using a wireless home networking system

Informing physicians using a situated decision support system: Disease management for the smart city

Informing physicians using a situated decision support system: Disease management for the smart city

... support system: Disease management for the smart city Raafat George Saade* John Molson School of Business Concordia University, Montreal, Canada E-mail: raafat.saade@concordia.ca Rustam Vahidov ... Functionality of clinical information systems have grown from rudimentary data entry and retrieval on an intra-hospital basis, to real-time data retrieval, multi-user data entry, multi-access data ... data entry and retrieval on an intra-hospital basis, to real-time data retrieval, multi-user data entry, multi-access data retrieval, knowledge sharing, sophisticated consultation, patient and

Ngày tải lên: 10/01/2020, 07:17

22 35 0
genome modifications and cloning using a conjugally transferable recombineering system

genome modifications and cloning using a conjugally transferable recombineering system

... TGGGGCAGTTGATGAAACATCGCGCAGCCTGCCGGCCCCACATGGCCTCGACAGCCGCTAGTAGACTTCCGTTGAACT Li-CatR CCCTTTTATTATCTACCCAAGATATATGGTAATCTGCAGAAATTATGCTAGGAATGCATGGCCTAATGAGTGAGCTAA O_2RecF T*C*T*G*AGCGTAATCCATAGTCAAACCAGAAATTTTAAATTTAAGGATGTTGAATTTTGTAGACTTCCGTTGAACT ... GTTCAAAAAATTCCCGATGGAATCAAATTAGGCAGTGGCAGGTGTCAAAACATATGAATATCCTCCTTAGT ML44-RedF ATGCTTACAACAAAAAATATGCCAGCCAATGCTGGGCTGGCAGCGTTTTCTGGTGTAGGCTGGAGCTGCTTC ML44-RedR TTAGCAAGGGGGAAGATGCTCTGGTGGTGATGGTCTGTTTTTCTGATGATAGCATATGAATATCCTCCTTAGT ... T*G*G*G*GCAGTTGATGAAACATCGCGCAGCCTGCCGGCCCCACATGGCCTCGACAGCCGCTAGTAGACTTCCGTTGAACT Ligase-catR C*C*C*T*TTTATTATCTACCCAAGATATATGGTAATCTGCAGAAATTATGCTAGGAATGCATGGCCTAATGAGTGAGCTAA Li-CatF TGGGGCAGTTGATGAAACATCGCGCAGCCTGCCGGCCCCACATGGCCTCGACAGCCGCTAGTAGACTTCCGTTGAACT

Ngày tải lên: 02/11/2022, 10:42

12 4 0
Design of a Recruiter-Student Connection System Using Social Networking

Design of a Recruiter-Student Connection System Using Social Networking

... - large public universities have significant masters and doctoral programs Trang 5 Graduate degrees - at large public universities, advanced degree offerings such as an M.A., M.F.A., M.B.A., ... Helping an enterprise to enable its marketing departments to identify and target their best customers, manage marketing campaigns and generate quality leads for the sales team  Assisting the organization ... partners College Board: an organization that prepares and administers standardized tests that are used in college admission and placement In addition to managing tests for which it charges fees, the

Ngày tải lên: 18/10/2022, 22:36

41 6 0
Đồ án thiết kế mạch Điện tử Đề tài  “iot smart home automation system using esp32”

Đồ án thiết kế mạch Điện tử Đề tài “iot smart home automation system using esp32”

... fontColor':'rgba(0,0,255,1)'}}]},'plugins':{'datalabels':{'display':true, 'color':'gray','align':'right','formatter':function(value,context){index= context.dataIndex;data=context.dataset.data;if(index===data.length- ... kích ho t là FALLING attachInterrupt switch_1 thietbi1 FALLING( , , ); attachInterrupt switch_2 thietbi2 FALLING( , , ); attachInterrupt switch_3 thietbi3 FALLING( , , ); attachInterrupt switch_4 ... ReportData.push({Temperature, Humidity, epochTime}); } void Delete_data(unsigned long t ) { while (ReportData size () > 0 &&ReportData[0].EpochTime_number t < ) { Serial.print("xoa

Ngày tải lên: 15/02/2025, 22:18

32 1 0
Tài liệu A WIRELESS SENSOR NETWORK AIR POLLUTION MONITORING SYSTEM pdf

Tài liệu A WIRELESS SENSOR NETWORK AIR POLLUTION MONITORING SYSTEM pdf

... to extract data from database • Data Displayer: This extracts data as required by the user and displays them in a table as well as evaluates the AQI for the selected area • Trend Analyser: ... Initiator: The java DriverManager allows for a method to open a database, providing it the name of the database, user name and password as parameters So, this component just has to make a call ... monitoring system (WAPMS) comprises of an array of sensor nodes and a communications system which allows the data to reach a server The sensor nodes gather data autonomously and the data network

