-and-mathematics-curriculum-reform-in-a-large-school-district

... relevant today through hands on and practical applications They address STEM content and practices that fill gaps between state-mandated and tested content and what business and industry say they ... on applied problem solving, mathematics education, and assessment and evaluation He teaches graduate courses in learning, assessment, research methods, and data analysis He currently is the lead ... James Van Haneghan is professor of Professional Studies and director of Assessment and Evaluation in the College of Education at the University of South Alabama His research over the years has

Ngày tải lên: 20/10/2022, 13:08

11 3 0
repatriation of an old fish host as an opportunity for myxozoan parasite diversity the example of the allis shad alosa alosa clupeidae in the rhine

repatriation of an old fish host as an opportunity for myxozoan parasite diversity the example of the allis shad alosa alosa clupeidae in the rhine

... , 36 ] Black Sea H caspialosum (Dogiel & Bychovsky, 1939) (syn Sphaerospora caspialosae) Alosa caspia caspia (Eichwald, 1838) [ 32 ] b Peninsula Sara, Caspian Sea, Azerbaijan Renal tubules ... [35] and Naidenova [36] refer to a different parasite species in the anchovies One could suspect a similar case for H caspialosumwhich was described from the Caspian shad Alosa caspia caspia (Eichwald, ... listed 16 species of Alosa native to the northern hemisphere and distributed through the western and eastern Atlantic coasts, the Mediterranean, Black and Caspian Seas, as well as Lake Volvi (Greece)

Ngày tải lên: 04/12/2022, 16:21

13 2 0
Luận văn thạc sĩ VNU ULIS using the flipped classroom model as a vocabulary teaching aid for the new ‘tiếng anh 11’ to enhance EFL learning of students at a high school in ha noi

Luận văn thạc sĩ VNU ULIS using the flipped classroom model as a vocabulary teaching aid for the new ‘tiếng anh 11’ to enhance EFL learning of students at a high school in ha noi

... oral and print language and in productive and receptive forms Teaching language cannot be separated with teaching vocabulary Vocabulary is considered as an important component in English language ... enables language use and, conversely, language use leads to an increase in vocabulary knowledge In English as a second language (ESL) and English as a foreign language (EFL), learning vocabulary items ... language teaching and learning According to Thornbury (2002), vocabulary is a crucial aspect in learning a language as languages are based on words While Walters (2004) states that it is practically

Ngày tải lên: 06/12/2022, 09:13

98 56 0
Luận văn thạc sĩ Kỹ thuật hóa học: Investigation of synthesis conditions for silver nanoparticles@graphene oxide using mangifera indica leaf extract as a reducing agent for the application in colorimetric detection of H2O2

Luận văn thạc sĩ Kỹ thuật hóa học: Investigation of synthesis conditions for silver nanoparticles@graphene oxide using mangifera indica leaf extract as a reducing agent for the application in colorimetric detection of H2O2

... K Anandalakshmi, J Venugobal, and V Ramasamy, “Characterization of silver nanoparticles by green synthesis method using Pedalium murex leaf extract and their antibacterial activity,” Appl Nanosci, ... anticancer, and antibacterial traits of Punica granatum peel extracts-mediated Ag and Ag/GO nanocomposites.,” Microsc Res Tech, vol 85, no 1, pp 44–55, Jan [47] S Basiri, A Mehdinia, and A Jabbari, ... Khoshnamvand, P Liu, C.-G Yuan, and W Cao, “Eco-friendly approach for biosynthesis of silver nanoparticles using Citrus maxima peel extract and their characterization, catalytic, antioxidant and antimicrobial

Ngày tải lên: 25/09/2024, 14:43

132 1 0
Luận văn using the flipped classroom model as a vocabulary teaching aid for the new ‘tiếng anh 11’ to enhance efl learning of students at a high school in ha noi

Luận văn using the flipped classroom model as a vocabulary teaching aid for the new ‘tiếng anh 11’ to enhance efl learning of students at a high school in ha noi

... enables language use and, conversely, language use leads to an increase in vocabulary knowledge In English as a second language (ESL) and English as a foreign language (FFI), learning vocabulary ... oral and print language and in productive and receptive forms Teaching language cannot be separated with teaching vocabulary Vocabulary is considered as an important component in English language ... language teaching and learning According to ‘thornbury (2002), vocabulary is a crucial aspect in leaming a language as languages are based on words While Walters (2004) states that it is practically