Ngày tải lên: 17/02/2014, 22:20

15 367 1
Therapeutic ultrasound as a potential male contraceptive: power, frequency and temperature required to deplete rat testes of meiotic cells and epididymides of sperm determined using a commercially available system doc

Therapeutic ultrasound as a potential male contraceptive: power, frequency and temperature required to deplete rat testes of meiotic cells and epididymides of sperm determined using a commercially available system doc

... Untreated, retired breeders served as untreated controls Sham-treated animals underwent all preparations for ultrasound treatment as treated animals: anesthesia was administered and main-tained at ... using a commercially available system James K Tsuruta1*, Paul A Dayton3, Caterina M Gallippi3, Michael G O ’Rand1,2, Michael A Streicker4, Ryan C Gessner3, Thomas S Gregory3,6, Erick JR Silva1,2, ... (Mole-cular Devices, Sunnyvale, CA) Statistical analyses One-way ANOVA analyses with post-tests were per-formed using GraphPad Prism version 5.0 d, GraphPad Software, San Diego California USA [6]

Ngày tải lên: 05/03/2014, 17:20

15 968 0
Security and Privacy Vulnerabilities of In-Car Wireless Networks: A Tire Pressure Monitoring System Case Study ppt

Security and Privacy Vulnerabilities of In-Car Wireless Networks: A Tire Pressure Monitoring System Case Study ppt

... Activation signals are mainly used by car dealers to install and diagnose tire sensors, and are manufacturer-specific 2.1 Security and Privacy Analysis Goals Our analysis will concentrate on tracking ... tracking via TPMS and Au-tomatic Number Plate Reading AuAu-tomatic Number Plate Reading (ANPR) technologies have been proposed to track automobiles and leverage License Plate Cap-ture Cameras ... can be measured using the anti-lock braking system (ABS) sensors A lower-pressure tire has to rotate faster to travel the same distance as a higher-pressure tire The disad-vantages of this approach

Ngày tải lên: 23/03/2014, 10:20

16 477 0
Báo cáo hóa học: " Testing the potential of a virtual reality neurorehabilitation system during performance of observation, imagery and imitation of motor actions recorded by wireless functional nearinfrared spectroscopy (fNIRS)" potx

Báo cáo hóa học: " Testing the potential of a virtual reality neurorehabilitation system during performance of observation, imagery and imitation of motor actions recorded by wireless functional nearinfrared spectroscopy (fNIRS)" potx

... representations of the patient’s own arms and hands, which are displayed on a large screen and con-trolled by the patient wearing arm position trackers and data gloves To activate the action-observation ... least squares approximation was subtracted from [O2Hb] and [HHb] for drift elimination Data Analysis Descriptive analysis was calculated for all median signal amplitudes (μmol/l ± SD) Each source-detector ... execution (as in traditional motor learning), imitation, observation (as in observational learning) and motor imagery Activation of these brain areas following observation or motor imagery may thereby

Ngày tải lên: 19/06/2014, 08:20

13 578 0
Báo cáo hóa học: " Results of Clinicians Using a Therapeutic Robotic System in an Inpatient Stroke Rehabilitation Unit" potx

Báo cáo hóa học: " Results of Clinicians Using a Therapeutic Robotic System in an Inpatient Stroke Rehabilitation Unit" potx

... biomechanical and progress data from the robotic system at baseline and at dis-charge An occupational therapist blinded to patient allocation administered the CAHAI-7 and the CMSA at admission and ... preferred a familiar Canadian measure, theCMSA This impairment measure divides arm and hand recovery into separate motor stages (1-7), allowing patients to be placed in similar bins as well as allowing ... age The covariates initial CAHAI and impair-ment score for the arm and hand and side of stroke were not significant for any outcome measure Age was a significant covariate for the outcome measures

Ngày tải lên: 19/06/2014, 08:20

12 369 0
Báo cáo hóa học: "IDEA1: A validated SystemC-based system-level design and simulation environment for wireless sensor networks" pot

Báo cáo hóa học: "IDEA1: A validated SystemC-based system-level design and simulation environment for wireless sensor networks" pot