Ngày tải lên: 19/05/2025, 21:28

97 0 0
(Đồ án HCMUTE) charaterization of bacterial cellulose produced by gluconacetobacter xylinus using rice extract as a nutrient source

(Đồ án HCMUTE) charaterization of bacterial cellulose produced by gluconacetobacter xylinus using rice extract as a nutrient source

... spontaneously at the coconut water/air interface Nata de coco, a Filipino dish, has gained popularity throughout many other Asian nations The "Nata" bacteria was later identified as Acetobacter ... surface areas, great water holding capacity, well-developed liquid/gas permeability, outstanding mechanical qualities, and transparency [117, 118] BC is a particularly special material that shows ... cellulose-based packaging and wrapping films and coatings are of particular commercial importance (C Chang & Zhang, 2011) Additionally, it has been demonstrated that these films and coatings

Ngày tải lên: 08/05/2023, 17:39

106 5 0
Using role play as a teachnique to improve the tenth graders speaking skill at an upper secondary school in dong nai province (master of tesol)

Using role play as a teachnique to improve the tenth graders speaking skill at an upper secondary school in dong nai province (master of tesol)

... CLT regards language as a system for meaning expression, emphasizing activities that involve oral communication, meaningful tasks, and relevant language use tailored to learners' needs Nunan highlights ... overly complex language, which can lead to more debate and improve engagement.In CLT (Communicative Language Teaching), the teacher plays a crucial role as both a facilitator and an advisor, guiding ... matter Meanwhile, quantitative data is collected using questionnaires, as well as pre-test and post-test assessments, to measure changes and outcomes effectively This integrated approach enhances

Ngày tải lên: 07/08/2023, 17:08

83 2 0
An investigation into english teachers practices of using individual development plan as a tool for their professional development at tien giang university

An investigation into english teachers practices of using individual development plan as a tool for their professional development at tien giang university

... planned in advance An individual development plan can outline what Trang 15career goals a teacher wants to accomplish and what steps he can take to meet those goals An IDP can be a useful tool ... because it is a response to a past experience and involves conscious recall and examination of the experience as a basic for evaluation and decision-making and as a source for planning and action ... employee and the organization” (http://www.fsa.usda.gov/FSA/hrdapp?area=home&subject=trai&topic=idp) Third, as an English teacher, I find individual development plan has a significant meaning

Ngày tải lên: 30/08/2023, 18:08

101 4 0
An investigation into the acceptance of using grammarly as an automated writing evaluation tool a case study in english majored students at banking academy

An investigation into the acceptance of using grammarly as an automated writing evaluation tool a case study in english majored students at banking academy

... Faculty of Foreign Languages at the Banking Academy to assess their views on Grammarly as an Automated Writing Evaluation (AWE) tool Data was gathered via an online questionnaire to gain insights into ... five essential steps: prewriting, planning, drafting, pausing and reading, and revising and editing, as highlighted by Abas and Abd Aziz (2018) Importantly, feedback plays a crucial role in the ... faced by teachers due to larger class sizes and the increasing demand for personalized assistance.6 automated essay evaluation presents itself as a cost-effective method to either replace or augment

Ngày tải lên: 05/12/2024, 14:08

60 2 0
Using eliciting question as a technique to teach english to 11th form pupils

Using eliciting question as a technique to teach english to 11th form pupils

... information collection. My warmest thanks are due to my loving family, my friends for all thing they have done for me. Finally, I am all to aware that despite all the advice and assistance, I ... “Using eliciting questions as a technique to teach English to 11th form pupils” is an attempt to provide a basic understanding about English questions and questioning techniques. The advantages ... each country that wants to join in the world community to exchange trade and technology as well as other fields and learn from the others, has to carry out open-door policies. In that process, English,

Ngày tải lên: 27/12/2013, 20:26

36 644 0
Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc

Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc

... Quang  Tri  is  ranging  from  200C to 250 C, in which the highest and lowest  temperature  usually  happens  on  July  and  January, respectively.   Quang  Tri  has  a  total  annual  rainfall  ... Trang 1Using multi‐criteria analysis as a tool to select the feasible  measures for sustainable development of brackish water  shrimp culture in Quang Tri Province  Nguyen Tien Giang1, *, Tran Anh Phuong ... of  variation  [3].  Based  on  this  general  direction,  a  number  of  methods  have  been  developed  and  applied.  Each  of  them  has  its  own  advantages  and  disadvantages.  Table 