... the average latency of packets can attain 7.0 ms, Payload is 10 samples which mean that the first sample data should wait... nodes and WSN applications Many COTS hardware platforms have been ... unslotted CSMA-CA algorithm. The para- meters of this algorithm (e.g., macMinBE, macMaxCS- MABackoffs and macMaxFrameRetries)aresetasthe default values defined in IEEE 802.15.4 standard. The TX ... RESEARCH Open Access IDEA1: A validated SystemC-based system-level design and simulation environment for wireless sensor networks Wan Du * , Fabien Mieyeville, David Navarro and Ian O Connor Abstract

Ngày tải lên: 20/06/2014, 22:20

20 408 0
Báo cáo hóa học: " Research Article Trade-Offs between Energy Saving and Reliability in Low Duty Cycle Wireless Sensor Networks Using a Packet Splitting Forwarding Technique" docx

Báo cáo hóa học: " Research Article Trade-Offs between Energy Saving and Reliability in Low Duty Cycle Wireless Sensor Networks Using a Packet Splitting Forwarding Technique" docx

... Messina, Italy 2 Dipartimento di Ingegneria Informatica e delle Telecomunicazioni, Universit`a di Catania, I-95125 Catania, Italy Correspondence should be addressed to Alessandro Leonardi,aleonardi@diit.unict.it ... Forwarding Technique Giuseppe Campobello,1Salvatore Serrano,1Alessandro Leonardi,2and Sergio Palazzo2 1 Dipartimento di Fisica della Materia e Ingegneria Elettronica, Universit`a di Messina, I-98166 ... model and simulations If we consider that TTXj are uniformly distributed between 0 andTAMAX, the random variablez has a triangular distribution function over the range [− T AMAX, +T AMAX], and

Ngày tải lên: 21/06/2014, 11:20

11 352 0
Báo cáo hóa học: " Research Article Centroid Localization of Uncooperative Nodes in Wireless Networks Using a Relative Span Weighting Method" pot

Báo cáo hóa học: " Research Article Centroid Localization of Uncooperative Nodes in Wireless Networks Using a Relative Span Weighting Method" pot

... signal noise, as well as the availability of multiple transmitted messages so that the signal fluctuations can be averaged out Even in a moderately shadowed environment, such approaches may fail ... years, this approach has also served as a network-based technique to localize a transmitting device using two receivers of known coordinates and the transmission’s angle of arrival A significant ... candidate area for the location of a transmitter While open-form solutions may localize a node within an area with a suitable degree of granularity for certain types of applications, other scenarios

Ngày tải lên: 21/06/2014, 23:20

10 294 0
Báo cáo hóa học: "Research Article Rendering-Oriented Decoding for a Distributed Multiview Coding System Using a Coset Code Yuichi Taguchi and Takeshi Naemura" docx

Báo cáo hóa học: "Research Article Rendering-Oriented Decoding for a Distributed Multiview Coding System Using a Coset Code Yuichi Taguchi and Takeshi Naemura" docx

... City and Santa image sets shows a clearer advantage of our method than that for the Meeting room image set, because the former image sets are suitable for generating accurate side information Although ... Therefore, if the cameras have a function that maps pixel values to coset indices and encodes them with an intraimage coder (e.g., the Axis 210 camera we used for the camera array has a built-in JPEG ... 7) are captured by moving a single camera on a control stage, which is an ideal condition for generating accurate side information Since they are captured on a regular 2D grid with a fixed camera

Ngày tải lên: 22/06/2014, 00:20

12 204 0
Báo cáo hóa học: " Research Article LCMV Beamforming for a Novel Wireless Local Positioning System: Nonstationarity and Cyclostationarity Analysis" doc

Báo cáo hóa học: " Research Article LCMV Beamforming for a Novel Wireless Local Positioning System: Nonstationarity and Cyclostationarity Analysis" doc

... has many civilian and military appli-cations For example, in vehicle collision avoidance applica-tions, each vehicle (car) may carry a DBS and each pedestrian may carry a transponder Then, each ... data length for Rq jestimation Ify j q[n] is a stationary and ergodic process, the sample average equals time average, and the sam-ple covariance matrix estimator leads to an accurate estimate ... proposed co-variance matrix estimator has a wide range of applications Beamforming [10] and cyclostationarity [11] have been studied separately for more than fifty years In recent decades, a joint

Ngày tải lên: 22/06/2014, 19:20

12 309 0
Báo cáo hóa học: " A New Position Location System Using DTV Transmitter Identification Watermark Signals" potx

Báo cáo hóa học: " A New Position Location System Using DTV Transmitter Identification Watermark Signals" potx