Ngày tải lên: 22/03/2014, 12:20

13 489 0
Public management as a social science or a business subject in a   luận án tiến sỹ của tác giã nước ngoài liên quan đến đề tài về kiểm toán

Public management as a social science or a business subject in a luận án tiến sỹ của tác giã nước ngoài liên quan đến đề tài về kiểm toán

... unemployment had increased; water was scarce and wasted through poor management of sanitation and infrastructure; average life expectancy was declining; education outcomes are poor; safety and security ... as an academic discipline and whether it should be registered and presented as an academic qualification within the standard qualification programme and qualification... and extended debate ... programme management, human resources management, information management, information technology, organizational development and behaviour and... exports; and dominance, dependence and vulnerability

Ngày tải lên: 02/04/2014, 00:13

25 500 0
Báo cáo sinh học: " Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide" pptx

Báo cáo sinh học: " Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide" pptx

... GGTGATATCGTGATRACMCARGATGAACTCTC Kappa 2 GGTGATATCWTGMTGACCCAAWCTCCACTCTC Kappa 3 GGTGATATCGTKCTCACYCARTCTCCAGCAAT C region kappa primer TGGTGGGAAGATGGA Signal sequence/framework primers Gamma 1 GAGGTGAAGCTGCAGGAGTCAGGACCTAGCCTGGTG ... anti-gD preparations, an impor-tant advantage if they are to be used clinically The specific nature of anti-herpes scFv and the ability to choose an inert formulation has two potential advantages over ... total bacterial lysate; lane 2, nickel column flow through; lanes 3 and 4, saline washes; lane 6, eluate from Ni beads; lane 7, bacterial supernatant; lane 8, scFv remaining on nickel column after

Ngày tải lên: 18/06/2014, 22:20

10 541 0
báo cáo hóa học: " Intention as an indicator for subjective need: A new pathway in need assessment" doc

báo cáo hóa học: " Intention as an indicator for subjective need: A new pathway in need assessment" doc

... regression analysis at t-1 was used as additional covariate The last analysis was focused on the association between health factors and participation This result has to be taken into account for ... current analysis. RP participated at data acquisition and data preparation for the current analy-sis. TU participated in the design of the study and at the data preparation. JB participated at the ... regression analysis based on participation as out-come variable showed a similar pattern of results Psy-chological distress among female teachers indicated by GHQ-12 and MBI-EE was associated with participation

Ngày tải lên: 20/06/2014, 00:20

10 367 0
Báo cáo khoa học nông nghiệp " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " pptx

Báo cáo khoa học nông nghiệp " Implementation of the IPM program using weaver ants as a major component for cashew growers in Vietnam " pptx

... Vietnam, and the government has designated cashew development as a national priority. The area growing cashew is about 430000 ha located in Central Highlands, South Central Coast and South East ... the crematogaster ant, Crematogaster sp. with large numbers occupying one third of the trees in the IPM plot, and the small black ant, Tapinoma melanocephalum that was abundant on the remaining ... provinces with a standard questionnaire. The survey concentrated on current cashew husbandry practices, assessment of cashew production, labour use and costs, pest and disease practices and assessment

Ngày tải lên: 21/06/2014, 05:20

10 553 1
Card Project VIE: Implementation of the IPM Program Using Weaver Ants as a Major Component for Cashew Growers in Vietnam - MS4" pdf

Card Project VIE: Implementation of the IPM Program Using Weaver Ants as a Major Component for Cashew Growers in Vietnam - MS4" pdf

... of competitive species of ants, identification of weaver ant colonies, transplantation of the ants into cashew orchards, and management and maintenance of the weaver ant colonies Under the supervision ... queen ants, and that the small black ant activity was greatly reduced Seven days later after this baiting, weaver ant colonies were transplanted into this plot Determination of weaver ant colonies ... baseline survey, most cashew orchards in Vietnam have no weaver ants due to frequent insecticide spray Thus, we assumed that to use weaver ants, farmers would have to transplant many weaver ant

Ngày tải lên: 21/06/2014, 06:20

12 532 1
w