... tech-niques are also referred to as direction-based and distance-based techniques Direction-distance-based techniques measure the angle of arrival (AOA) using antenna array Because this AOA triangulation ... Watermark Signals Xianbin Wang, 1 Yiyan Wu, 1 and Jean-Yves Chouinard 2 1 Communications Research Centre Canada, 3701 Carling Avenue, Ottawa, Canada ON K2H 8S2 2 Department of Electrical and Computer ... transmitters in operation in the U.S.A., Canada, and Mexico The Advanced Television System Com-mittee (ATSC) DTV signals are entirely different from the analog TV signals and have many new capabilities

Ngày tải lên: 22/06/2014, 23:20

11 259 0
Báo cáo hóa học: "Particle Filtering Algorithms for Tracking a Maneuvering Target Using a Network of Wireless Dynamic Sensors" doc

Báo cáo hóa học: "Particle Filtering Algorithms for Tracking a Maneuvering Target Using a Network of Wireless Dynamic Sensors" doc

... M´ıguez and Antonio Art ´es-Rodr´ıguez Departamento de Teor´ıa de la Se˜nal y Comunicaciones, Universidad Carlos III de Madrid, Avenida de la Universidad 30, Legan´es, 28911 Madrid, Spain Received ... January 2006; Accepted 30 April 2006 We investigate the problem of tracking a maneuvering target using a wireless sensor network We assume that the sensors are binary (they transmit ’1’ for target ... view, a PF algorithm performs a data fusion process that consists of approximating the a poste-riori distribution of the target and sensor trajectories, as well as any estimators that can be

Ngày tải lên: 22/06/2014, 23:20

16 365 0
Vertical Shaft Plumbness Using a Laser Alignment System potx

Vertical Shaft Plumbness Using a Laser Alignment System potx

... space along the shaft The mirror and transducer are attached by a bracket that uses magnets on the turbine shaft From a single 270-degree shaft rotation, the system calculates and displays angularity ... measurement system, known as the PERMAPLUMB®, uses a self-adjusting mechanical mirror, always plumb to earth, that reflects a class 1 laser beam into a detector It requires only 14 of axial space ... Trang 1Vertical Shaft Plumbness Using a Laser Alignment System By Daus Studenberg, Ludeca, Inc ABSTRACT Traditionally, plumbness measurements on a vertical hydro-turbine/generator shaft involved

Ngày tải lên: 08/08/2014, 13:20

11 88 0
Tài liệu Design of a Powerline Home Automation System pdf

Tài liệu Design of a Powerline Home Automation System pdf

... complete home alarm system, but merely illustrates that the home automation system can interface with a larger existing alarm system The alarm interface unit provides the home alarm system with an arm/disarm ... Transmitter), using a serial data speed of 1200 bits/s On the master module, attached to the computer with a 9-way cable, the RS-232 signals are translated into volt binary signals using a Maxim ... that carries any amount of noise, it is possible to transmit data reliably (that is, with an error probability of zero) as long as the data rate is below a certain limit known as the channel capacity...

Ngày tải lên: 19/01/2014, 20:20

55 700 1
wireless home networking for dummies 3rd edition apr 2008

wireless home networking for dummies 3rd edition apr 2008

... has not completely finished agreeing on the 802.11n system standard What they have in place (and what manufacturers are building their systems around) is a draft of the final standard that’s about ... route for each packet to take In the home, a home or broadband router uses a capability called Network Address Translation (NAT) to enable all the computers on a home network to share a single ... Bullock, at Witopia; Melody Chalaban and Jonathan Bettino at Belkin; Shira Frantzich from Sterling PR (for NETGEAR); David Henry at NETGEAR; Karl Stetson at Edelman (for the Wi-Fi Alliance); and Mindy...

Ngày tải lên: 25/03/2014, 16:14

406 407 0
Wireless Home Networking for dummies phần 3 pdf

Wireless Home Networking for dummies phần 3 pdf

... of antenna that you’ve attached to the AP The standard antenna on any AP is an omnidirectional antenna, which broadcasts its signal in a spherical shape The signal pattern that radiates from a ... your AP has an internal antenna and you decide that the signal strength and coverage in your house are inadequate, an external antenna jack allows you to add one or two external antennas Several ... that bundles a wireless AP and a cable/DSL router into a single unit In this case, the wireless Internet gateway also has a connection for a printer and acts as a print server Read through Chapters...

Ngày tải lên: 14/08/2014, 01:20

39 395 0
w